ID: 1014983325

View in Genome Browser
Species Human (GRCh38)
Location 6:127972056-127972078
Sequence CTGTAGAAAGGGTGGAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014983317_1014983325 14 Left 1014983317 6:127972019-127972041 CCAGGGAAATGAGGTGGTGTAGG 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1014983325 6:127972056-127972078 CTGTAGAAAGGGTGGAAGTCTGG No data
1014983316_1014983325 15 Left 1014983316 6:127972018-127972040 CCCAGGGAAATGAGGTGGTGTAG 0: 1
1: 0
2: 1
3: 4
4: 154
Right 1014983325 6:127972056-127972078 CTGTAGAAAGGGTGGAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014983325 Original CRISPR CTGTAGAAAGGGTGGAAGTC TGG Intronic
No off target data available for this crispr