ID: 1014988829

View in Genome Browser
Species Human (GRCh38)
Location 6:128048441-128048463
Sequence CTAATGCTCCTGCCCTACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1014988824_1014988829 -2 Left 1014988824 6:128048420-128048442 CCGCATATGTTCCCTCTGCCTCT 0: 1
1: 0
2: 3
3: 58
4: 928
Right 1014988829 6:128048441-128048463 CTAATGCTCCTGCCCTACATGGG 0: 1
1: 0
2: 0
3: 8
4: 64
1014988823_1014988829 8 Left 1014988823 6:128048410-128048432 CCTCAAGGTTCCGCATATGTTCC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1014988829 6:128048441-128048463 CTAATGCTCCTGCCCTACATGGG 0: 1
1: 0
2: 0
3: 8
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014988829 Original CRISPR CTAATGCTCCTGCCCTACAT GGG Intronic
901122637 1:6907811-6907833 CTTCTGCTCCTGCCCCACCTGGG + Intronic
902794617 1:18793149-18793171 CTTATGCTCCTGCCCTGTCTGGG + Intergenic
906697530 1:47833414-47833436 CAAATGCTACTGCCCTATCTGGG - Intronic
909209989 1:72810801-72810823 CTAATGTTTCTCACCTACATTGG + Intergenic
919682607 1:200451225-200451247 CTAGAGCCCCTGCCCTACATTGG + Intergenic
920759683 1:208770635-208770657 CCAATGCACCTGCCGTACAAAGG + Intergenic
923197542 1:231683051-231683073 CTAAATCTTCTACCCTACATAGG - Intronic
1064782969 10:18863143-18863165 CTACTGCTCCTCCTCTACAGTGG - Intergenic
1067405464 10:46019261-46019283 CTAATGCTTCTGCCTAACACAGG - Intronic
1071391019 10:85175422-85175444 CTTATCCTCCTTCCCTCCATTGG + Intergenic
1073631678 10:105155739-105155761 ATCATGCCCCTGCCCTACCTTGG + Intronic
1081038012 11:38174416-38174438 ATAATGCAGCTGCCCTAAATAGG - Intergenic
1107414843 13:40190857-40190879 CTAAGTCTCCTGCCTTACATTGG + Intergenic
1109136644 13:58659777-58659799 ATGCTGCTCCTGCCCTTCATTGG + Intergenic
1110466997 13:75813591-75813613 CTCATGTTCCTGCCTTACACAGG + Intronic
1116591944 14:46788203-46788225 CTAGTCCTCCTCCCCTACACTGG - Intergenic
1122147938 14:99704929-99704951 ACAATGCTCCTGCCCACCATGGG - Intronic
1124621502 15:31276642-31276664 CTCATGCTCCTCCCCACCATGGG + Intergenic
1130944042 15:88537562-88537584 ATATTGCTTTTGCCCTACATAGG + Intronic
1131440149 15:92453830-92453852 ACAAGGCTCCTGCCCTCCATTGG + Intronic
1135303347 16:21349476-21349498 CGCATGCTCCTGACCTTCATCGG + Intergenic
1137838186 16:51614698-51614720 ATAATGCTCCTGGCCAACATAGG - Intergenic
1139102825 16:63789022-63789044 CTAATGCTACTGCCTCATATGGG - Intergenic
1139167738 16:64589240-64589262 TTATTTCTGCTGCCCTACATGGG + Intergenic
1141894202 16:86948131-86948153 CTGAAGCTCCTGCCCTTCACAGG + Intergenic
1148613270 17:48979399-48979421 CCACTGCGCCTGGCCTACATAGG - Intergenic
1150523042 17:65889594-65889616 CTAATTCTCTTTCCCTCCATAGG + Intronic
936690399 2:114881170-114881192 CTACTGATCCTCCTCTACATTGG - Intronic
942907906 2:181206070-181206092 TAAATGCTCCTGTTCTACATGGG + Intergenic
1170687364 20:18581580-18581602 CCACTGCACCTGGCCTACATTGG + Intronic
1172048586 20:32099131-32099153 CTGATGCCCCTTCCCTACCTGGG - Exonic
