ID: 1014977223

View in Genome Browser
Species Human (GRCh38)
Location 6:127902400-127902422
Sequence TTTCTTTAGTAACCAAACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 2, 3: 43, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014977223 Original CRISPR TTTCTTTAGTAACCAAACCC AGG Intronic
901901728 1:12369810-12369832 TTTCATTCTTTACCAAACCCTGG + Intronic
906422407 1:45680959-45680981 ATTCATTAGTAACCAAAACCAGG + Intronic
906469103 1:46112632-46112654 TTACTTTAGCAACTAAAACCTGG + Intronic
906564309 1:46787359-46787381 TTGATTTAGGAACCAAATCCAGG + Intronic
908855404 1:68421239-68421261 TTTTTGTTGTAACCAAAACCTGG + Intergenic
910266079 1:85339160-85339182 TTTCTTTTTTACCCACACCCTGG - Intronic
912980012 1:114362902-114362924 TTGATTTAGGATCCAAACCCAGG - Intergenic
913655755 1:120957970-120957992 TTGATTTAGGAACCAAACCCAGG + Intergenic
914007330 1:143743767-143743789 TTGATTTAGGAACCGAACCCAGG + Intergenic
914318483 1:146536372-146536394 TTTATTTAGTAACCAAATTGGGG - Intergenic
914495877 1:148196985-148197007 TTTATTTAGTAACCAAATTGGGG + Intergenic
914646146 1:149654249-149654271 TTGATTTAGGAACCGAACCCAGG + Intergenic
915346137 1:155197928-155197950 TTTCTTTACTATACAACCCCAGG - Exonic
916945300 1:169720213-169720235 TTTCAGTAATAACAAAACCCCGG + Intronic
917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG + Intronic
921679660 1:218015394-218015416 TTGATTTAGAAACCATACCCTGG - Intergenic
922913377 1:229235749-229235771 GTTCTTCAATAACAAAACCCAGG - Intergenic
923840322 1:237663993-237664015 TTTCTTTAGTATCCCTACCAAGG - Intronic
924350697 1:243112107-243112129 TATGTGTTGTAACCAAACCCAGG + Intergenic
1064010165 10:11729332-11729354 TTGCTATTGTAACCTAACCCAGG - Intergenic
1065776999 10:29130331-29130353 TATCTTTAGTAAACACACACTGG + Intergenic
1065868601 10:29935720-29935742 CTTCATTATAAACCAAACCCTGG + Intergenic
1066066800 10:31767376-31767398 TATCTTTAGTAAACTAACCCAGG - Intergenic
1068154272 10:53176682-53176704 TTTTTATAGTCACCAAAGCCTGG + Intergenic
1068448639 10:57157883-57157905 TTTCTTTAGTAAGTAAACCAAGG + Intergenic
1071192226 10:83114637-83114659 TTTCCTTAGTAAACTAACCCAGG + Intergenic
1073996061 10:109316741-109316763 TTTCTTTATTAACCCAGCCTCGG - Intergenic
1074697758 10:116065988-116066010 TTTCTTTAGTAACCTAGTCCTGG - Intronic
1075754253 10:124798487-124798509 TTTCTTCAGTGAGCAAACCTAGG + Intergenic
1076935009 10:133562100-133562122 TTGATTTAGGAACCAAACCCAGG - Intronic
1079962899 11:26945812-26945834 TCTTTTTAGTTACCAAAGCCAGG - Intergenic
1080622247 11:33996614-33996636 TTACATTAGTAATCAAACCCTGG + Intergenic
1081438115 11:43050482-43050504 TTTTTTTAGGAAGCAAACCAAGG - Intergenic
1083383479 11:62288568-62288590 TTGATTTAGGAACCAAAGCCAGG + Intergenic
1088161287 11:106874313-106874335 TTTCTTTATTAATCAATTCCTGG - Intronic
1088603594 11:111507574-111507596 ATTCTTTACTGACCAAACCTTGG + Intronic
1090455961 11:126850068-126850090 TTTCTTTAGCCACCAAAGCGGGG + Intronic
