ID: 1014974047

View in Genome Browser
Species Human (GRCh38)
Location 6:127856493-127856515
Sequence CTCGCTTGTCCTCTGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 23, 3: 66, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014974047_1014974054 20 Left 1014974047 6:127856493-127856515 CCAGAAGCCAGAGGACAAGCGAG 0: 1
1: 0
2: 23
3: 66
4: 329
Right 1014974054 6:127856536-127856558 GTCAGCTTCCCAGGCAGAGTGGG No data
1014974047_1014974053 19 Left 1014974047 6:127856493-127856515 CCAGAAGCCAGAGGACAAGCGAG 0: 1
1: 0
2: 23
3: 66
4: 329
Right 1014974053 6:127856535-127856557 AGTCAGCTTCCCAGGCAGAGTGG 0: 1
1: 0
2: 1
3: 39
4: 387
1014974047_1014974051 11 Left 1014974047 6:127856493-127856515 CCAGAAGCCAGAGGACAAGCGAG 0: 1
1: 0
2: 23
3: 66
4: 329
Right 1014974051 6:127856527-127856549 CCCACAGAAGTCAGCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014974047 Original CRISPR CTCGCTTGTCCTCTGGCTTC TGG (reversed) Intronic
900089871 1:915454-915476 CCCACCTGCCCTCTGGCTTCGGG - Intergenic
900189427 1:1347057-1347079 CTCCCTGGTCCTCTGGCTGGTGG - Intronic
902747745 1:18484501-18484523 CTCCCATCTCCCCTGGCTTCTGG - Exonic
903474635 1:23611055-23611077 CCCCATTGCCCTCTGGCTTCTGG - Intronic
905017511 1:34787699-34787721 CTGACTTGCCCTCTGACTTCCGG - Intronic
905385830 1:37603441-37603463 CTCCCTTCTCCTTTGGCCTCAGG - Intergenic
906832040 1:49043270-49043292 CTCCTTTGTTCTCTGGATTCTGG + Intronic
906920066 1:50054821-50054843 CTCCCTTGCACTCTTGCTTCTGG + Intronic
906937532 1:50227096-50227118 CTTCCTTGCCCTCAGGCTTCTGG + Intergenic
907107730 1:51899452-51899474 CTCCTTTGCCCTCTGGCTTTTGG + Intergenic
907857022 1:58313522-58313544 ATGTCTTATCCTCTGGCTTCTGG - Intronic
907965347 1:59323467-59323489 CATGCTTATCCTGTGGCTTCTGG - Intronic
908529528 1:65021093-65021115 TTCTCTTGTCTTCTGGCTTCTGG - Intergenic
908751189 1:67424934-67424956 CACGTTTGTCCTCGTGCTTCAGG + Exonic
908797660 1:67847110-67847132 CTCCCTTGTCCTCTAGCTTCTGG + Intergenic
909044922 1:70698452-70698474 CTCCTGTGTCCTCTGGCTTGTGG - Intergenic
909236974 1:73164987-73165009 CTACCTGGCCCTCTGGCTTCTGG - Intergenic
909591332 1:77352414-77352436 CTCCCTTGTTTACTGGCTTCAGG - Intronic
909809837 1:79918908-79918930 CTCCCTTATTCTCTGGTTTCTGG - Intergenic
910011972 1:82475513-82475535 CTCTCTTGTGATCTAGCTTCTGG - Intergenic
910985593 1:93002116-93002138 CTTCCAAGTCCTCTGGCTTCTGG + Intergenic
910992147 1:93067489-93067511 CTCCCTTGCCCTCTGGCTTCTGG + Intergenic
911316161 1:96359131-96359153 TTCCCATGTTCTCTGGCTTCTGG - Intergenic
911706543 1:101020424-101020446 CTCCCTCCTCCTCTGGCTCCAGG + Intronic
911831852 1:102560295-102560317 CTCTCTTCTCTTTTGGCTTCAGG - Intergenic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
912583285 1:110738664-110738686 TTTCCTTGTCTTCTGGCTTCAGG + Intergenic
912878684 1:113388692-113388714 CTCCCTTGCCCTCTGGCGTCTGG + Intergenic
913100533 1:115560078-115560100 GTCTCTTGTCCTCTGGCTTCTGG - Intergenic
916530571 1:165652674-165652696 CTTGCTTGTCTTCTGGCTGGAGG - Intronic
917612132 1:176699478-176699500 GTCCCTTGTGCTCTGGCTGCAGG + Exonic
917927391 1:179800585-179800607 ATGGCCTGTCCTCTGGTTTCAGG - Intronic
919630383 1:199954920-199954942 CTCCCCTGTCCCCTGGCTTTTGG - Intergenic
921410619 1:214832608-214832630 CATGCTTCTCCCCTGGCTTCCGG + Intergenic
922543052 1:226433580-226433602 CCCCCTTCTCCTCCGGCTTCTGG + Intergenic
923205439 1:231754335-231754357 CTGGCATCTGCTCTGGCTTCTGG + Intronic
923220766 1:231891060-231891082 CTTCCTTGTCCTCTGGCTGAAGG + Intronic
923978829 1:239297213-239297235 CTCCCTTATCCTCTGACTTTGGG + Intergenic
1062855059 10:775874-775896 CTCGGTTCCCCTCTGGCCTCAGG + Intergenic
1062951784 10:1508915-1508937 TTTCCTTCTCCTCTGGCTTCAGG + Intronic
1063707454 10:8444637-8444659 CTCAATTCTCCTCTGGCTGCGGG + Intergenic