1173843382 20:46173587-46173609 CTCCTGATCCTGCCCTGCATGGG - Intergenic
1177226396 21:18262538-18262560 ATAATGGAGCTGCCCTACATAGG - Intronic
1177935656 21:27342507-27342529 CTTATGCTCCTGCCTTTCACTGG + Intergenic
956374385 3:68598590-68598612 CTGAGGCTCCTGTTCTACATGGG - Intergenic
959584664 3:108014941-108014963 CAATTGCGCCTGCCCTACCTGGG - Intergenic
963734886 3:149008409-149008431 CTCATGCTCCTGCCCGCCACAGG + Intronic
963862338 3:150323979-150324001 CTAGTGCTCATGCCTTCCATTGG - Intergenic
966819861 3:183915792-183915814 CTAATTCTACTGCCCTTGATGGG - Intergenic
976037283 4:80839350-80839372 ATTATTCTCCTGTCCTACATGGG + Intronic
983366607 4:166799147-166799169 CTATTGCTCCTGCAGTACACAGG - Intronic
984965645 4:185137539-185137561 CTGCTGCTCCTGCGCCACATTGG + Intergenic
986207914 5:5643668-5643690 CTAATGCTCCTTCTCTCCAAAGG + Intergenic
987247533 5:16063673-16063695 CTAATTCTCCTCCCATACATAGG + Intergenic
988725431 5:33921698-33921720 CTAATGCTCCTGATATAGATAGG - Intergenic
994665731 5:102703085-102703107 TAGATGCTCTTGCCCTACATGGG - Intergenic
998861869 5:146452073-146452095 CCACTGCTCCTGGCCTAAATTGG + Intronic
999865868 5:155699787-155699809 CTAATAATCCTGCCCTTCTTTGG - Intergenic
1000046850 5:157528882-157528904 CTAATGCCCATACCCTACACAGG - Intronic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1003233406 6:4274926-4274948 CAAAGGCTCCTGCCCTGCTTTGG - Intergenic
1007178254 6:39910980-39911002 CTAAGGCTCCAGCCCTTCCTGGG + Intronic
1010151002 6:72732292-72732314 CTAATGCTACTCCCCTACTCAGG - Intronic
1014988829 6:128048441-128048463 CTAATGCTCCTGCCCTACATGGG + Intronic
1015570663 6:134618088-134618110 CTAATGTTCCTGCCTCACTTAGG - Intergenic
1018889446 6:167972881-167972903 ATAATGGTACTGCCCTACAGTGG + Intergenic
1022890182 7:34689060-34689082 CTAATGCTTCTGCCTGCCATTGG + Intronic
1026647530 7:72185270-72185292 CAAATGCTCCTTCCTTTCATGGG - Intronic
1027966463 7:85016384-85016406 CTACTCCTCCTGCCCTACCTTGG + Intronic
1029130273 7:98324861-98324883 CTAATGCACCTGAACTGCATAGG + Intronic
1032321728 7:130891904-130891926 TTAATTCTCCTGCCCCACACAGG + Intergenic
1035282367 7:157786047-157786069 CTAACGCTCGTGCCCCACAGGGG - Intronic
1042381202 8:68116361-68116383 CTAATGTTCCTTGCCTACCTCGG + Intronic
1042694100 8:71537525-71537547 ATAATAATCCTGCCTTACATTGG + Intronic
1046470681 8:114669996-114670018 CTTATTCTCCTGTACTACATTGG + Intergenic
1047900994 8:129422491-129422513 CAAATGCTCCTTCCATGCATGGG - Intergenic
1048934188 8:139341752-139341774 CCTCTGCTCCTGCCCTGCATTGG - Intergenic
1049976788 9:867676-867698 CCCATGCTCATGCCCTACATCGG + Intronic
1050583284 9:7083513-7083535 CTATTGCTCCTAGCCTTCATGGG + Intergenic
1061918020 9:133767008-133767030 CTACTTCCCCTGCCCTACATTGG - Intronic
1194211748 X:91078943-91078965 TTAATGCTCCTGCTCTCCATAGG - Intergenic
1198236163 X:134737610-134737632 CTAATGCACCTGCCCCTAATTGG + Intronic
1201953656 Y:19595718-19595740 TTCTTGCTTCTGCCCTACATTGG - Intergenic