ID: 1014966428

View in Genome Browser
Species Human (GRCh38)
Location 6:127758898-127758920
Sequence GCACCAATTACCTAAGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014966428 Original CRISPR GCACCAATTACCTAAGTAAC TGG (reversed) Intronic