ID: 1014956905

View in Genome Browser
Species Human (GRCh38)
Location 6:127630910-127630932
Sequence ATGTTATGCTTCAAGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014956905_1014956908 17 Left 1014956905 6:127630910-127630932 CCTTCTCTCTTGAAGCATAACAT No data
Right 1014956908 6:127630950-127630972 TTCAACCAGCTTGAGAAGATAGG No data
1014956905_1014956907 -10 Left 1014956905 6:127630910-127630932 CCTTCTCTCTTGAAGCATAACAT No data
Right 1014956907 6:127630923-127630945 AGCATAACATGGAAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014956905 Original CRISPR ATGTTATGCTTCAAGAGAGA AGG (reversed) Intergenic
No off target data available for this crispr