ID: 1014991348

View in Genome Browser
Species Human (GRCh38)
Location 6:128081740-128081762
Sequence TATAAACTTTAGTAGATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 733
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 703}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014991348 Original CRISPR TATAAACTTTAGTAGATTTA GGG Intronic
901958270 1:12803822-12803844 TATCAGCTTTAGGAGATTTTGGG + Intergenic
901966270 1:12869735-12869757 TATCAGCTTTAGGAGATTTTGGG + Intronic
902019668 1:13334693-13334715 TATCAGCTTTAGGAGATTTTGGG - Intergenic
906330877 1:44883236-44883258 TATAAACTGTAATAAATTTCTGG - Intronic
906974621 1:50556522-50556544 TTTAAATTTCAATAGATTTAGGG - Intronic
907572449 1:55495946-55495968 TATCAACTTAAGGAGATTTTGGG + Intergenic
908049086 1:60208122-60208144 TATCAACTTAAGGAGATTTTGGG + Intergenic
908429353 1:64040847-64040869 TATAAGCTTTTGTGGATATATGG - Intronic
908541216 1:65124051-65124073 TATCAACTTAAGGAGATTTTGGG + Intergenic
908905060 1:68998696-68998718 TATCAACTTAAGGAGATTTTGGG - Intergenic
909003844 1:70252677-70252699 TTTAAACTTTAGTAGATAAAAGG + Exonic
909176036 1:72360294-72360316 TATAAAGTTTGGTAGTTTGAGGG - Intergenic
909461078 1:75915011-75915033 TGTGAATTTTAGTACATTTATGG + Intergenic
909689755 1:78394120-78394142 TATCAACTTAAGGAGATTTTGGG + Intronic
909847877 1:80418751-80418773 TAAAAACTTTAAGATATTTATGG + Intergenic
910310953 1:85824124-85824146 TATGCTCTTTAGTGGATTTAGGG - Intronic
911109484 1:94167184-94167206 TGTCAACTTTATTAGATTGAAGG - Intronic
911277192 1:95876722-95876744 TAGTAACTGTAGCAGATTTATGG + Intergenic
911290676 1:96053456-96053478 TATCAGCTTAAGTAGATTTTGGG + Intergenic
911537139 1:99114040-99114062 TATCAACTTAAGGAGATTTTGGG + Intergenic
911584598 1:99676395-99676417 TAAAAATTTTTGTAGATGTAGGG + Intronic
911636563 1:100242511-100242533 TATAAAGACTAGTCGATTTAGGG - Intronic
911689662 1:100818780-100818802 TATTAGCTTTAGTAGCTTTTTGG + Intergenic
911753830 1:101529749-101529771 TATCAACTTTACCAGATTAAAGG - Intergenic
911803232 1:102171812-102171834 TATAATATTTATTAGATTAAGGG - Intergenic
911937063 1:103990374-103990396 TATACATTTTAGTAGATTCTTGG + Intergenic
913446995 1:118960533-118960555 TATAAACTTTGGTACTTTTTAGG - Intronic
913525981 1:119693301-119693323 TATCAGCTTAAGTAGATTTGGGG + Intronic
914434016 1:147644135-147644157 TATACTCTTTAGTAGTTTTCAGG - Exonic
916185115 1:162124132-162124154 TTTAAATTTCAGTAGCTTTAGGG + Intronic
916373032 1:164120886-164120908 TATAAGCTTAAGGAGATTTTGGG - Intergenic
916377385 1:164170203-164170225 TATCAACTTAAGGAGATTTTGGG - Intergenic
916775428 1:167958118-167958140 TAAAAACTTTTGTACATTAAAGG - Intronic
916836269 1:168548781-168548803 TATCAACTTAAGGAGATTTTGGG - Intergenic
916874598 1:168955568-168955590 TATCAGCTTAAGGAGATTTAGGG + Intergenic
917009355 1:170453618-170453640 TATCAACTTAAGGAGATTTTTGG + Intergenic
917216780 1:172687133-172687155 TATAGACTGTTGTAGATTCACGG - Intergenic
917267075 1:173232346-173232368 TATCAGCTTAAGTAGATTTTGGG + Intergenic
917941827 1:179929776-179929798 TTTTAACTTTAGTAGATATGGGG - Intergenic
917997274 1:180453660-180453682 TATCAGCTTTAGGAGATTTTGGG - Intronic
918435589 1:184509116-184509138 GACACACATTAGTAGATTTAAGG - Intronic
918848168 1:189645530-189645552 TATTAATATTTGTAGATTTAGGG - Intergenic
918855093 1:189742674-189742696 TATATACTTTAAAATATTTATGG + Intergenic
919065158 1:192684828-192684850 TATCAACTTAAGGAGATTTGGGG + Intergenic
919127908 1:193418435-193418457 TAGAAATTTTAGTAGGTATAGGG + Intergenic
919239465 1:194892950-194892972 TATGATTTTTAGTATATTTATGG - Intergenic
919335041 1:196221251-196221273 TATCAGCTTTAGGAGATTTTGGG + Intergenic
919610236 1:199736225-199736247 CATAAACTTTAAGATATTTATGG + Intergenic
921439147 1:215163296-215163318 TATCAACTTAAGGAGATTTTGGG + Intronic
921809018 1:219490505-219490527 AATAAAATTGAGTTGATTTATGG + Intergenic
922890435 1:229057901-229057923 TGGAAACTTTAGGAGAATTAGGG - Intergenic
923380559 1:233413637-233413659 TAAAAAAGTTAGTAGTTTTAGGG - Intergenic
923705523 1:236341311-236341333 TATAAATATTAATAGACTTATGG + Intergenic
923938420 1:238791646-238791668 TAAAAACTTTAGAAGAGATATGG + Intergenic
924419992 1:243898994-243899016 TATAAAGGGTAGTAAATTTAAGG - Intergenic
924735635 1:246753458-246753480 TATAAAATTTTTTAGATTAAAGG - Intronic
1063282307 10:4643799-4643821 TATAGAGATCAGTAGATTTATGG - Intergenic
1063294903 10:4795456-4795478 TATAAGCTTAAGGAGATTTTGGG + Intronic
1064385730 10:14889400-14889422 TATAAACTTTTGTATATGTAGGG - Intronic
1064503621 10:16004511-16004533 TATAAATTTTTATACATTTAAGG + Intergenic
1064510260 10:16082384-16082406 TTTAATCTTTAGTAGAGTTGGGG - Intergenic
1064990127 10:21249354-21249376 TAGAAACTTTTGTACATTGAAGG - Intergenic
1065273697 10:24064019-24064041 TATCAGCTTAAGGAGATTTAGGG + Intronic
1065463306 10:25992388-25992410 TATCAACTTAAGGAGATTTTGGG + Intronic
1066077658 10:31896340-31896362 TGTAAACATTTCTAGATTTATGG + Intronic
1066582344 10:36894836-36894858 TATAAGCTTAAGGAGATTTTGGG + Intergenic
1066583743 10:36909339-36909361 TATAAGCTTAAGGAGATTTTGGG + Intergenic
1066699271 10:38109605-38109627 TATCAGCTTTAGGAGATTTTGGG - Intronic
1066973085 10:42335017-42335039 TGTAAACTTTAGAAAATTCACGG - Intergenic
1066993103 10:42535610-42535632 TATCAGCTTTAGGAGATTTTGGG + Intergenic
1067154390 10:43764872-43764894 TTAAAACTTCAGTAGCTTTAGGG + Intergenic
1067423680 10:46183885-46183907 TATAAATTTTAGCCAATTTAGGG - Intergenic