1065947909 10:30624226-30624248 TTCCCATGTCCTCTGACTTCTGG + Intronic
1066062682 10:31737940-31737962 GTCCCTTGTCCTGTTGCTTCTGG + Intergenic
1068116235 10:52740403-52740425 CTCGCTTGGCATCTGGCATTTGG - Intergenic
1068939337 10:62665309-62665331 CTTCCTTGTCTTGTGGCTTCTGG - Intronic
1069274235 10:66569138-66569160 CTCCTTTGTTCTCTGGCTTCTGG - Intronic
1070406748 10:76104359-76104381 CTCCATTGCCCTCTGGCTTCTGG + Intronic
1071365989 10:84901119-84901141 CTCTCTTTGCCTCTGGCTTCTGG + Intergenic
1071930046 10:90458745-90458767 GCAGTTTGTCCTCTGGCTTCTGG - Intergenic
1073592349 10:104769269-104769291 CTGGCTTTTCCTCTGGCTGTGGG - Intronic
1074598311 10:114887936-114887958 CTTTCTTGCCCTCTGACTTCTGG + Intronic
1075262377 10:120974405-120974427 CTCTCTTGCCCTCTTGCTTCTGG + Intergenic
1075509050 10:123054235-123054257 CAGGCTGGTCTTCTGGCTTCTGG + Exonic
1075705197 10:124496461-124496483 CTCGCTTGACCTCCGGCTAACGG + Intronic
1077439938 11:2563386-2563408 CTTGCTGGCCCTCCGGCTTCGGG + Intronic
1078469982 11:11578965-11578987 CTCTCTTGCCCCCTGGCTTCAGG + Intronic
1078650483 11:13186244-13186266 CTCCTTTGCCCTCTGCCTTCTGG - Intergenic
1078705617 11:13740937-13740959 TTCCCTTGCCTTCTGGCTTCCGG + Intergenic
1079175586 11:18137337-18137359 CGCGGTTGTGCTCTGGCTCCTGG + Exonic
1079177216 11:18153420-18153442 CGCGGTTGTGCTCTGGCTCCTGG + Intronic
1079179152 11:18173391-18173413 CGCGGTTGTGCTCTGGCTCCTGG + Exonic
1079263873 11:18911240-18911262 CGCGGTTGTGCTCTGGCTCCTGG - Intergenic
1079269694 11:18972546-18972568 CGCGGTTGTGCTCTGGCTCCTGG - Intergenic
1081596142 11:44460872-44460894 CTCCCCTGCCCTCAGGCTTCTGG - Intergenic
1082067884 11:47915591-47915613 TTCCCTTACCCTCTGGCTTCCGG + Intergenic
1084115696 11:67041801-67041823 TTCCCTTGGCCTTTGGCTTCTGG - Intronic
1084440944 11:69172844-69172866 GTCCTTTGCCCTCTGGCTTCTGG - Intergenic
1085720867 11:78911423-78911445 CTCCCTTGCCCACTGGCTTCTGG + Intronic
1085755269 11:79196706-79196728 CACACTTGTTCTCAGGCTTCTGG + Intronic
1087312828 11:96569819-96569841 CCCTCTTATCCTCTGGATTCAGG + Intergenic
1087491416 11:98832162-98832184 CCTGTTTGTCCTCTGGTTTCAGG + Intergenic
1087791194 11:102407731-102407753 CATGCCTCTCCTCTGGCTTCTGG - Intronic
1089025486 11:115265361-115265383 CTTCCTGGGCCTCTGGCTTCTGG + Intronic
1089626500 11:119754515-119754537 CTCTCTTACCTTCTGGCTTCTGG - Intergenic
1090051412 11:123382960-123382982 TTCTCTTGCCTTCTGGCTTCTGG - Intergenic
1091724588 12:2836855-2836877 CACGCCTCTCCCCTGGCTTCTGG - Intronic
1092904302 12:13088063-13088085 CTCCCTCTTCCTCTGGTTTCTGG - Intronic
1093172938 12:15879363-15879385 CTCCCTTGTCTTCTGGGCTCTGG + Intronic
1095392786 12:41728794-41728816 GTCTCTTGTCTTCTGGCTTTTGG - Intergenic
1095945917 12:47753369-47753391 CTAGCTTCCCATCTGGCTTCAGG + Intronic
1096116939 12:49060369-49060391 CTCCCTTCCCCTCTGGCCTCGGG + Intergenic
1100195692 12:92241812-92241834 CTTCCTTGCCCCCTGGCTTCTGG - Intergenic
1100774148 12:97955878-97955900 CTGTCTTGCCCTTTGGCTTCTGG - Intergenic
1101860705 12:108480200-108480222 CTCCCCAGTCCTCTGGCTTCAGG + Intergenic
1102625592 12:114233085-114233107 CTCCCTTGCCCTCTGGCTTCAGG + Intergenic
1103080491 12:118020128-118020150 CTCACTTACCCTCTGGCTCCTGG + Intronic
1103764522 12:123271231-123271253 CTCCTTTTTCCTCCGGCTTCTGG - Intronic
1104379156 12:128291758-128291780 TTCCCTTGTTTTCTGGCTTCTGG + Intronic
1104419182 12:128621148-128621170 CTCCCTTGCCCTCTGGCTTCTGG + Intronic
1104498465 12:129262938-129262960 CACCCTTGGTCTCTGGCTTCTGG + Intronic
1104549121 12:129739719-129739741 CTTCCTCATCCTCTGGCTTCTGG + Intronic
1105284820 13:18995248-18995270 TTCCCTTGTCTTCTTGCTTCTGG - Intergenic
1105934048 13:25082016-25082038 CTCTCTTGCCCTCTTGCCTCTGG + Intergenic
1106161398 13:27204231-27204253 CTCTCTTGCCCTCTGCATTCTGG + Intergenic
1107288284 13:38821893-38821915 CTCACTTGGCCTCAGGCTCCCGG + Intronic