1093355798 12:18165170-18165192 TTTCTGTAGTAACAAAATCAGGG - Intronic
1093568937 12:20643389-20643411 ATTCTCTGGTAACCCAACCCAGG - Intronic
1093585292 12:20828815-20828837 TGGATTTAGGAACCAAACCCAGG + Intronic
1093708669 12:22304084-22304106 TTGATTTAGGAAACAAACCCAGG - Intronic
1094467824 12:30772179-30772201 TTGATTTAGGAACCAAACCCAGG - Intergenic
1094725987 12:33116796-33116818 TTTTTTTACTAACGGAACCCTGG + Intergenic
1095482789 12:42652984-42653006 TTTTTTTAATCACCAGACCCTGG - Intergenic
1095724990 12:45441925-45441947 TTTTTTTAATAACCAAATTCTGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097567726 12:61292243-61292265 TATCTTTAGTAAACTAACACTGG + Intergenic
1100109589 12:91223230-91223252 TTTCATGAGAAGCCAAACCCGGG + Intergenic
1100172853 12:91996366-91996388 TATCTACAGTAACAAAACCCAGG - Intronic
1100459839 12:94788333-94788355 TTTCTCTAGTACCCAAGCCTGGG - Intergenic
1101574081 12:105981263-105981285 TTTCTTTAGTAATGAACTCCAGG + Intergenic
1102509684 12:113405931-113405953 TTGATTTAGGAACCAAGCCCAGG - Intronic
1105608853 13:21949709-21949731 TTTCTTTAAGAAGTAAACCCAGG - Intergenic
1106236036 13:27861271-27861293 CTTCCTTAAAAACCAAACCCAGG - Intergenic
1107883349 13:44852916-44852938 ATTATTTAGTAGCCAAAACCAGG - Intergenic
1111189400 13:84788990-84789012 TTTTTCTATTAATCAAACCCTGG - Intergenic
1112108027 13:96263839-96263861 TTTCTTGATTAACAAATCCCTGG + Intronic
1113144733 13:107196026-107196048 TATCTTTAGTAAACTAACACAGG + Intronic
1114759465 14:25297059-25297081 TTTCTTAAGTGACCACACACAGG - Intergenic
1116025940 14:39514905-39514927 TTTCTTAAGTACTGAAACCCAGG - Intergenic
1117078947 14:52132038-52132060 ATCCTTTAGCAACCAAAACCCGG + Intergenic
1118631863 14:67712721-67712743 TTGATTTAGGAACCAAACCTAGG + Intronic
1118936425 14:70292999-70293021 TTGATTTAGGAACCAAACCCAGG - Intergenic
1119196828 14:72723313-72723335 CTTCTTTAGTAACCAAGCAGTGG + Intronic
1119373998 14:74173966-74173988 TGTCTTTAGTGAAGAAACCCAGG + Intronic
1121853147 14:97241984-97242006 ATTCTTTAAGAATCAAACCCAGG + Intergenic
1122186843 14:100005811-100005833 TTGATTTAGGAACCAAACCCAGG + Intronic
1122434325 14:101683890-101683912 TTGATTTAGGAACCAAACCCAGG + Intergenic
1122574329 14:102732173-102732195 TTGCTTTAGAAACCAATCCCAGG - Intergenic
1123472825 15:20567720-20567742 GTTCTTTAAAAACCAAACCACGG + Intergenic
1123645180 15:22432633-22432655 GTTCTTTAAAAACCAAACCACGG - Intergenic
1123733130 15:23162711-23162733 GTTCTTTAAAAACCAAACCACGG + Intergenic
1123751260 15:23360087-23360109 GTTCTTTAAAAACCAAACCACGG + Intronic
1124283635 15:28384005-28384027 GTTCTTTAAAAACCAAACCACGG + Intronic
1124299064 15:28527608-28527630 GTTCTTTAAAAACCAAACCACGG - Intronic
1127926082 15:63544312-63544334 CTTCTTTTGTAACCAAATGCAGG + Intronic
1128289852 15:66469869-66469891 TTGATTTAGGAACCAAACCTAGG + Intronic
1130012777 15:80164920-80164942 TTTCTTTAGTTAACAAAACGAGG + Intronic
1131000968 15:88939683-88939705 TTGACTTAGGAACCAAACCCAGG - Intergenic