1067855603 10:49790008-49790030 GATGATCTTTAGTATATTTATGG - Intergenic
1068181704 10:53527914-53527936 TATACACTTGAGTATATTTCTGG - Intergenic
1068352760 10:55870097-55870119 TAAAAATTTTGGTAGTTTTAAGG + Intergenic
1069344695 10:67454918-67454940 AATAAACTAAAGTAGATTTTAGG - Intronic
1069366950 10:67703889-67703911 TATCAGCTTAAGGAGATTTAGGG - Intergenic
1069999369 10:72364900-72364922 TATAATCTTTAGTAGAGATGGGG + Intergenic
1070076217 10:73139028-73139050 TTTACTCTTTAGTAGCTTTATGG - Intronic
1070419360 10:76221385-76221407 TATCAGCTTAAGTAGATTTTGGG - Intronic
1070462959 10:76688134-76688156 TATCCACTTTAGTAGATGTGAGG - Intergenic
1070687194 10:78495267-78495289 TATATATTTTAGGAGATTTTAGG - Intergenic
1070709625 10:78670646-78670668 TATCAGCTTAAGGAGATTTAGGG - Intergenic
1071225540 10:83524259-83524281 TATAAAGTTTGCTAGATTTAAGG - Intergenic
1072176211 10:92924686-92924708 TATTTATTTTAGTAGCTTTAGGG + Intronic
1072774673 10:98178941-98178963 TATAAGCTTAAGGAGATTTTGGG + Intronic
1072832879 10:98677638-98677660 TCTGACCTTTAGTAGATTTGTGG - Intronic
1074016371 10:109538474-109538496 TATCAGCTTTAGGAGATTTTCGG + Intergenic
1074553410 10:114466342-114466364 TATAAACCTTAATAGAGATAGGG + Intronic
1074608924 10:115002616-115002638 TATTAACTTTTGCATATTTAGGG - Intergenic
1078260919 11:9707891-9707913 TTTAAACTTTAATAGTTTTGGGG + Intronic
1078653126 11:13214482-13214504 TATAAACTGGAGTGGATTCAAGG - Intergenic
1078967782 11:16366960-16366982 TTTAAATTTTTATAGATTTAGGG - Intronic
1079118778 11:17661300-17661322 TATAAACTTTGCAGGATTTATGG + Intergenic
1079317968 11:19425884-19425906 GATAACTTTTAGTAGATATATGG - Intronic
1079431419 11:20392239-20392261 AATAAATTTTATTAGACTTAAGG + Exonic
1079543670 11:21607183-21607205 TATCAACTTAAGGAGATTTTGGG - Intergenic
1079715582 11:23739589-23739611 TAAAAATTTTTATAGATTTAAGG + Intergenic
1079808068 11:24959629-24959651 TATCAACTTAAGGAGATTTTGGG + Intronic
1079929416 11:26539441-26539463 GCTAAACTTTAGAATATTTAGGG - Intronic
1079965411 11:26974197-26974219 TATAAACTTTAATAGCTGTCAGG - Intergenic
1080069512 11:28063570-28063592 GATAAGGTTTAGTAGGTTTAAGG - Intronic
1080331468 11:31144556-31144578 GATAAAGATTAGTGGATTTAAGG - Intronic
1081064323 11:38521429-38521451 TATCAGCTTTAGGAGATTTTGGG + Intergenic
1081095756 11:38932549-38932571 AATAAACTTCAGTAAATTTCAGG - Intergenic
1082123610 11:48406575-48406597 TATAAGCTTGAGGAGATTTGGGG - Intergenic
1082127435 11:48449688-48449710 TATCAACTTAAGGAGATTTTGGG + Intergenic
1082138210 11:48575316-48575338 TATCAGCTTTAGGAGATTTTGGG - Intergenic
1082141393 11:48613634-48613656 TATCAGCTTTAGGAGATTTTGGG + Intergenic
1082314346 11:50698705-50698727 TATAAGCTTAAGGAGATTTTGGG - Intergenic
1082314833 11:50705167-50705189 TATAAGCTTAAGGAGATTTTGGG + Intergenic
1082316098 11:50724360-50724382 TATAAGCTTAAGGAGATTTTGGG - Intergenic
1082624280 11:55464043-55464065 TATCAACTTAAGGAGATTTTGGG - Intergenic
1082743844 11:56940939-56940961 TATCAACTTAAGGAGATTTTGGG + Intergenic
1082746045 11:56964427-56964449 TATCAACTTAAGGAGATTTTGGG - Intergenic
1082918074 11:58461001-58461023 TAAAAAATTTAGTGGCTTTAAGG - Intergenic
1082925008 11:58535783-58535805 TATCAGCTTTAGGAGATTTTGGG - Intronic
1083422634 11:62563613-62563635 TTCAATGTTTAGTAGATTTATGG - Intronic
1083515563 11:63255129-63255151 TATCAGCTTAAGGAGATTTAGGG - Intronic
1084139122 11:67212193-67212215 TAGAAACTATAGGAGAATTAGGG + Intronic
1086051069 11:82591049-82591071 TATATATTTTTATAGATTTAGGG + Intergenic
1086667156 11:89496532-89496554 TATAAAATTTTATATATTTAAGG - Intronic
1086670990 11:89547558-89547580 GATTAAATTCAGTAGATTTAGGG - Intergenic
1086754635 11:90544639-90544661 AATAAACTTTTGTTGTTTTAGGG + Intergenic
1086786580 11:90976389-90976411 TATCAGCTTAAGTAGATTTTGGG - Intergenic
1087000695 11:93417293-93417315 TATCAACTTAAGGAGATTTTGGG - Intronic
1087001018 11:93420676-93420698 TATCAACTTAAGGAGATTTTGGG - Intronic
1087079748 11:94158626-94158648 TATAAGCTTAAGGAGATTTTGGG + Intronic
1087243799 11:95810464-95810486 TATCAACTTGAGGAGATTTTGGG - Intronic
1088127759 11:106449220-106449242 TATAAATTTTAGTAGAGTTGGGG + Intergenic
1088508629 11:110551719-110551741 TATCAGCTTAAGTAGATTTTGGG + Intergenic
1089768162 11:120783529-120783551 TTTGAAGTTTAGTAGGTTTATGG + Intronic
1090100059 11:123785414-123785436 TATAAGCTAAAATAGATTTAAGG + Intergenic
1090559564 11:127916968-127916990 TATAAACTTAAGGAGGTTTGGGG - Intergenic
1091185660 11:133644926-133644948 TATCAGCTTTAGGAGATTTTGGG - Intergenic
1091199501 11:133763377-133763399 TATCAGCTTTAGGAGATTTTGGG - Intergenic
1091213110 11:133880984-133881006 TATCAGCTTTAGGAGATTTTGGG + Intergenic
1092326074 12:7532748-7532770 TATCAGCTTAAGTAGATTTTGGG - Intergenic
1093265854 12:17002571-17002593 TATAAGCTTAAGGAGATTTTGGG - Intergenic
1093295714 12:17388410-17388432 TTTTAATTTTAATAGATTTATGG - Intergenic
1093323867 12:17748548-17748570 TGTAAATTTTAGTAGGTATATGG + Intergenic
1093326469 12:17781391-17781413 TATCAGCTTAAGGAGATTTAGGG + Intergenic
1093612104 12:21173598-21173620 TAAAAAATTTAGTACCTTTACGG - Intronic
1093900069 12:24621705-24621727 TATCAGCTTTAGGAGATTTTGGG + Intergenic
1093969889 12:25365899-25365921 TATCAACTGTTGTACATTTAAGG - Intergenic
1093977953 12:25443762-25443784 TTTAAATTTCAGTAGCTTTAGGG + Intronic
1093994704 12:25629229-25629251 TCTAAACGATAGTAGAGTTACGG + Intronic
1094429822 12:30355745-30355767 TATTAACTTGACTAGATTGAGGG - Intergenic
1094481960 12:30890847-30890869 TATCAGCTTAAGGAGATTTAGGG + Intergenic