1107484330 13:40811892-40811914 ATCCCTGGCCCTCTGGCTTCTGG - Intergenic
1108164448 13:47677437-47677459 CTCTCTTGCCCTCTGGCTCCAGG - Intergenic
1110850477 13:80239264-80239286 CTTTCATGCCCTCTGGCTTCTGG - Intergenic
1112126211 13:96471229-96471251 CTTGGATGTCCTCTGCCTTCAGG + Intronic
1112239323 13:97665313-97665335 CCTGCTTCTCCTCTAGCTTCTGG - Intergenic
1112598678 13:100833398-100833420 CACGCCTCTCCCCTGGCTTCTGG - Intergenic
1113271210 13:108676725-108676747 CACGCCTCTCCTCTGGCTTCTGG - Intronic
1113731436 13:112644433-112644455 CATCCCTGTCCTCTGGCTTCAGG + Intergenic
1113940084 13:114014483-114014505 CTTGCGTGTCCTGTGGCCTCGGG - Intronic
1114692827 14:24600943-24600965 CAGGCCTGTCCTCTGGCTCCTGG + Intergenic
1116497126 14:45574730-45574752 CTCTCTTGTCCTCTGGCTCCTGG + Intergenic
1119181682 14:72609631-72609653 CACCCTTGTCCTCTGTCCTCTGG - Intergenic
1121345977 14:93136174-93136196 CCCGCTGGTCCTCTCTCTTCAGG + Intergenic
1121378236 14:93433606-93433628 CTCGTTTCTCCTCTGCATTCAGG + Intronic
1121910607 14:97789028-97789050 GTAGGGTGTCCTCTGGCTTCAGG + Intergenic
1122044111 14:99011235-99011257 CTCCCTGCTCCTCTGCCTTCTGG - Intergenic
1122816026 14:104314533-104314555 CGGGCTTGTCCTTTGGCTGCAGG - Intergenic
1202853260 14_GL000225v1_random:35097-35119 CTTGCTTATGCTCTGCCTTCAGG - Intergenic
1123404316 15:20011021-20011043 CTCCGTTGTGCTCTGGCTGCTGG + Intergenic
1123513651 15:21017668-21017690 CTCCGTTGTGCTCTGGCTGCTGG + Intergenic
1125136913 15:36354257-36354279 TTCTTCTGTCCTCTGGCTTCTGG - Intergenic
1125852191 15:42914447-42914469 ATGGCTTGTACTCTGGCTTCTGG + Intronic
1126241475 15:46449667-46449689 CTCCCTTGCCCTCTTGCTTTGGG - Intergenic
1126729813 15:51671412-51671434 CACCCTTGTCCTCTAGTTTCTGG + Intergenic
1126871759 15:52996792-52996814 CTCTCTTGCCCTGTGGCTTCTGG + Intergenic
1130422732 15:83764442-83764464 CTCCCTTGCCCTCTGGCTTCTGG + Intronic
1130990507 15:88873113-88873135 GTCCCTTGTCTTCTGGCTGCTGG + Intronic
1132066366 15:98734261-98734283 TTGGCATGTCCTATGGCTTCAGG - Intronic
1132807466 16:1781810-1781832 CTCGCTCCTCCTCTGTCGTCCGG + Intronic
1134883726 16:17771467-17771489 CTATCTTTTCCTCTGACTTCTGG - Intergenic
1135017613 16:18936899-18936921 ATCCCTTGTCCTGTGTCTTCTGG + Intergenic
1135458932 16:22624255-22624277 CTCACCTGTCCTCAGGCTCCTGG - Intergenic
1136183836 16:28573303-28573325 CTCCCTTCTCCTCTGGCTTCAGG - Intronic
1136581214 16:31152067-31152089 CTCCCTTGAACTCTGGCCTCTGG - Intergenic
1137764883 16:50970360-50970382 CTTCCTTACCCTCTGGCTTCTGG - Intergenic
1138179630 16:54932860-54932882 CGCCCTTGTCCTCGGGCTTCTGG - Exonic
1138203061 16:55104478-55104500 CTCCCTCGCCCTCTAGCTTCTGG + Intergenic
1138560590 16:57798564-57798586 CTGGCTTGTCCTCAGGCTCCAGG - Intronic
1140202432 16:72905378-72905400 CTCAGTTGTCCTCTGGCTGGGGG - Intronic
1140955981 16:79865996-79866018 CTCCCTTGGCCTCTTTCTTCTGG + Intergenic
1141175089 16:81713478-81713500 CTAGCTGGTCCTCTGGCCTGAGG - Intergenic
1141527250 16:84618966-84618988 CTCGCGTTTACTCTGGATTCTGG + Intergenic
1144029035 17:11303652-11303674 CTCCCTTGTCCTCTGTATGCTGG - Intronic
1144233985 17:13238950-13238972 CTCTCTTGTCCTCAGGTTTCTGG - Intergenic
1144430339 17:15185480-15185502 CTCCCTTGACCTGTGGCTTCTGG + Intergenic
1144501258 17:15787760-15787782 CCGCCTGGTCCTCTGGCTTCAGG + Intergenic
1144557445 17:16294691-16294713 CTCCCATGTCCATTGGCTTCTGG + Intronic
1147460636 17:40565862-40565884 ATGGCTTTCCCTCTGGCTTCTGG + Intergenic
1148539352 17:48467475-48467497 CTCCCTTGTCATCTGGCTTCTGG + Intergenic
1148688062 17:49511870-49511892 CTGGCCTGTCCTCTGGCTCCAGG + Exonic
1149457767 17:56802198-56802220 CTCCCTTGGCCTGTGGCTTCTGG + Intronic
1151572001 17:74931086-74931108 CTGGCGTCTCCACTGGCTTCTGG - Exonic
1152233672 17:79127312-79127334 CTGGGTTGTCCTCTGGCTCGTGG - Intronic