1131591157 15:93749874-93749896 TTTTTTTATAAACCAACCCCTGG - Intergenic
1132231058 15:100184593-100184615 TTTCTTTGGGGACCAGACCCTGG + Intronic
1134105521 16:11483368-11483390 TCTTTTTAATAGCCAAACCCTGG + Intronic
1135502991 16:23013324-23013346 TTTCTCTATTAAACAAAACCTGG - Intergenic
1136012680 16:27374260-27374282 TTGCTTTAGCAATCAAAACCAGG - Intergenic
1137481094 16:48852550-48852572 CTTCTTTAGTAAGCACACCTCGG + Intergenic
1137837157 16:51603575-51603597 TGTCTTTAGTAAACTAACGCAGG - Intergenic
1139152722 16:64403306-64403328 CTTCTTTAGTAACTAAAACGTGG - Intergenic
1140399281 16:74657309-74657331 TTTCTTTAATAATCACTCCCTGG + Intronic
1146195684 17:30810782-30810804 TCTTTTTAGTAACTAAACTCTGG - Intronic
1147761818 17:42803136-42803158 TTTGTTTAGTAACCACCCTCTGG - Intronic
1148445563 17:47734968-47734990 TTTGTTTAGTAAGCAACCCCCGG + Intronic
1148898127 17:50852431-50852453 CTTCTTTATTCATCAAACCCAGG - Intergenic
1154375293 18:13803922-13803944 CTTCTTTAGGATCTAAACCCTGG - Intergenic
1155801163 18:30105278-30105300 TATCTTTAGCAAACTAACCCAGG - Intergenic
1156211931 18:34953523-34953545 TTTCATTTGGAATCAAACCCTGG - Intergenic
1157643273 18:49239897-49239919 TTTATTTCATAACCACACCCAGG + Intronic
1157912549 18:51630937-51630959 TTGATTTAGGAACCAAAGCCAGG - Intergenic
1160467025 18:79086853-79086875 TGACTTTAGTAGCAAAACCCAGG - Intronic
1164390548 19:27816103-27816125 TTTCCTTAGTAAACTAACACAGG - Intergenic
1164469279 19:28515602-28515624 TTTGTTTATTTACCAAACCAGGG + Intergenic
1168135356 19:54347474-54347496 TATCCTTAGTAAACAAACACAGG + Intergenic
925318314 2:2941596-2941618 TTTCTTTAAAAAGCAAACCTGGG - Intergenic
928149525 2:28813129-28813151 TGTCTTTAATAAGCAAACACTGG - Intronic
930135883 2:47904838-47904860 TGTCTTTAGTTACGAACCCCTGG - Intronic
933178264 2:79200908-79200930 TTGATTTAGAAACCAAACCCAGG + Intronic
934890028 2:98059304-98059326 TTCCTTGAGTATCCAAACCAGGG - Intergenic
935591701 2:104851323-104851345 TTTATTTAAAAACCTAACCCTGG - Intergenic
936477366 2:112850869-112850891 TTGATTTAGGAACCAAACCCAGG - Intergenic
936613566 2:114025905-114025927 TATCTTTAGTAAACTAACACAGG + Intergenic
937734491 2:125273191-125273213 TTTCTTTAGTAGTTTAACCCTGG - Intergenic
939011071 2:136846279-136846301 TCTCCTTAGTTACCCAACCCAGG - Intronic
939700908 2:145389225-145389247 TTTCCTTAGTAAACTAACGCAGG - Intergenic
940447499 2:153793389-153793411 TCTCTTTACAATCCAAACCCAGG + Intergenic
940653261 2:156458269-156458291 TCTCTTTAGTTAACACACCCAGG - Intronic
940805511 2:158182279-158182301 TTTCCTTAGGAATCAATCCCAGG - Intronic
941989413 2:171540412-171540434 TATTTATAGTAACCAAAACCTGG - Intronic
942402838 2:175621663-175621685 TTCCTTTAGTAACCAAACCCTGG + Intergenic
943876470 2:193073085-193073107 TATCTTCAGTAGCCAAAGCCTGG + Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944293090 2:198030280-198030302 TATCTTTAGCAAACAAACACAGG - Intronic
944802023 2:203245608-203245630 TTTCTTTAGCAAACTAACACAGG - Intronic
945868937 2:215206007-215206029 TTGATTTAGGAACAAAACCCAGG - Intergenic