1094566943 12:31607605-31607627 TATAAACATTATTAAATGTACGG + Intergenic
1094793760 12:33945971-33945993 TATACAGTTTAGTAGACTAATGG + Intergenic
1094797168 12:33988413-33988435 TATAAACTTTTATTGATTCATGG - Intergenic
1095087512 12:38073725-38073747 TATCAACTTAAGGAGATTTTGGG - Intergenic
1095105032 12:38222783-38222805 TATACAGTTTAGTAGACTAATGG + Intergenic
1095124026 12:38453855-38453877 GATAAACTTTGGTAGTCTTAGGG + Intergenic
1095808562 12:46347683-46347705 TATCAACTTAAGGAGATTTTGGG + Intergenic
1096897200 12:54834490-54834512 TTTAAAGTTTTGTATATTTAAGG + Intronic
1097299609 12:58004192-58004214 TGTAAACTTTTGTTGATGTATGG + Intergenic
1097408640 12:59223890-59223912 TATCAACTTAAGGAGATTTTGGG + Intergenic
1098116059 12:67178078-67178100 TATCAGCTTAAGGAGATTTAGGG - Intergenic
1098494850 12:71122201-71122223 TATCAACTTAAGGAGATTTTGGG - Intergenic
1098852863 12:75618299-75618321 TATCAACTTAAGGAGATTTTGGG - Intergenic
1099053075 12:77805045-77805067 TATTAACTTAAGGAGATTTTGGG + Intergenic
1099066568 12:77987870-77987892 TATAATTTTTAGAATATTTATGG + Intronic
1099501798 12:83422230-83422252 TATAAGCTTAAGGAGATTTTGGG + Intergenic
1099582583 12:84469838-84469860 TATAAATTTGAATATATTTATGG - Intergenic
1099737422 12:86587826-86587848 TATCAGCTTTAGGAGATTTTGGG + Intronic
1100319773 12:93479711-93479733 TAAAAAATTTGGTAGATTTCTGG + Intronic
1100416017 12:94376246-94376268 TATAAACTTTATTTTATTGATGG - Intronic
1100515018 12:95319202-95319224 TAAAAATTTTTGTATATTTAGGG - Intergenic
1100761117 12:97808472-97808494 TATCAACTTTAGGAGATTTTTGG - Intergenic
1100768356 12:97894169-97894191 TATTAGCTTAAGGAGATTTAGGG + Intergenic
1101713813 12:107293049-107293071 TATAAACTTGATTGGATTGAAGG + Intergenic
1105495734 13:20929247-20929269 TCTAAATTTTAGTAGGTCTATGG - Intergenic
1105686465 13:22787282-22787304 CATAAAGTGTAGTAGAATTAGGG - Intergenic
1106894622 13:34285886-34285908 GAAAAACTTTACTAGTTTTAGGG - Intergenic
1107523929 13:41211751-41211773 TATTATTTTTAGTAGATTCAGGG + Intergenic
1107539864 13:41378535-41378557 CACAAACTTTTGTAGCTTTAGGG - Intergenic
1107700050 13:43038184-43038206 TAAAGACATTAGTATATTTAAGG + Intronic
1108456215 13:50616594-50616616 TATAAACTTTAAAAGGTTTGGGG + Intronic
1108924991 13:55731360-55731382 TATAAACTTGATTGGATTGAAGG + Intergenic
1109213725 13:59563938-59563960 TAAAAAATTTATTATATTTAAGG - Intergenic
1109358503 13:61266305-61266327 TATAATATTTAGTATATGTAAGG - Intergenic
1109607941 13:64722167-64722189 TATAAGCTTAAGGAGATTTTGGG - Intergenic
1109646021 13:65257800-65257822 TGCAAAATTTAGTAGATGTATGG - Intergenic
1109946139 13:69434816-69434838 TATCAACTTAAGGAGATTTTGGG - Intergenic
1110333487 13:74299614-74299636 TATAAACTTTCCTAGCGTTAAGG + Intergenic
1110928817 13:81189451-81189473 TATAATCTTTATTAAATGTAAGG + Intergenic
1110972712 13:81786590-81786612 TATCAACTTAAGTAGTTTTTGGG + Intergenic
1111254385 13:85646785-85646807 TATAAACGGGATTAGATTTAGGG + Intergenic
1111355734 13:87099993-87100015 TAATAACTTTAGTATTTTTATGG + Intergenic
1111410482 13:87870170-87870192 TATATAATATAGTAGATATATGG + Intergenic
1111503346 13:89154852-89154874 AATAAACTTTAGTGAAATTATGG + Intergenic
1111697863 13:91647920-91647942 TATACACTTAAGTAAATTTGAGG + Intronic
1112143350 13:96670991-96671013 TATGAATTTTAGTAGCTTTAGGG + Intronic
1112763059 13:102712178-102712200 TATAATTTTTAGTAGAGATAAGG - Intergenic
1112903116 13:104383446-104383468 TATATACTTTAGGACATATATGG + Intergenic
1113195193 13:107795672-107795694 TATAAACTATAGTATTATTAAGG - Intronic
1113312482 13:109144684-109144706 AATGAACTTTAGTTAATTTAAGG - Intronic
1114141324 14:19914252-19914274 TATCAACTTAAGGAGATTTTGGG - Intergenic
1114349363 14:21833911-21833933 TATCATCTTTTTTAGATTTAAGG - Intergenic
1114966513 14:27967909-27967931 TATCAGCTTAAGGAGATTTAGGG + Intergenic
1115430030 14:33306735-33306757 AATAAACTCTAATAGATGTAAGG - Intronic
1115638390 14:35313432-35313454 CAAAAATTTTAGTAGATTTTGGG + Intronic
1115855915 14:37629484-37629506 TATCAACTTAAGGAGATTTTGGG + Intronic
1116032107 14:39586140-39586162 TATCAACTTAAGGAGATTTTGGG + Intergenic
1116148719 14:41109468-41109490 TATAAAATTCAGTAGATGGATGG - Intergenic
1116355258 14:43920426-43920448 TATCAATTTTACTAGATTTTTGG - Intergenic
1117569576 14:57033248-57033270 TAAAAACTTTAATACATATATGG + Intergenic
1117822251 14:59662014-59662036 TATCAACTTAAGGAGATTTTGGG - Intronic
1117822725 14:59667723-59667745 TATCAACTTAAGGAGATTTTGGG - Intronic
1118104352 14:62640810-62640832 TATCAACTTAAGGAGATTTTGGG - Intergenic
1118265078 14:64287098-64287120 TATAAAGTTCAGTAGTGTTAAGG + Intronic
1120070066 14:80092781-80092803 TATCAACTTAAGGAGATTTTGGG - Intergenic
1120186546 14:81399619-81399641 TATAAACATTAGTTGTTTTTAGG - Intronic
1120934799 14:89884375-89884397 AATAACCTTTATTAGATTAAGGG - Intronic
1121967563 14:98324578-98324600 TATGATGTTTAGTACATTTAGGG - Intergenic
1123961747 15:25410210-25410232 ATTAAATCTTAGTAGATTTATGG - Intronic
1124465784 15:29938774-29938796 CATAAATTTAAGTAGAGTTATGG + Intronic
1124667125 15:31602717-31602739 TATCAGCTTAAGGAGATTTAGGG - Intronic
1124893253 15:33752608-33752630 TATCAACTTAAGGAGATTTGGGG + Intronic
1126155882 15:45565303-45565325 TATAATTTTTAGTAGAGTCAGGG - Intergenic
1126933476 15:53680641-53680663 TAAAAAATTTAGAAAATTTATGG - Intronic
1126964649 15:54037869-54037891 TATAAAATTTAGCAAATATATGG + Intronic
1127869415 15:63058533-63058555 TCTATTTTTTAGTAGATTTAGGG - Intronic
1128626119 15:69206091-69206113 CATAGACTATAGGAGATTTAGGG - Intronic