1152293194 17:79452515-79452537 GTCCCCTGCCCTCTGGCTTCTGG + Intronic
1155157580 18:23170397-23170419 CACACCTGCCCTCTGGCTTCTGG + Intronic
1155454646 18:25998157-25998179 CACTCTTCTCCACTGGCTTCTGG - Intergenic
1156051604 18:32942496-32942518 CTCTCTTGTGCTCTGACTTATGG - Intronic
1158557503 18:58487351-58487373 CATGCCTCTCCTCTGGCTTCCGG - Intronic
1158629018 18:59096001-59096023 CTTGCCTCTCCCCTGGCTTCTGG - Intergenic
1160044637 18:75375495-75375517 CTTGGGTGTCCTCTGGCTGCGGG + Intergenic
1161136268 19:2621815-2621837 CTTCCGCGTCCTCTGGCTTCTGG - Intronic
1163200769 19:15767360-15767382 CCCGCTTGCCCCCTGGGTTCTGG + Intergenic
1163630470 19:18415687-18415709 AACGCTTTTTCTCTGGCTTCTGG - Intergenic
1164952515 19:32349253-32349275 CTCCCCTGTCCTCTGCCTTCTGG - Intronic
1165002468 19:32776313-32776335 CTCCCAGTTCCTCTGGCTTCAGG + Intronic
1165372020 19:35414529-35414551 CTCCCTTGTCCTCTGCCATGTGG + Intergenic
1168590678 19:57632093-57632115 TTCCCTTGTCCGTTGGCTTCAGG + Intronic
925368295 2:3325843-3325865 CACCCTTATCCTGTGGCTTCAGG + Intronic
925818519 2:7776866-7776888 TTCATTTCTCCTCTGGCTTCTGG + Intergenic
926584076 2:14666073-14666095 CTCCTTTGCTCTCTGGCTTCTGG + Intergenic
927065118 2:19463271-19463293 CTTCCTTGACCTCTGGCTACTGG - Intergenic
927392970 2:22616252-22616274 CTCCCTTGCCCTCTGACTCCAGG - Intergenic
927872365 2:26631749-26631771 CTCCCTTTCCCTCTGGCTTAAGG + Intronic
928230583 2:29495253-29495275 CTCCCTGGCTCTCTGGCTTCTGG + Intronic
928235008 2:29531683-29531705 GCAGCTGGTCCTCTGGCTTCTGG + Intronic
928458483 2:31447562-31447584 AAAGCTTTTCCTCTGGCTTCTGG + Intergenic
928890700 2:36199815-36199837 ATCACTTGTCCTCTGGTTTCTGG + Intergenic
929723216 2:44393824-44393846 CTAGCTTGTCCTCTGACCTCTGG + Intronic
930425880 2:51211789-51211811 CTTCCTTGTCAACTGGCTTCTGG - Intergenic
930492000 2:52085840-52085862 CTGGATTGTCCTTTGGCTTAAGG + Intergenic
930747583 2:54900720-54900742 CTCCCTTGTCCTCTGGTTTCAGG - Intronic
931426592 2:62177316-62177338 CTTCCCTGTCCTCTGACTTCTGG - Intergenic
932633386 2:73366518-73366540 CTCCCTTGTCCCCTGCCCTCTGG - Intergenic
932835414 2:75031315-75031337 CTCCCTTGCTTTCTGGCTTCTGG + Intergenic
933105431 2:78318779-78318801 CTCCCTTGTCGTCTGGCTGCTGG + Intergenic
933793383 2:85901713-85901735 TTCTCTTGTCTTCTGGCTTCGGG + Intergenic
935093287 2:99917322-99917344 ATCTCCTGCCCTCTGGCTTCTGG - Intronic
935605596 2:104969662-104969684 ATCCATTGTTCTCTGGCTTCTGG + Intergenic
935682091 2:105647045-105647067 CTCCCTCCTCCTCGGGCTTCTGG + Intergenic
938928318 2:136064302-136064324 CTTCCTTGACCTCTGGCTTCTGG - Intergenic
939196672 2:138981323-138981345 CTCTCTTGCCTTCTGGCTTCTGG - Intergenic
939215840 2:139237172-139237194 CTTCCTTCCCCTCTGGCTTCTGG - Intergenic
939844660 2:147228799-147228821 CTCTCTTGTCTACTAGCTTCTGG + Intergenic
940810371 2:158235995-158236017 CTTCCTTGCCCTCTGGCTTTTGG - Intronic
941099870 2:161283729-161283751 CTTCCTTGCCTTCTGGCTTCTGG + Intergenic
941316058 2:163994046-163994068 CTCCCTTGTCCTCTGAATTCTGG - Intergenic
941510071 2:166396264-166396286 TTCTCTTGACCTCCGGCTTCCGG - Intergenic
941926668 2:170902444-170902466 CTCCCTTTATCTCTGGCTTCTGG + Intergenic
944432378 2:199647096-199647118 CTCCCTTGCCCTCTGGCTTCTGG + Intergenic
945286284 2:208085941-208085963 CTCTCTTCTCCTTTAGCTTCTGG + Intergenic
945474469 2:210264849-210264871 CTCCCTTGTCCCTTGGCTTCTGG + Intergenic
945691631 2:213044034-213044056 CTCCGTTGTCCTCTGGCTTCTGG + Intronic
946045677 2:216819020-216819042 CTTCCTTGCCCTCTGGCTTCTGG - Intergenic
946414795 2:219534575-219534597 CTCCCTTGTCCTCTGGCTTTGGG - Intronic
946496681 2:220202520-220202542 CTGGCATCTCCTCTGGCCTCAGG + Intergenic
946523038 2:220487172-220487194 CTCTCTTGCCTTCTGTCTTCTGG - Intergenic
946569330 2:221004541-221004563 TGCCCTTGCCCTCTGGCTTCTGG - Intergenic