946494222 2:220179250-220179272 TTTCTTTAGTCATCAACCTCTGG - Intergenic
1169636150 20:7693991-7694013 TTTCTTTAGTCATCTATCCCAGG - Intergenic
1170313723 20:15019493-15019515 TTTCTGTATTTACCAAAGCCTGG + Intronic
1171036760 20:21718702-21718724 TTTCTTTTGAAAAGAAACCCAGG - Intergenic
1175682401 20:60999371-60999393 TTGCTTTGCTCACCAAACCCTGG - Intergenic
1177589541 21:23144884-23144906 TTGATTTAGGAACCAAACCCAGG + Intergenic
1177658126 21:24046270-24046292 TATTTTTTGTAACCAAACACCGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1179440740 21:41392093-41392115 TATCCTTAGTAAACTAACCCAGG - Intronic
1179559478 21:42204860-42204882 TTTATTTAGTTAGCATACCCAGG - Intronic
1179965903 21:44805315-44805337 TTTCTTTACATACGAAACCCAGG + Intergenic
1179966469 21:44809616-44809638 TTTCTTTACATACGAAACCCAGG + Intronic
1180256517 21:46633520-46633542 TTAATTTAGGAACTAAACCCAGG + Intergenic
1182909422 22:33969189-33969211 TTTCCTAGGTAACCAACCCCAGG - Intergenic
1184167326 22:42737611-42737633 CTTCATTTGTAACCAAACACAGG - Intergenic
1184917455 22:47579975-47579997 TTGATTTAGGAACCAAACCCAGG - Intergenic
950238275 3:11342840-11342862 TTTTTTTAGGAAAAAAACCCTGG + Intronic
950857876 3:16122269-16122291 TCTATTTAGTATCCAAACTCTGG + Intergenic
950918835 3:16671991-16672013 TTGATTTAGGAACCAAACCCAGG - Intergenic
952436015 3:33273139-33273161 TTTCTTTATTAAGCACTCCCTGG + Intergenic
952578801 3:34806364-34806386 TTTCTTTGGTAACAAAATCAGGG - Intergenic
953783636 3:45894239-45894261 TTTCTTCAGTACACAAACCTAGG + Intronic
954650334 3:52157617-52157639 TTGATTTAGGAACCAAACCCAGG - Intergenic
956488588 3:69747707-69747729 TGTCTTTATAAACCTAACCCTGG + Intronic
959957847 3:112259171-112259193 TATCTTTAGTAAACTAACGCAGG + Intronic
961230467 3:125302929-125302951 TATTTTTAATAACCAAAACCTGG + Intronic
961870366 3:129983311-129983333 TTTCTTTAGTAATCTTACCAAGG + Intergenic
962035676 3:131649015-131649037 ACTCATTACTAACCAAACCCAGG - Intronic
963896397 3:150689415-150689437 TTGATTTAGGAACAAAACCCAGG - Intronic
963975359 3:151474240-151474262 TTTCTGTAGTAACGAAATCAGGG - Intergenic
966811394 3:183848171-183848193 TTTCTTAAGTAAATACACCCTGG - Intronic
966951994 3:184828887-184828909 TCCCTTTAGTACCCAAACCCAGG + Intronic
968043081 3:195604229-195604251 TTGATTTAGGAACCAAACCCAGG - Intergenic
968807027 4:2780727-2780749 CTTGTTTAGGAACCAAACCCAGG + Intergenic
970631619 4:17953011-17953033 TATCTTTAGTAAACTAACGCAGG - Intronic
970934892 4:21557824-21557846 TTTCTATAGTTACAAAGCCCAGG - Intronic
972981932 4:44714641-44714663 AGTTTTTATTAACCAAACCCTGG + Intronic
973246023 4:48012336-48012358 TTGATTTAGGAACCAAACCCAGG + Intronic
973587869 4:52410494-52410516 TATCTATAGTAACCAGCCCCAGG - Intergenic
974386280 4:61203919-61203941 TTTTTTTTGTAACCAAAGCAAGG + Intronic
976657197 4:87501386-87501408 TTTCTTGAGAAACCACACACAGG + Intronic
979251239 4:118568440-118568462 TATGTGTTGTAACCAAACCCAGG - Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982196987 4:152926466-152926488 TTGATTTAGGAACAAAACCCAGG + Intergenic