1128837505 15:70822184-70822206 TATATACTTTGTTAGAGTTATGG + Intergenic
1129630856 15:77258604-77258626 TATCAGCTTTAGGAGATTTTGGG + Intronic
1129631371 15:77264368-77264390 TATCAGCTTTAGGAGATTTTGGG - Intronic
1130365143 15:83230512-83230534 TATATACTATAGTATATATACGG + Intergenic
1130806515 15:87329275-87329297 TATCAGCTTAAGTAGATTTTGGG + Intergenic
1131026537 15:89147249-89147271 TATAAAAGTAAGTGGATTTAAGG + Intronic
1131704805 15:94981901-94981923 CAAAACCTTTAGAAGATTTAAGG - Intergenic
1131718015 15:95134619-95134641 TATAAACATGATTTGATTTATGG + Intergenic
1134790898 16:16988371-16988393 TATATTTTTTAGTAGATATAGGG + Intergenic
1134859660 16:17549910-17549932 TATCAACTTGATTAGATTGAGGG + Intergenic
1135689803 16:24527111-24527133 TCTAATCTTAACTAGATTTAGGG + Intergenic
1137025778 16:35472798-35472820 TATAAGCTTAAGGAGATTTTGGG - Intergenic
1137258459 16:46798902-46798924 AATACCCTTTAGTAGATTGAGGG - Intronic
1137474581 16:48796503-48796525 TTTAAACTTAAGCAGCTTTATGG - Intergenic
1138902827 16:61295320-61295342 TCTAAACTTTAGCAGAATTCAGG - Intergenic
1139208708 16:65054969-65054991 AACAAATTTTAGTAGATCTAAGG - Intronic
1139783938 16:69375126-69375148 TATAAACTATAGTACATGCATGG - Intronic
1140160809 16:72491235-72491257 TATATATTTTAGTAAATATATGG - Intergenic
1140569666 16:76088617-76088639 TATCAACTTAAGGAGATTTTGGG + Intergenic
1140575867 16:76168128-76168150 TATCAACTTAAGGAGATTTGGGG + Intergenic
1140608857 16:76573891-76573913 AATAAAATTTAGTAAATTTAGGG - Intronic
1141249612 16:82343213-82343235 TATCAACTTGATTAGATTGAAGG - Intergenic
1142417732 16:89952185-89952207 TATAAAATTTAATAGAGATAGGG + Intronic
1143236477 17:5405632-5405654 CATAAACCATAGTAAATTTAGGG - Intronic
1144141874 17:12357312-12357334 TTTAAAGTTTTATAGATTTAGGG + Intergenic
1144504014 17:15814384-15814406 TTTAAATTTTAGTAGGTTTTTGG - Intergenic
1144633756 17:16890011-16890033 TAAAAATTTTAGTAGGTTTTTGG - Intergenic
1145055311 17:19699573-19699595 TAAAAACTTTTGTAGAGATAGGG + Intronic
1145167870 17:20629886-20629908 TAAAAATTTTAGTAGGTTTTTGG - Intergenic
1145327839 17:21845943-21845965 TATTATCTTTAGAAGTTTTATGG + Intergenic
1145694653 17:26777323-26777345 TATTATCTTTAGAAGTTTTATGG + Intergenic
1146342615 17:32034181-32034203 TATAAAGTTTTTTAAATTTATGG - Intronic
1146600573 17:34211620-34211642 TATCAGCTTAAGTAGATTTTGGG + Intergenic
1146743656 17:35308457-35308479 TATCAGCTTAAGGAGATTTAGGG - Intergenic
1146766584 17:35527967-35527989 TATAAGCTTAAGGAGATTTTTGG - Intronic
1149047285 17:52261927-52261949 TATCAACTCTAGGAGATTTTTGG + Intergenic
1149100942 17:52906076-52906098 CATACACTTTACTAAATTTATGG + Intergenic
1150431417 17:65121187-65121209 TCTAAAATTCAGTAGATTCAGGG - Intergenic
1151860563 17:76758241-76758263 TAAAACTTTTAGTAGATTAAAGG + Intronic
1203192473 17_KI270729v1_random:202171-202193 TATTATCTTTAGAAGTTTTATGG + Intergenic
1203201838 17_KI270730v1_random:1606-1628 TATTATCTTTAGAAGTTTTATGG + Intergenic
1152959147 18:67631-67653 TGTCAACTTTACTAGATTAAGGG + Intronic
1153389436 18:4537599-4537621 TTTAAATTTAAGAAGATTTAAGG - Intergenic
1153494415 18:5683171-5683193 TATCAACTTAAGGAGATTTTGGG + Intergenic
1155212605 18:23615179-23615201 TTTAAACTTTTGTAGAGATAGGG + Intronic
1155350930 18:24905342-24905364 TATCAACTTAAGGAGATTTTGGG - Intergenic
1155871581 18:31035986-31036008 AATAAACTGTGGTACATTTATGG - Intronic
1156177472 18:34563749-34563771 TCTAAATTTTGGTGGATTTAAGG - Intronic
1156234243 18:35185553-35185575 TAAAAATTTTTGTAGATTCAAGG - Intergenic
1156776424 18:40794332-40794354 TATAAGCTTAAGGAGATTTTGGG - Intergenic
1157664088 18:49470692-49470714 TTTAAATTTCAGTAGTTTTAGGG + Intergenic
1158072784 18:53493202-53493224 TATCAGCTTAAGGAGATTTAGGG + Intronic
1159277963 18:66245462-66245484 TATAAACTTGACTAGGTTAAGGG - Intergenic
1159563510 18:70022011-70022033 TTTAAATTTTATTAAATTTATGG - Intronic
1159630174 18:70740096-70740118 TATCAGCTTAAGTAGATTTTGGG - Intergenic
1159647345 18:70934642-70934664 TATAAACTTTAGGAGCTTCATGG - Intergenic
1159819828 18:73126980-73127002 GATAAACTTTGGTAGCTATATGG - Intergenic
1164559477 19:29279364-29279386 TTAAAACTTTTGTAGATTCACGG + Intergenic
1165970017 19:39620277-39620299 TATCAACTTAAGGAGATTTTGGG + Intergenic
1167222233 19:48207474-48207496 TATAAAATGTAGTATTTTTATGG + Intronic
1168439380 19:56350809-56350831 ATTAAACTTTATTTGATTTAAGG - Intronic
925473441 2:4187242-4187264 TATAAACTTTAATAGAAGCAGGG - Intergenic
926623043 2:15065185-15065207 CATAAAATTTTGTATATTTAAGG - Intergenic
926831355 2:16965716-16965738 TATAAACTTTATTTCATTCATGG - Intergenic
927028305 2:19093467-19093489 TATAAGCTTAAGGAGATTTGGGG - Intergenic
930382036 2:50642384-50642406 TTTAAAATTTAGGAGATTTGAGG + Intronic
930468333 2:51781372-51781394 AATAAACTTCAGTAAATTTTAGG - Intergenic
930579347 2:53191205-53191227 TATAATCTGTAGTATCTTTAAGG - Intergenic
930623156 2:53665786-53665808 TATCAACTTAAGGAGATTTAGGG - Intronic
930928056 2:56845783-56845805 TATAAATATTAGTTGAATTAGGG - Intergenic
930965108 2:57313575-57313597 TATCAACTTGACTAGATTAAGGG + Intergenic
931585248 2:63819332-63819354 TAATAACTTTAGTAAATTGAGGG - Intronic
931596839 2:63956226-63956248 TCTAAATTATAGGAGATTTAAGG + Intronic
931825184 2:65992892-65992914 TATACATTTTAGTATACTTAGGG + Intergenic
931887078 2:66628962-66628984 TATCAGCTTAAGTAGATTTTGGG + Intergenic
932726090 2:74180979-74181001 TTTAAACTTTTGTAGTTTTTTGG + Intergenic
933257216 2:80094882-80094904 TATCAACTTAAGGAGATTTTGGG + Intronic