946862901 2:224016955-224016977 CTCTCTTGTTCTCTAACTTCTGG - Intronic
947663527 2:231888099-231888121 CCCCCAGGTCCTCTGGCTTCTGG + Intergenic
947854576 2:233314452-233314474 TTCCCTGGTCTTCTGGCTTCTGG - Intronic
948288223 2:236803801-236803823 CTCCTTTACCCTCTGGCTTCGGG + Intergenic
948613194 2:239182400-239182422 CTCACTTTCCCTCTGGGTTCTGG - Intronic
948671369 2:239570819-239570841 CTCATTTATCCTCTGGCTCCAGG - Intergenic
948890483 2:240904903-240904925 CAAGCATGACCTCTGGCTTCAGG - Intergenic
1169512022 20:6274773-6274795 TGGGCTTCTCCTCTGGCTTCTGG + Intergenic
1169746237 20:8945940-8945962 CCCTCTTGCCCTCTGACTTCTGG + Intronic
1169843627 20:9966067-9966089 CTCTCTTGCCCTCTGGTCTCTGG - Intergenic
1171879354 20:30605658-30605680 CTCACTTCTCCTTTGTCTTCAGG + Intergenic
1172014861 20:31867284-31867306 CTCCCTGATCCTCTTGCTTCTGG + Intronic
1173158185 20:40632590-40632612 GTCCCTTGTCCTCCGGCATCAGG + Intergenic
1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG + Intronic
1173667421 20:44772805-44772827 CTCTCTTGTCCTCTGGCAGGAGG - Intronic
1174163885 20:48571091-48571113 CTGGCTTGTCCTCTCACTCCAGG - Intergenic
1174239256 20:49119792-49119814 CTCGCATGTCCACTGGCCCCAGG - Intronic
1175797213 20:61779340-61779362 CTAGCTTGTCCTCTGGCAGGGGG - Intronic
1175834629 20:61985718-61985740 CTCACTTCTCCTCAGGCCTCAGG - Intronic
1176300596 21:5097211-5097233 CACGCTTGACCTCAGGCTCCTGG - Intergenic
1177103880 21:16930961-16930983 TTCTCTTGTTCTCTGGCTTATGG - Intergenic
1177967755 21:27749476-27749498 CTCTCTTGTTCTCTGGCATCTGG - Intergenic
1179039237 21:37787091-37787113 CTCTTTTGTCCTCTGAATTCAGG + Intronic
1179140471 21:38720565-38720587 CTCTCTTGTCAACTGCCTTCTGG + Intergenic
1179856447 21:44164770-44164792 CACGCTTGACCTCAGGCTCCTGG + Intergenic
1180855839 22:19044225-19044247 CTGGGCTGGCCTCTGGCTTCTGG - Intronic
1180955520 22:19739620-19739642 CTCGCCTGTCCCCTGGCTACCGG - Intergenic
1183933181 22:41247770-41247792 CTGGCCTGTTCACTGGCTTCAGG - Intronic
949536047 3:4996997-4997019 CTAGCTTCTCCTCTGTCTTAAGG - Intergenic
950198819 3:11028524-11028546 CTCACTGGTCCTCTTGCCTCTGG + Intronic
950707355 3:14791382-14791404 CTCCCTTGTCCTCTGGGATGTGG + Intergenic
951472547 3:23071680-23071702 CTTCCTTCTCCTCTTGCTTCTGG - Intergenic
951510818 3:23500087-23500109 CTTGCTTGGGCTCTGGCTCCAGG - Intronic
952225168 3:31367578-31367600 CTCCCTTGCCCTCTAGGTTCTGG - Intergenic
952238705 3:31507445-31507467 GTTACTTGCCCTCTGGCTTCCGG - Intergenic
952354819 3:32574281-32574303 GTCTCTTGTCCTCTGGCTCCTGG - Intergenic
953194730 3:40721688-40721710 CTTCCTTGCTCTCTGGCTTCTGG + Intergenic
953582724 3:44171926-44171948 CTGCCTTGCCCTCTGGCTTCTGG + Intergenic
954242889 3:49308046-49308068 CTAGCTTTGCCCCTGGCTTCTGG + Intronic
954951427 3:54477690-54477712 CTGGCTTGTCCTCTGGCTCCAGG + Intronic
955319953 3:57967262-57967284 CTTGCCTGTCTCCTGGCTTCTGG + Intergenic
955473662 3:59313347-59313369 CTCTCTTGACCTTGGGCTTCAGG + Intergenic
955878766 3:63521932-63521954 CTCTTTTGTCCTCTGGTTTCTGG - Intronic
955939244 3:64132313-64132335 CTCTCTTGCTCTCTGGCTGCTGG + Intronic
956899875 3:73704284-73704306 CTCTCCTGTCTTCTGGCTTTAGG - Intergenic
957149583 3:76468730-76468752 CTCCCATGTCCTCTCTCTTCAGG + Intronic
959139723 3:102471174-102471196 CTCCCTTGCCCTCTAGTTTCTGG + Intronic
961401058 3:126643203-126643225 CAGCCTTGCCCTCTGGCTTCTGG - Intronic
961498798 3:127315743-127315765 CTTGGTTGTTCTCTGGTTTCTGG + Intergenic
961547850 3:127647872-127647894 CTGGAATGTCCCCTGGCTTCAGG - Intronic
962042776 3:131724517-131724539 CACCCTTGCCCTCTGGGTTCTGG + Intronic
963055986 3:141186653-141186675 CTCTCTAGTTCTCTGACTTCTGG + Intergenic
963120179 3:141769672-141769694 CTCCCTTGCCCTCTGGCTTCTGG + Intergenic
963167331 3:142218465-142218487 CTCGCTGAACCTCTGCCTTCCGG - Intronic
963465693 3:145678577-145678599 CTCCCTTGTCCTCTGGCATCTGG - Intergenic
