ID: 1014954833

View in Genome Browser
Species Human (GRCh38)
Location 6:127601932-127601954
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014954829_1014954833 -1 Left 1014954829 6:127601910-127601932 CCTTTTTGGCAATCCCATTTACC No data
Right 1014954833 6:127601932-127601954 CTAAATATGTACCTCCCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014954833 Original CRISPR CTAAATATGTACCTCCCTTT TGG Intergenic