935195002 2:100808208-100808230 TAAAAATTTTTATAGATTTATGG - Intergenic
935491814 2:103730519-103730541 TATAAGCTTAAGAAGATTTGGGG - Intergenic
935946020 2:108287518-108287540 CAGACACTTTAGTAGACTTAGGG + Intergenic
938175142 2:129119051-129119073 TCTAAATTTTAATAGCTTTAAGG + Intergenic
939084366 2:137700238-137700260 TATCAGCTTAAGGAGATTTAGGG - Intergenic
939150331 2:138464896-138464918 TATAAATTTCAGTAGGTTTTTGG - Intergenic
939162127 2:138603237-138603259 TACAAACTTTAGTAAATGTATGG + Intergenic
940048120 2:149431781-149431803 TAAAAACTTTTGTAGATCAAAGG + Intronic
940292709 2:152093185-152093207 GATAATTTTTATTAGATTTAGGG + Intronic
940415427 2:153413913-153413935 TATAAACTTTATTATATATGTGG + Intergenic
940602992 2:155884472-155884494 TATCAACTTAAGGAGATTTGGGG - Intergenic
941205779 2:162571159-162571181 TATCAGCTTTAGGAGATTTTGGG - Intronic
941684790 2:168437427-168437449 TATAAACTATAGAAGAGTTCAGG - Intergenic
942007087 2:171714656-171714678 AAGTGACTTTAGTAGATTTATGG + Intronic
942197363 2:173534836-173534858 TACAAACTTGAGTAGAGTTGGGG - Intergenic
942733956 2:179089265-179089287 TATCAACTTAAGCAGATTTTGGG + Intergenic
943154895 2:184162933-184162955 TATAATTTTATGTAGATTTAAGG + Intergenic
943176162 2:184477416-184477438 GTTTTACTTTAGTAGATTTAGGG + Intergenic
943500964 2:188689283-188689305 TATAAACTTAAGGAGCTTTTGGG + Intergenic
943513804 2:188859509-188859531 TAAAAGCTTTAGAAGTTTTATGG - Intergenic
943744110 2:191443413-191443435 TATAAACTTTGATATATTTCAGG - Intergenic
943749079 2:191493098-191493120 CATATATTTTATTAGATTTATGG + Intergenic
943988900 2:194660457-194660479 TAAAATCTTTAGTTCATTTAGGG + Intergenic
944370681 2:198979507-198979529 TAAAAATTTTAATAGCTTTAGGG - Intergenic
944393212 2:199241471-199241493 TATAAGCTTAAGGAGATTTTAGG + Intergenic
944617170 2:201473348-201473370 TTTAGATTTTAGTACATTTATGG + Intronic
944955363 2:204801583-204801605 TATCAACTTGAGGAGATTTGGGG + Intronic
945256560 2:207808071-207808093 TAAAAATTTTAGTAGAGGTAGGG + Intergenic
946788258 2:223271901-223271923 TATAAACTAGAACAGATTTATGG + Intergenic
947293759 2:228607132-228607154 TATCAACTTAAGGAGATTTTGGG - Intergenic
947681008 2:232033349-232033371 TATCAACTTAAGGAGATTTTGGG + Intronic
948495809 2:238349030-238349052 TATAATATTTTGGAGATTTAGGG + Intronic
1171434469 20:25109507-25109529 TATCAACTTAAGGAGATTTTGGG - Intergenic
1171518114 20:25754748-25754770 TATTATCTTTAGAAGTTTTATGG + Intergenic
1171558745 20:26101459-26101481 TATTATCTTTAGAAGTTTTATGG - Intergenic
1171566908 20:26203136-26203158 TATCAGCTTAAGGAGATTTAGGG + Intergenic
1171740138 20:28874350-28874372 TATCAACTTAAGGAGATTTTGGG + Intergenic
1171814435 20:29771960-29771982 TATCAACTTAAGGAGATTTTGGG - Intergenic
1173774195 20:45689719-45689741 TATCAACTTAAGGAGATTTTGGG + Intronic
1174932215 20:54828232-54828254 TTGAAACTTTTGTAAATTTAAGG + Intergenic
1175564985 20:59967526-59967548 TATAAAACTTATAAGATTTAAGG + Intronic
1176915949 21:14625391-14625413 TATCAGCTTAAGGAGATTTAGGG - Intronic
1176987243 21:15451721-15451743 TATCAACTTTAGAAGCTTTTGGG + Intergenic
1177943476 21:27439978-27440000 TTTAAGTTTTAGTATATTTAGGG - Intergenic
1177964883 21:27715477-27715499 TATCAACTTTACTAAATTAAAGG - Intergenic
1177995751 21:28095362-28095384 CATAAATTTTAGTATCTTTAAGG - Intergenic
1178557984 21:33610521-33610543 TATATACTTTAATGGATTTCTGG + Intronic
1180322362 22:11334048-11334070 TATAAGCTTAAGGAGATTTTGGG + Intergenic
1180679001 22:17610163-17610185 TATATATTCTAATAGATTTAAGG + Intronic
1180904573 22:19400133-19400155 TTTATACTGTAGTAGTTTTATGG + Intronic
949308324 3:2668470-2668492 TATCAACTTAAGGAGATTTTGGG + Intronic
949406885 3:3723502-3723524 TATCAACTTAAGGAGATTTTGGG - Intronic
949792346 3:7807008-7807030 TAAAAACCTCAGTAGATTCATGG + Intergenic
950299499 3:11863860-11863882 TATAAACTTAAGGAGATTTCGGG + Intergenic
950302587 3:11894120-11894142 TATAAACTTAAGGAGATTTTGGG + Intergenic
951238938 3:20267723-20267745 TATCAACTTAAGGAGATTTTGGG + Intergenic
951438069 3:22688280-22688302 TATCAACTTAAGGAGATTTTGGG - Intergenic
951832581 3:26947100-26947122 TATCAGCTTTAGGAGATTTTGGG - Intergenic
952383954 3:32825621-32825643 TTTAACCTTTATTAGTTTTATGG - Intronic
952465090 3:33575891-33575913 TATACACTATAGTATACTTAAGG - Intronic
952472994 3:33675700-33675722 TATCAACTTAAGGAGATTTTGGG - Intronic
953448889 3:42990191-42990213 TTTAAACTTTTGTAGAGATAGGG - Intronic
954523985 3:51252740-51252762 TATCAGCTTAAGTAGATTTTGGG + Intronic
955657428 3:61259690-61259712 TATCAACTTAAGGAGATTTTGGG + Intergenic
956317272 3:67952055-67952077 TATCAACTTAAGGAGATTTTGGG - Intergenic
956487187 3:69735452-69735474 TATAATTTTTAGTAGATATGAGG + Intergenic
956509179 3:69976620-69976642 TATCAACTTTATTGGATTGAAGG + Intergenic
956515593 3:70043292-70043314 TTTAATCTTCAGTAAATTTATGG + Intergenic
956548165 3:70429844-70429866 TATAAGCTTAAGGAGATTTTGGG + Intergenic
957410936 3:79838955-79838977 AATAAACTTAAGTAGAATTATGG + Intergenic
957475252 3:80714007-80714029 TATCAGCTTAAGTAGATTTTGGG - Intergenic
957690695 3:83562799-83562821 TATTACTTTTAGTAGATATAGGG + Intergenic
958782647 3:98561529-98561551 TATATACTTTAGTGTATTTTGGG - Intronic
959029819 3:101285791-101285813 TATAAATTTTGGTAGATTTACGG + Intronic
959091438 3:101907295-101907317 TATCAACTTAAGGAGATTTTGGG + Intergenic
959290326 3:104465715-104465737 TATCAGCTTAAGGAGATTTAGGG + Intergenic
959361368 3:105397061-105397083 TATAAACTTTAGTAGAAAATGGG - Intronic