963607886 3:147427910-147427932 CTCGCTAGGCCTCTGTCTTTTGG + Intronic
964192120 3:154015506-154015528 CTGGCTTGCCCTCAGGCTACTGG + Intergenic
964605160 3:158553114-158553136 TTCCCTTGCCCTCTGGCTTCTGG + Intergenic
965071762 3:163923968-163923990 GTCTCTTGTCCTGTGGCTTTGGG + Intergenic
966896834 3:184451423-184451445 CTCACTTCACCTCTGCCTTCTGG + Intronic
967811881 3:193767509-193767531 CTGGCTTGTCCTCTGGGCCCTGG + Intergenic
968448486 4:664092-664114 CTCCCTTGTTCCCTGGGTTCAGG + Exonic
968877755 4:3282985-3283007 CTCCCTTTCCTTCTGGCTTCTGG + Intergenic
970626859 4:17895700-17895722 CTCCCTTGTCCTATGACTCCTGG + Intronic
972095882 4:35346476-35346498 GTCTCTTGCCCTCTGGGTTCTGG - Intergenic
972240559 4:37187388-37187410 CTTCCTTTTCCTCTGGATTCTGG - Intergenic
972367465 4:38389939-38389961 CTTCATTGTCCTCTGGCTTCTGG - Intergenic
973344186 4:49036707-49036729 GTCCCTTGCCTTCTGGCTTCTGG + Intronic
973652314 4:53008278-53008300 CTCTCTTGCCCTATGGTTTCTGG - Intronic
975469334 4:74747274-74747296 CTCCATTGCCCTCTGGTTTCTGG + Intronic
975749517 4:77508429-77508451 CTCCCTTGACCAGTGGCTTCTGG - Intergenic
975812208 4:78181398-78181420 CACGTTTGTCCTCGTGCTTCAGG + Intronic
976441911 4:85085596-85085618 CTCCCTTGCCCTCCGGCTTCTGG - Intergenic
976494915 4:85716968-85716990 CTCTCTTGATCTCTGGCTTCAGG - Intronic
977503769 4:97877225-97877247 CTCCCTTTTCCCCTAGCTTCTGG + Intronic
977664532 4:99630397-99630419 CACTCTTGCCCTCTGGCTCCTGG - Intergenic
977716303 4:100187764-100187786 GTCGCTTCTCCTCTGGTTTCAGG - Exonic
978368692 4:108008792-108008814 CATGCCTGTCCTCTTGCTTCTGG + Intronic
978486144 4:109255665-109255687 CTCACTTTTCTTCTGGCTTAGGG - Intronic
982330533 4:154177436-154177458 CTTTCTTGCCCTCTGGCTTCTGG + Intergenic
982454651 4:155594377-155594399 CTGCCTTGCCCTCTGACTTCTGG - Intergenic
984808865 4:183776298-183776320 CCCTCTTGCCCTCTGACTTCCGG - Intergenic
985382816 4:189413548-189413570 CTCCCTTGCCTTCTGGCTTTTGG + Intergenic
986424256 5:7614667-7614689 CTCCTTTGCCCTCTGGCTTCAGG + Intronic
986530016 5:8726592-8726614 CTCTCTTGCCATCTGGCTCCTGG - Intergenic
986964600 5:13255184-13255206 CTCGCCTTACCTGTGGCTTCAGG + Intergenic
987092937 5:14523478-14523500 CTCTCCTGTCCTCTGGCTTTTGG - Intronic
987276701 5:16370685-16370707 GTCTCTTGTCCTCTGGCTTCTGG - Intergenic
989457032 5:41656406-41656428 CTCTTTTGACATCTGGCTTCAGG + Intergenic
989716012 5:44464143-44464165 CTCGCTCGACCTCTGCCTCCTGG - Intergenic
990039465 5:51361813-51361835 TTCTCTTTTCCCCTGGCTTCTGG - Intergenic
990328693 5:54703823-54703845 CTCCTTTGTCCCCTGGCTTCTGG - Intergenic
990338253 5:54796114-54796136 CCAGCTTATACTCTGGCTTCTGG + Intergenic
990737744 5:58882049-58882071 CTCCCTGGTCCTCTAGATTCTGG + Intergenic
990983178 5:61619707-61619729 CTCCCTTGCCCTCTGGCTTCTGG - Intergenic
991054337 5:62305910-62305932 CTTTCTTGCCCTCTCGCTTCCGG - Intergenic
991246518 5:64514049-64514071 CATGCTTCTCCTCTAGCTTCTGG + Intronic
992015161 5:72567991-72568013 CTCCCTTGCCAACTGGCTTCTGG + Intergenic
992681387 5:79156864-79156886 CTCGCTTGTCAACTGGCTCCTGG - Intronic
993013485 5:82510063-82510085 CTCCCTTGCCTTCTGGCTTCTGG - Intergenic
993041885 5:82823916-82823938 ATTTCTTGCCCTCTGGCTTCTGG - Intergenic
993486238 5:88489666-88489688 CTAGCATGTCCTTTGCCTTCAGG + Intergenic
993660794 5:90631699-90631721 CTGGTTTGTCCTGTGGCTTGTGG + Intronic
995012884 5:107277544-107277566 CTCCCTCGTCTTCTGGCCTCAGG - Intergenic
996234384 5:121108260-121108282 CTCGTGTTTTCTCTGGCTTCAGG - Intergenic
996293007 5:121876392-121876414 CAGGCTTTTCCTTTGGCTTCAGG - Intergenic
996330688 5:122325247-122325269 CTCCCTTGTTCTCTGGCTTCCGG + Intronic
996880381 5:128290228-128290250 CTGGCTTGGCCTCTGGGTTAGGG - Intronic
997950755 5:138241035-138241057 CTCCCTTGTCAGCTGGCTTTTGG - Intergenic