983706999 4:170674037-170674059 CTTCTTTGCTAACCAAGCCCTGG + Intergenic
984031314 4:174607194-174607216 TTGATTTAGGCACCAAACCCAGG - Intergenic
984170859 4:176357838-176357860 TTGATTTAGAAACGAAACCCAGG + Intergenic
985158636 4:187020187-187020209 TTTCTTAAGGAACAAAACACAGG + Intergenic
986365946 5:7031814-7031836 TTGATTTAGGAACCAAACCCCGG + Intergenic
987729275 5:21747515-21747537 TTCCTTTAGTAACCAAACTCAGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987785784 5:22496904-22496926 TTGCATTAGTAATCAAATCCTGG + Intronic
988708914 5:33754164-33754186 TTTCTTTGGAAAGCAAACCACGG - Intronic
989018922 5:36976887-36976909 TTTTTTTAGTAAACAAATCATGG + Intronic
989316577 5:40087179-40087201 TTGATTTAGGAACCAAACCTAGG - Intergenic
992146322 5:73853028-73853050 TTACTTTAGTAACAGAACCCTGG + Intronic
992684065 5:79182078-79182100 TTTCTTTAGAAACCAAAATGGGG + Intronic
994411720 5:99414821-99414843 TATCTTTAGTAAACTAACACAGG - Intergenic
994482104 5:100350429-100350451 TATCTTTAGTAAACTAACACAGG + Intergenic
995522191 5:113019621-113019643 TTTCTTCAGTAACAAAAACAGGG + Exonic
996340926 5:122438093-122438115 TTTCTTTAGCAAGTAAAGCCTGG - Intronic
996506325 5:124271311-124271333 TTGTTTTTGTAACCAGACCCTGG + Intergenic
996974968 5:129421142-129421164 TTTCTTTAGTGAAGAAAACCTGG - Intergenic
997250982 5:132388315-132388337 TTGCTTTCTTAAGCAAACCCAGG - Intronic
997467372 5:134097184-134097206 TTTCTTTTGGAAGGAAACCCAGG + Intergenic
998093750 5:139385312-139385334 TTTCCTTAGTAAAGAAGCCCTGG - Intergenic
998608497 5:143662402-143662424 TTTCTCTGGCAACCAAACCAAGG - Intergenic
999358361 5:150958449-150958471 TTGACTTAGGAACCAAACCCAGG - Intergenic
999462402 5:151769025-151769047 TTCCTTTATTATACAAACCCAGG + Intronic
999700325 5:154221683-154221705 TTTCTTCAGTACCCAAGTCCTGG - Intronic
999900921 5:156086299-156086321 ATACTTCTGTAACCAAACCCAGG + Intronic
1002059981 5:176620382-176620404 TTTTTTTTTTAACCAAAACCAGG - Exonic
1003174499 6:3745034-3745056 TTTCTTAGGTAACCCAAACCTGG + Intronic
1003996893 6:11550543-11550565 CTTCCTTAGTACCAAAACCCTGG - Intronic
1005812075 6:29525065-29525087 TTTATTTAGGAACCAAACCCAGG + Intergenic
1007499143 6:42281986-42282008 TTTCTTTAGGATACATACCCAGG + Intronic
1009541197 6:64960922-64960944 TATCTTTAGCAAACTAACCCAGG - Intronic
1009749218 6:67861640-67861662 TTGATTTAGGAACCAAACCCAGG + Intergenic
1010910217 6:81544673-81544695 TATCTTTAGTAAAAGAACCCAGG + Intronic
1012531854 6:100247691-100247713 TTTCTTCAGTAAACAAGCACTGG - Intergenic
1012787663 6:103652682-103652704 TTTACTTAATAATCAAACCCAGG + Intergenic
1014273176 6:119357146-119357168 TTTGTTTAGTAGTCAAACCAAGG + Intergenic
1014977223 6:127902400-127902422 TTTCTTTAGTAACCAAACCCAGG + Intronic
1015409996 6:132883378-132883400 TTTCTTGAGGAACCAAATGCAGG - Intergenic
1016377721 6:143440672-143440694 TGTCTATATTAACCAAACCTCGG - Intronic
1018193330 6:161330691-161330713 TTGATTTAGGAACCAAACCCAGG - Intergenic