959387442 3:105728226-105728248 TATCAGCTTTAGGAGATTTTGGG - Intronic
960457981 3:117897184-117897206 TATATAATTGAGTAGAGTTAGGG - Intergenic
960491653 3:118322677-118322699 TATAAGCTTAAGGAGATTTTGGG - Intergenic
961263155 3:125618763-125618785 TGTCAACTTGAGTAGATTGAAGG + Intergenic
961969193 3:130941753-130941775 GATAAACATTACTAGTTTTAAGG + Intronic
962602433 3:137003644-137003666 TATAAGCTTAAGGAGATTTTGGG + Intronic
962861680 3:139408847-139408869 TATCAACTTAAGGAGATTTTGGG - Intergenic
962913715 3:139879310-139879332 TATCAACTTAAGGAGATTTGGGG + Intergenic
963316104 3:143760459-143760481 TATCAACTTAAGGAGATTTTGGG - Intronic
963444115 3:145380531-145380553 TGTTAACTTTAGGAGAATTAGGG + Intergenic
963546393 3:146664079-146664101 TAAAAATTTGTGTAGATTTAAGG - Intergenic
963700596 3:148620247-148620269 TTTAAATTTAAGTATATTTAAGG - Intergenic
964326787 3:155555524-155555546 AATAAACTTCAGTTGTTTTAAGG + Intronic
964672143 3:159238442-159238464 AAGAAACTTTAGTAGCTTAATGG - Intronic
964706442 3:159623732-159623754 TATAAAATTTGGAAGATTTTGGG + Intronic
964887068 3:161496269-161496291 CATTATCCTTAGTAGATTTAAGG + Intergenic
964910590 3:161775777-161775799 TATAAAATTTAGAAGTTATAAGG + Intergenic
964937074 3:162102842-162102864 TTTAAATTTTTATAGATTTAGGG - Intergenic
965030002 3:163353613-163353635 TATCAGCTTTAGGAGATTTTGGG + Intergenic
965221729 3:165934689-165934711 TATAAACTTAAGGAGATTTGGGG - Intergenic
965278453 3:166718180-166718202 TATAAGCTTAAGGAGATTTTGGG - Intergenic
965976341 3:174628075-174628097 TTTATATTTTTGTAGATTTAGGG - Intronic
966589437 3:181664825-181664847 TATAAACTTTTGTACACTTAAGG + Intergenic
966705475 3:182909108-182909130 TCTAAAATTTATAAGATTTAAGG + Intronic
967315224 3:188146022-188146044 TAGTAAATTTAGTAAATTTATGG - Intergenic
967407580 3:189134587-189134609 TATAAAATTTTGTAGAGTTGGGG + Intronic
967586299 3:191218190-191218212 TTTAAAATTTAGCATATTTACGG - Intronic
970070749 4:12157026-12157048 TATCAGCTTTAGGAGATTTTGGG + Intergenic
970470079 4:16369157-16369179 TATCAACTTAAGGAGATTTTGGG + Intergenic
970944655 4:21676957-21676979 CATATACTTTAGAAGATTGATGG - Intronic
970998002 4:22290169-22290191 TATCAGCTTTAGAAGATTTTGGG + Intergenic
971480030 4:27106355-27106377 TATCAACTTAAGGAGATTTTGGG - Intergenic
971874814 4:32294031-32294053 AATAAACTATTGTAGATGTAGGG - Intergenic
972113195 4:35592248-35592270 GATAAATTTTTGTAGACTTAGGG - Intergenic
972983893 4:44740496-44740518 TATCAACTTGACTAGACTTAAGG + Intergenic
973689015 4:53405886-53405908 TATCAACTTAAGGAGATTTTGGG + Intronic
973714829 4:53665686-53665708 TATCAGCTTTAGGAGATTTTGGG + Intronic
974098465 4:57390912-57390934 GATAAACTTTAGCAGAGTTTGGG - Intergenic
974215107 4:58836204-58836226 TATAAACTTGATTAGATGGAAGG + Intergenic
974265462 4:59581417-59581439 TATCAGCTTTAGGAGATTTTGGG + Intergenic
974299726 4:60047929-60047951 TATCAACTTAAGGAGATTTTGGG + Intergenic
974370951 4:61015892-61015914 TATCAACTTAAGGAGATTTTGGG - Intergenic
974427178 4:61756497-61756519 TATCAACTTAAGGAGATTTTGGG + Intronic
974548060 4:63337829-63337851 TATCAGCTTTAGGAGATTTTGGG - Intergenic
974606547 4:64159315-64159337 TATAAACTTTAAAATATATAAGG - Intergenic
974700044 4:65431306-65431328 TATAAACTAGAGGATATTTATGG - Intronic
974740027 4:65995178-65995200 TATCAGCTTTAGGAGATTTTGGG + Intergenic
975017376 4:69439428-69439450 TATAAATTTTAATAAATATAAGG + Intergenic
975304817 4:72837400-72837422 TATCATCTTAAGTAGATTTTGGG + Intergenic
975520301 4:75293530-75293552 TATCAACTTAAGGAGATTTTGGG + Intergenic
976036506 4:80829094-80829116 TAAAAACTTTTGTACATTAAAGG + Intronic
976060946 4:81127708-81127730 TATCAGCTTTAGGAGATTTTGGG + Intronic
976347613 4:84023156-84023178 TATCAACTTTAATACATTCATGG - Intergenic
976415972 4:84775149-84775171 TAAAAACAGTAGTATATTTAAGG + Intronic
976578127 4:86700018-86700040 TTTACACTTGAGTAGATTCATGG + Intronic
977047274 4:92083225-92083247 TATAAGCTTAAGGAGATTTTGGG - Intergenic
977077453 4:92473849-92473871 CATAAAAATTAGTATATTTAAGG + Intronic
977357034 4:95959376-95959398 TAAAAATTTTAGTAGAAGTATGG + Intergenic
977414223 4:96710445-96710467 TATTAACTTTATCAGATTGAGGG - Intergenic
977502957 4:97864211-97864233 TATCAGCTTAAGTAGATTTTGGG - Intronic
977560885 4:98532568-98532590 TATCAACTTAAGGAGATTTTGGG + Intronic
977771345 4:100864685-100864707 TATCAGCTTAAGTAGATTTGGGG + Intronic
977789416 4:101081256-101081278 TGTAAAATTTCATAGATTTAAGG - Intronic
977862109 4:101974609-101974631 TTTAAAATGTATTAGATTTAGGG - Intronic
978236515 4:106467432-106467454 TATAAGCTTAAGGAGATTTTAGG + Intergenic
978714397 4:111824303-111824325 TATTAAATTTAGGAGTTTTAAGG + Intergenic
978751224 4:112249673-112249695 TATAATTTTTTATAGATTTAGGG + Intronic
978845457 4:113268128-113268150 TATCAGCTTTAGGAGATTTTGGG + Intronic
978881181 4:113704715-113704737 AATAAACTTTTGTGGATTCACGG - Intronic
979176332 4:117668527-117668549 TATCAACTTCAGGAGATTTTGGG + Intergenic
979214733 4:118149633-118149655 TATCAACTTAAGGAGATTTTGGG + Intronic
979695873 4:123612361-123612383 AATAAAGTTTTGTAGTTTTAAGG - Intergenic
980248501 4:130280706-130280728 TAAAAATTTTTATAGATTTAGGG + Intergenic
980293313 4:130873075-130873097 TAAAAACGTTATTATATTTATGG - Intergenic
980363496 4:131767976-131767998 AATAAACTTTATTATATTAAAGG + Intergenic
980749112 4:137065660-137065682 TTTTAACTTTTATAGATTTATGG + Intergenic
980787006 4:137568953-137568975 TATCAGCTTTAGGAGATTTTGGG + Intergenic
981404402 4:144351438-144351460 TATAACCTTTAGCAAAATTAGGG + Intergenic