999060559 5:148629896-148629918 CTTTCTTGCCCACTGGCTTCAGG + Intronic
1000029302 5:157388311-157388333 CTGGCTTTTCATCTGGGTTCTGG - Intronic
1001285137 5:170417595-170417617 CCCTCTTGTCGTCTGGGTTCTGG + Intronic
1001679267 5:173544295-173544317 CCCCCATGGCCTCTGGCTTCTGG + Intergenic
1002441628 5:179267305-179267327 GGCGCTTGTCCTCTGTCTCCTGG + Intronic
1002449304 5:179309960-179309982 CACCCCTGCCCTCTGGCTTCTGG + Intronic
1003840055 6:10111032-10111054 CTCCCTTGTCCTCTGGCTGCTGG + Intronic
1003840451 6:10113752-10113774 CTCGATTTTCCTCTGACTTTGGG + Intronic
1004333263 6:14740711-14740733 CTCTATTGCCCTGTGGCTTCTGG - Intergenic
1004780611 6:18904418-18904440 TTCTTTTATCCTCTGGCTTCTGG + Intergenic
1004780708 6:18905567-18905589 CTCTCATGCCCTCAGGCTTCTGG + Intergenic
1005016890 6:21383089-21383111 CAGGCTTCTCCCCTGGCTTCCGG + Intergenic
1005617282 6:27586115-27586137 CTCCCTTGTCAACTGACTTCTGG - Intergenic
1005831312 6:29673163-29673185 CTGGATGGACCTCTGGCTTCTGG + Exonic
1005833204 6:29687390-29687412 TTCTCTTGTCCTCTGACTACTGG - Intergenic
1005971792 6:30767552-30767574 CTGGCTTGTCCTCTGTGTTCTGG + Intergenic
1007717958 6:43868208-43868230 CTCTCCTGCCCTGTGGCTTCTGG - Intergenic
1007870723 6:45034331-45034353 CTCTCTTGCCCTCTGACTTCTGG - Intronic
1008154224 6:47994143-47994165 ATCCCTTGTCCTCTGGCTTTTGG - Intronic
1008954053 6:57195451-57195473 CCCGCTATTTCTCTGGCTTCTGG + Intronic
1009623531 6:66106312-66106334 TTCTACTGTCCTCTGGCTTCAGG + Intergenic
1010505112 6:76647592-76647614 CTTTCTTGTCCTCTAGCTTCTGG - Intergenic
1013097352 6:106957709-106957731 CTCTTTTGGCCTCTGGCTACTGG - Intergenic
1013479694 6:110543189-110543211 CCCCATTGCCCTCTGGCTTCTGG - Intergenic
1014974047 6:127856493-127856515 CTCGCTTGTCCTCTGGCTTCTGG - Intronic
1015547521 6:134376719-134376741 CTCACTTGCCCTCTGGTTTCTGG + Intergenic
1015629728 6:135219689-135219711 CTCCCTTGTCCTCCAGCTTCTGG - Intergenic
1017291642 6:152744733-152744755 CACCCTGGTCCTCTGGCTGCTGG - Intergenic
1018435344 6:163753946-163753968 CAGGCCTCTCCTCTGGCTTCTGG + Intergenic
1019003674 6:168778137-168778159 GTCTCTTGACCTCTGGCCTCAGG - Intergenic
1019664752 7:2246259-2246281 CTCTCGTGTCATCTGGCTGCCGG + Intronic
1020086595 7:5313741-5313763 CTCGCTTGTCCACAGGCTCTGGG + Exonic
1020785455 7:12567974-12567996 CTCTGATGTCCTCTGGCTTGAGG - Intergenic
1022648706 7:32255418-32255440 AACACTTGGCCTCTGGCTTCAGG + Intronic
1023212313 7:37819949-37819971 CTCTCTTGCCTTCTGGCTTCTGG - Intronic
1023621863 7:42081613-42081635 CTCGGTTATTCTCTGGCTACAGG - Intronic
1023649322 7:42352017-42352039 TTCCCCTGCCCTCTGGCTTCTGG + Intergenic
1023991314 7:45130419-45130441 CTTGCCTGTCATCTGGGTTCAGG + Intergenic
1025207718 7:57003397-57003419 CTCGCTTGTCCACAGGCTCTGGG - Intergenic
1025664218 7:63573475-63573497 CTCGCTTGTCCACAGGCTCTGGG + Intergenic
1027235345 7:76294621-76294643 CTCCCTGGACCTCTGGTTTCTGG - Intergenic
1027583622 7:80028696-80028718 TTCTCTTGACCTCTGGCTTCTGG - Intergenic
1028002177 7:85513133-85513155 CTCTCTTGACCTTGGGCTTCTGG + Intergenic
1028645852 7:93095941-93095963 CTCCCTTGTCCTCTAGTTTCTGG + Intergenic
1028675736 7:93458535-93458557 CTGCCTTGCCCTCTGGTTTCTGG + Intronic
1029544000 7:101200884-101200906 ATCGTTTGTCCTCCGGGTTCTGG - Exonic
1032921727 7:136556696-136556718 ATCCCTAGTCCTGTGGCTTCTGG + Intergenic
1034477079 7:151291465-151291487 CTCTCTTATCTTCTGGCTTCTGG - Intergenic
1035844056 8:2844083-2844105 ATCCCGTGTCCTCTGGATTCCGG + Intergenic
1035876484 8:3195344-3195366 CTCTCTTGGCCTCTGTTTTCAGG + Intronic
1038069961 8:24002887-24002909 ATATTTTGTCCTCTGGCTTCTGG - Intergenic
1038370811 8:26988415-26988437 ATCACTTTTCCTCAGGCTTCTGG + Intergenic
1039485862 8:37909302-37909324 CACTCGTGTCCTCTGGCTTCTGG - Intergenic
1040516087 8:48136360-48136382 CTCCCTTTCCTTCTGGCTTCTGG + Intergenic