1022752012 7:33238986-33239008 TTTCTTTAGAATCAAATCCCAGG + Intronic
1024821698 7:53338191-53338213 TTAATTTAGGAATCAAACCCAGG - Intergenic
1026430492 7:70342225-70342247 TTTCTTAAGTAAGCCAACTCTGG + Intronic
1027594856 7:80160300-80160322 TTTTTTTAGTAACCAAAATGAGG - Intronic
1028173954 7:87631329-87631351 TTTCCAGAGTCACCAAACCCTGG + Intronic
1028538725 7:91919111-91919133 TTTCTTGATTAACCCAACCAGGG + Intergenic
1033089814 7:138375005-138375027 GTCCTTTTGTAACCAAACTCAGG - Intergenic
1033881615 7:145890872-145890894 TTTTATTAGGAACCAAATCCTGG - Intergenic
1035631708 8:1111671-1111693 TATCTTTAGCAAACTAACCCAGG - Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1038056642 8:23864751-23864773 CTTCTCTAGTCACCCAACCCAGG - Intergenic
1042044663 8:64636123-64636145 TTTCTCTATTAACTTAACCCTGG + Intronic
1042105766 8:65324606-65324628 TTTCTTCAGTAAGCACACACTGG - Intergenic
1048527908 8:135221387-135221409 TTTGTGTAGTAACTAAACCTCGG - Intergenic
1048563172 8:135564844-135564866 TTTCTTTTGTAATCACACCCAGG + Intronic
1049909759 9:254131-254153 TTAATGTAGTAACCAGACCCAGG + Intronic
1050000445 9:1071914-1071936 CTTCTTTAGTAACAGAGCCCTGG + Intergenic
1051256837 9:15222465-15222487 ATTCTTTACTAACCAATCCAAGG + Intronic
1053482526 9:38426141-38426163 TTGCTATAGTAACCAACTCCAGG - Intergenic
1186289817 X:8084248-8084270 TTTCTTAAGTAACGAAAAGCTGG - Intergenic
1187671135 X:21667050-21667072 TTTCTTAAGAAATAAAACCCTGG - Intergenic
1187821475 X:23292773-23292795 TTTCTTTGGTAACCAAGCCAGGG - Intergenic
1188697534 X:33214196-33214218 TATTTGTAGTGACCAAACCCTGG - Intronic
1189724617 X:43955640-43955662 GATCTTTTGTACCCAAACCCAGG + Intronic
1190001854 X:46696507-46696529 TATGTTTAGTAAGCAAAACCAGG - Intronic
1191839923 X:65504834-65504856 TTTCTCTAGGAAACAAAACCAGG + Exonic
1193265021 X:79457578-79457600 TTGATTTAGAAACCAAACCCAGG - Intergenic
1193319099 X:80098910-80098932 TTGATTTAGGAACAAAACCCAGG - Intergenic
1193393340 X:80955610-80955632 TTTCTGTAGTAACAAAATCAGGG + Intergenic
1194044304 X:88983008-88983030 TTGATTTAGGAACCAAACCCAGG + Intergenic
1194159283 X:90431373-90431395 TTGTTTTAGGAACCAAACCCAGG + Intergenic
1196861956 X:120036994-120037016 TTGATTTAGGAACCAAACCCAGG - Intergenic
1196869882 X:120102651-120102673 TTGATTTAGGAACCAAACCCAGG - Intergenic
1197568607 X:128120394-128120416 TTGATTTAGGAATCAAACCCAGG + Intergenic
1198155810 X:133959264-133959286 TTTCTTTAGTCACCTCCCCCAGG + Intronic
1198566553 X:137911089-137911111 TTGCTATAATAACCAAATCCAGG + Intergenic
1198854073 X:140997172-140997194 TTGATTTAGGAAGCAAACCCAGG - Intergenic
1198877940 X:141247943-141247965 TTGATTTAGGAAGCAAACCCAGG + Intergenic
1198886980 X:141350086-141350108 TATCTTTAGCAAACTAACCCAGG + Intergenic
1199644733 X:149896473-149896495 TTGATTTAGGAACCAAACCGAGG + Intergenic
1200325389 X:155232893-155232915 ACTCTGTAGTAACCAAAACCTGG + Intronic
1200505584 Y:4008342-4008364 TTGTTTTAGGAACCAAACCCAGG + Intergenic