981662891 4:147188146-147188168 TATCATCTTTAGGAGATTTTGGG - Intergenic
982028421 4:151275691-151275713 TTTAAATTTTTGTAGATATAGGG + Intronic
982052463 4:151515567-151515589 TATCAGCTTAAGGAGATTTAGGG - Intronic
982782300 4:159504050-159504072 TATTGACTTTATTAGATTTTTGG + Intergenic
982852570 4:160338357-160338379 TATCAGCTTAAGTAGATTTTGGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
983681603 4:170359727-170359749 TATCAGCTTTAGGAGATTTTGGG + Intergenic
983733516 4:171028947-171028969 TATTAACTTAAGGAGATTTTGGG - Intergenic
984020780 4:174482660-174482682 TTTAAATTTTAATAGCTTTAGGG - Intergenic
984330383 4:178308058-178308080 TATAAACTTTAATATATTTATGG + Intergenic
985233537 4:187848504-187848526 TATTTATTTCAGTAGATTTAGGG + Intergenic
986114989 5:4764800-4764822 CATAAACTTGAAAAGATTTAGGG + Intergenic
987395611 5:17420354-17420376 ACTAAATTTTACTAGATTTATGG + Intergenic
987482972 5:18482432-18482454 TATAAATTTTAGTATATTTAAGG - Intergenic
987833827 5:23135067-23135089 TCTAAACATTATTAAATTTATGG - Intergenic
987872965 5:23644155-23644177 TATCAGCTTAAGTAGATTTTGGG + Intergenic
988233029 5:28504881-28504903 TATCAACTTAAGGAGATTTTGGG - Intergenic
988325127 5:29754950-29754972 TATCAACTTGAGGAGATTTGGGG - Intergenic
988445755 5:31284295-31284317 TACAAACTTCAGTAGATGGAAGG - Intronic
988614165 5:32757478-32757500 TATCAACTTAAGGAGATTTTGGG + Intronic
988646186 5:33097777-33097799 TATCAACTTAAGGAGATTTTAGG + Intergenic
988672110 5:33392969-33392991 TATCAGCTTTAGGAGATTTTGGG - Intergenic
988745699 5:34134800-34134822 TATCAACTTAAGGAGATTTTGGG + Intergenic
988801893 5:34703727-34703749 TTTAAGCTTTAGTTGCTTTATGG + Intronic
989344914 5:40419079-40419101 TATAAGCTTAAGGAGATTTTGGG + Intergenic
989401168 5:41009144-41009166 TATAAACTGGAGTAAAGTTAGGG + Intronic
989402766 5:41026299-41026321 TATCAGCTTAAGTAGATTTTGGG - Intronic
989443304 5:41498152-41498174 GACAAAATTTAGTAGAATTAAGG + Intronic
989629260 5:43464068-43464090 TATCAACTTAAGGAGATTTTGGG - Intronic
989948656 5:50270973-50270995 TATCAGCTTTAGGAGATTTTGGG - Intergenic
990107253 5:52279665-52279687 TATCAGCTTAAGTAGATTTTGGG - Intergenic
990201007 5:53374301-53374323 TATTTATTTTTGTAGATTTAAGG - Intergenic
990380647 5:55219687-55219709 CATATAATTTAGAAGATTTATGG - Intronic
990675474 5:58179590-58179612 TATAAACTATACCATATTTAAGG - Intergenic
990744010 5:58939735-58939757 CATAAACTTTGGGAGATTTTTGG + Intergenic
990755016 5:59058868-59058890 TCTAGACTTCAGTACATTTAGGG - Intronic
991002824 5:61799890-61799912 TACAAAATTTAGTAAATTTTAGG - Intergenic
991223962 5:64247376-64247398 TATAAGCTTAAGGAGATTTTGGG - Intronic
991495988 5:67226599-67226621 TATCAGCTTTAGGAGATTTTGGG + Intergenic
991541847 5:67738782-67738804 TATAAGCTTAAGGAGATTTTGGG + Intergenic
991647421 5:68815152-68815174 TATCAACTTGATTAGATTGAAGG + Intergenic
992213001 5:74499056-74499078 TAAACAATTTTGTAGATTTATGG + Intergenic
992338112 5:75794496-75794518 TATCAGCTTAAGTAGATTTTGGG + Intergenic
992580604 5:78171616-78171638 TATCAACTTAAGGAGATTTTGGG + Intronic
993043678 5:82843590-82843612 TATCAGCTTTAGGAGATTTTGGG + Intergenic
993259702 5:85642607-85642629 TATCAGCTTAAGGAGATTTAGGG - Intergenic
993261143 5:85659474-85659496 TATCAGCTTAAGGAGATTTAGGG + Intergenic
993949100 5:94151515-94151537 TATAAACTTTATTGCACTTATGG + Intergenic
994859891 5:105177799-105177821 TATAAAATGTAGTAGAATCAGGG - Intergenic
995161114 5:108983432-108983454 TTTAAAATTGAGTAGATTTTGGG + Intronic
995178778 5:109210372-109210394 TATCAACTTAAGGAGATTTTGGG + Intergenic
995316156 5:110776826-110776848 TATCAACTTAAGGAGATTTTGGG - Intergenic
995750236 5:115446313-115446335 TATCAACTTAAGGAGATTTTGGG - Intergenic
996157344 5:120118238-120118260 TATCAGCTTAAGTAGATTTTGGG - Intergenic
996215892 5:120865076-120865098 TCAAAAATTTAGTAGATTTCTGG - Intergenic
996269274 5:121582791-121582813 TATAAACACTAGTACATTTAGGG + Intergenic
996883074 5:128323135-128323157 TATCAGCTTTAGGAGATTTTGGG + Intronic
997252697 5:132402355-132402377 TATCAACTTAAGGAGATTTTGGG - Intergenic
998780860 5:145655012-145655034 TATAAGCTTAAGGAGATTTTGGG - Intronic
1000061749 5:157663716-157663738 TATCAACTTAAGGAGATTTTGGG - Intronic
1000069356 5:157725239-157725261 TATCAGCTTCAGGAGATTTAGGG - Intergenic
1000119742 5:158185842-158185864 TATCAGCTTAAGTAGATTTTGGG - Intergenic
1000428911 5:161127183-161127205 TATAAAATTGTGTATATTTAAGG + Intergenic
1000739357 5:164947299-164947321 TATAAACTAGAGAAGATCTAAGG - Intergenic
1002976112 6:2078898-2078920 GATAAATATTACTAGATTTAAGG - Intronic
1003206013 6:4012578-4012600 CAAAAACTGTAGTAGTTTTAGGG - Intergenic
1004038865 6:11954246-11954268 TATAAACTTAAGTAGTATTATGG - Intergenic
1004042067 6:11989399-11989421 AATAAATTTTACTATATTTACGG + Intergenic
1005543858 6:26843031-26843053 TATCAACTTAAGGAGATTTTGGG + Intergenic
1005663527 6:28025014-28025036 TATCAACTTAAGGAGATTTTGGG - Intergenic
1005779812 6:29178477-29178499 TATCAACTTAAGGAGATTTTGGG + Intergenic
1005791847 6:29310988-29311010 TATAAGCTTAAGGAGATTTTGGG + Intergenic
1006222810 6:32508391-32508413 TATCAACTTAAGGAGATTTTGGG - Intergenic
1007786328 6:44281885-44281907 TATATACTTAAATATATTTAGGG + Intronic
1007869569 6:45018224-45018246 TATCAACTTAAGGAGATTTTGGG + Intronic
1008643479 6:53489021-53489043 TATCAACTTAAGGAGATTTTGGG - Intergenic
1008781790 6:55115715-55115737 TGTAGATTTTAGTAGATTTAGGG + Intronic
1009014639 6:57884700-57884722 TATCAACTTAAGGAGATTTTGGG + Intergenic