1042064317 8:64857432-64857454 GTCTCTTGCCCTTTGGCTTCTGG - Intergenic
1043187914 8:77178533-77178555 CTCCCTTGCATTCTGGCTTCTGG + Intergenic
1044584851 8:93859739-93859761 CGTGGTTGTCCTCTGGTTTCAGG - Intronic
1044607194 8:94057716-94057738 CTCCCTTGTGCTCTGGCTTCTGG - Intergenic
1044648477 8:94469382-94469404 CTTGCTTCTCCTTTGCCTTCCGG + Intronic
1045955232 8:107898194-107898216 CTCCCTTGCCTACTGGCTTCTGG + Intergenic
1046794261 8:118353804-118353826 ATCCCTTGCCCTCTAGCTTCTGG + Intronic
1047362778 8:124184316-124184338 CTGCTTTGCCCTCTGGCTTCGGG + Intergenic
1047716122 8:127596741-127596763 TTGGCTTTTCCTCTGGCTCCTGG - Intergenic
1048498513 8:134955650-134955672 CCCCCTGGTCCTCTGGCTTCTGG + Intergenic
1049019570 8:139946446-139946468 CTCCCTTGTCCTCTGGAGTCGGG + Intronic
1049683397 8:143929799-143929821 GGCGCTGCTCCTCTGGCTTCAGG + Exonic
1050569643 9:6924373-6924395 CCCCCTTTCCCTCTGGCTTCTGG + Intronic
1051448485 9:17167954-17167976 CTCCATTGTCCTCTTCCTTCTGG + Intronic
1051796781 9:20880485-20880507 CTCCCATGTCCTCTGGCTTCTGG - Intronic
1052086689 9:24275900-24275922 CTCCCATGTACTCTGGCTTCTGG - Intergenic
1052933141 9:34072098-34072120 CCTTCTTGTCCTCTGCCTTCTGG - Intergenic
1053121071 9:35547865-35547887 CTGGCTGGACTTCTGGCTTCTGG - Exonic
1053281265 9:36820964-36820986 CCCCCTTGCCCTCTAGCTTCTGG - Intergenic
1053671090 9:40362925-40362947 CTCCCTCATCCTCTGGCTTCAGG + Intergenic
1053920898 9:42989305-42989327 CTCCCTCACCCTCTGGCTTCAGG + Intergenic
1054382206 9:64502989-64503011 CTCCCTCACCCTCTGGCTTCAGG + Intergenic
1054513524 9:66013375-66013397 CTCCCTCATCCTCTGGCTTCAGG - Intergenic
1055723297 9:79199671-79199693 TTCCCTTGACCTCTGGCTTCTGG - Intergenic
1056453083 9:86735312-86735334 CCCCTTTGTTCTCTGGCTTCTGG - Intergenic
1058153820 9:101489687-101489709 CTCTCTTGCCCTCTGATTTCTGG - Intronic
1058404096 9:104652344-104652366 CTCATTTGTCCTCTGAGTTCTGG + Intergenic
1059372507 9:113854185-113854207 CTCCCCTGCCCTTTGGCTTCTGG + Intergenic
1059525389 9:114986638-114986660 CTCCTTTGTCCTCTGCCCTCTGG - Intergenic
1059925987 9:119209491-119209513 CTCACTTGACCTCTGCCTCCCGG - Intronic
1060077965 9:120611577-120611599 CTCCCTTTTCCTCTGGCCTTAGG - Intronic
1060595327 9:124844382-124844404 CTCTCTTCTCTACTGGCTTCTGG - Intergenic
1061992146 9:134165168-134165190 CTCGCGTGTCCTCCGGCTCCAGG + Intergenic
1062192088 9:135253334-135253356 CTCCCTTGTGCTGTGGGTTCGGG - Intergenic
1187117430 X:16366602-16366624 CTTTCCTGACCTCTGGCTTCTGG - Intergenic
1187571800 X:20511606-20511628 CTTTCTTGCCCTCTGGCTTTTGG + Intergenic
1188051524 X:25492782-25492804 TTCACTTGTCCTCCAGCTTCTGG - Intergenic
1188154375 X:26722892-26722914 CTGGCCTGTCCTCTGGCCCCTGG - Intergenic
1189115112 X:38334421-38334443 CTCTCATGTCTTCTGGCTTTTGG - Intronic
1189280261 X:39816175-39816197 CTGCCTTGACCACTGGCTTCTGG - Intergenic
1189589546 X:42496733-42496755 CTCCCTTGACTTCTGGCTTCTGG + Intergenic
1189694636 X:43651995-43652017 CTCCCTTGTTTTCTAGCTTCTGG + Intergenic
1189744636 X:44157470-44157492 CTTCCTTGCTCTCTGGCTTCTGG + Intronic
1190031651 X:46978724-46978746 CCAGCCTGTCCTCTGGCTTCTGG + Intronic
1191692102 X:63950864-63950886 TTCCCTTGTTCTGTGGCTTCTGG + Intergenic
1192056643 X:67780464-67780486 TTCTCTTTTCCTCTGGCTCCAGG - Intergenic
1192160695 X:68784514-68784536 CACGTTTGTCCTCGTGCTTCAGG - Intergenic
1192545502 X:72009370-72009392 CTCCCTTGCCCTCTGGCTTCGGG - Intergenic
1195777055 X:108418706-108418728 ATAGTTTGTCCTCTGGCATCAGG - Intronic
1195974480 X:110511443-110511465 CTCCTTTGCCCTCTGGCATCTGG + Intergenic
1198076144 X:133194934-133194956 CTCTTCTGCCCTCTGGCTTCAGG - Intergenic
1198269916 X:135047134-135047156 TTCCCTTGCTCTCTGGCTTCTGG + Intergenic
1199215499 X:145256263-145256285 CTGTCTTGTTCTATGGCTTCGGG - Intergenic
1199940001 X:152615970-152615992 CTGGCTTGTGCTCTGGCTCATGG - Intergenic