1009399162 6:63233661-63233683 TATCAACTTAAGGAGATTTTGGG + Intergenic
1009476046 6:64093632-64093654 TATCAGCTTTAGAAGATTTTGGG + Intronic
1009518371 6:64649510-64649532 TAGAAACTTTAGTAGAGATGGGG + Intronic
1009521564 6:64689084-64689106 TATCAGCTTAAGTAGATTTTGGG - Intronic
1009586946 6:65619431-65619453 TATCAGCTTTAGGAGATTTTGGG + Intronic
1009675280 6:66812137-66812159 TATCAGCTTTAGGAGATTTTGGG + Intergenic
1009713861 6:67361692-67361714 TTTAAACTTTTATATATTTAAGG + Intergenic
1009845292 6:69126742-69126764 TGTCAACTTTACTAGATTAAGGG - Intronic
1009852433 6:69214579-69214601 TTTAAACCTAAGTAGATTTGGGG - Intronic
1009921275 6:70064724-70064746 TATCAACTTAAGGAGATTTTGGG - Intronic
1010014520 6:71089095-71089117 TATTAACTTTATTATATTAATGG - Intergenic
1010286175 6:74080742-74080764 TATCAGCTTAAGTAGATTTTGGG + Intergenic
1010303960 6:74294923-74294945 TATACATTTTAGCAGATTGATGG + Intergenic
1010566593 6:77422853-77422875 TATAAACTCTAGTATGTTTCAGG + Intergenic
1010866533 6:80982676-80982698 TATAAACTTTTAAAGACTTAAGG + Intergenic
1010972754 6:82280275-82280297 TATCAGCTTAAGGAGATTTAGGG + Intergenic
1011016150 6:82758107-82758129 TATCAACTTAAGAAGATTTTGGG - Intergenic
1011334072 6:86240899-86240921 TATAAGCTTAAGGAGATTTTGGG - Intergenic
1012570842 6:100726252-100726274 TTTAAAATTTAGGAGAATTATGG - Intronic
1012676532 6:102120005-102120027 TATATACATGAGTAGATTTGGGG - Intergenic
1012752999 6:103186474-103186496 TATAAATTATAGTAGTTTGAAGG + Intergenic
1012757582 6:103251384-103251406 TATCAGCTTAAGTAGATTTTGGG - Intergenic
1014025693 6:116642950-116642972 TATCAACTTAAGGAGATTTTGGG - Intronic
1014134703 6:117875098-117875120 TATCAGCTTAAGTAGATTTTGGG + Intergenic
1014138342 6:117913225-117913247 GACAAACTTCAGTAGATGTATGG + Intronic
1014358064 6:120436824-120436846 TATCAACTTAAGGAGATTTTGGG - Intergenic
1014843042 6:126242047-126242069 TATCAACTTAAGGAGATTTTGGG - Intergenic
1014991348 6:128081740-128081762 TATAAACTTTAGTAGATTTAGGG + Intronic
1015076206 6:129161351-129161373 TATTAACTATATTAAATTTAGGG - Intronic
1015080866 6:129224223-129224245 TATCAGCTTTAGGAGATTTTGGG + Intronic
1015230483 6:130909649-130909671 TATCAGCTTAAGTAGATTTTGGG - Intronic
1015911644 6:138174145-138174167 TATAGACTTTTATACATTTAAGG + Intronic
1017138161 6:151166451-151166473 AATACACATTAGTACATTTATGG - Intergenic
1017198125 6:151723906-151723928 TAGAAAATTTTATAGATTTAGGG - Intronic
1017910394 6:158787416-158787438 TATAAATTTGAGCAGATTCAGGG + Intronic
1018287900 6:162260361-162260383 AATAAATTCTAGTAAATTTATGG - Intronic
1018557264 6:165062494-165062516 TAGAAAATTTAGTAAACTTATGG + Intergenic
1020358033 7:7299023-7299045 TATCAACTTAAGAAGATTTTGGG + Intergenic
1020630179 7:10629928-10629950 TATCAGCTTAAGGAGATTTAGGG - Intergenic
1020694726 7:11399339-11399361 TCTAAACTTTATTTTATTTATGG + Intronic
1020703340 7:11511046-11511068 TATCAACTTAAGGAGATTTTGGG - Intronic
1020751086 7:12143204-12143226 TATCAACTTAAGGAGATTTTGGG - Intergenic
1020953578 7:14710637-14710659 TATACACATTATTAGATTAATGG + Intronic
1021081844 7:16374041-16374063 TATTAACTTGATTAGATTAAAGG + Intronic
1021261282 7:18460385-18460407 TATAAAATTTTGTAGAATTATGG + Intronic
1021307550 7:19050006-19050028 TATCAGCTTAAGAAGATTTAGGG - Intronic
1022453968 7:30541733-30541755 TATCAACTTAAGGAGATTTTGGG - Intronic
1023213730 7:37836448-37836470 TATAACATTTAGTAGAATTGGGG + Intronic
1023593556 7:41804649-41804671 TGTAATATTTAGCAGATTTAGGG - Intergenic
1024372533 7:48603107-48603129 TCTCAGCTTTAGGAGATTTAGGG + Intronic
1024698985 7:51886320-51886342 TGTTGACTTTAGTAGAATTAAGG + Intergenic
1024905934 7:54379894-54379916 TATAAACTTTAGAATAGTTTGGG + Intergenic
1025033840 7:55579055-55579077 TATCAACTTAAGGAGATTTTGGG + Intergenic
1025278938 7:57612094-57612116 TATTATCTTTAGAAGTTTTATGG + Intergenic
1025290977 7:57722601-57722623 TATCAACTTAAGGAGATTTTGGG + Intergenic
1025305793 7:57853406-57853428 TATTATCTTTAGAAGTTTTATGG - Intergenic
1027765257 7:82332680-82332702 TGTAGACTTCAGTACATTTATGG - Intronic
1027815829 7:82969319-82969341 TACAAACCTTAGTAGTTTAATGG - Intronic
1028362457 7:89985500-89985522 TATCAGCTTTAGGAGATTTTGGG + Intergenic
1028800160 7:94953837-94953859 TATCAACTTAAGGAGATTTTGGG + Intronic
1028800196 7:94954436-94954458 TATAGACTTAAGTAGAAATAAGG - Intronic
1028887159 7:95947056-95947078 TAGAAATTTTAGTATTTTTAAGG + Intronic
1029882193 7:103826245-103826267 TATAAACAATAGAAGATTTTTGG - Intronic
1030426439 7:109384770-109384792 TATAAGCTTAAGGAGATTTTGGG - Intergenic
1030508900 7:110458413-110458435 TATCAACTTAAGGAGATTTTGGG - Intergenic
1030529814 7:110698601-110698623 TATAAACTTTAGAAGCCTTTAGG + Intronic
1030551694 7:110969378-110969400 TATAGACTTTAGTTGTTTTTGGG + Intronic
1030565764 7:111153283-111153305 AATTAACTTTAGTAGGTATAAGG - Intronic
1030959047 7:115891595-115891617 TATCAGCTTTAGGAGATTTTGGG - Intergenic
1031441229 7:121797018-121797040 TATGAACGTTAGTATATTTCGGG + Intergenic
1032881557 7:136096082-136096104 TATCAACTTAAGGAGATTTTGGG + Intergenic
1032966745 7:137106432-137106454 TATCAACTTCAGGAGATTTTGGG - Intergenic
1033374605 7:140746039-140746061 TATTGACTAGAGTAGATTTACGG - Intronic
1033787552 7:144752009-144752031 TATCAACTTAAGGAGATTTTTGG + Intronic
1034037543 7:147840298-147840320 TTTAAATTTTTATAGATTTAGGG - Intronic
1035543774 8:462882-462904 TTTAAACTTCAATAGCTTTAGGG - Intronic
1035748888 8:1981503-1981525 TGTCAACTTGAGTAGATTAAGGG + Intronic
1035790878 8:2303841-2303863 TATCAGCTTTAGGAGATTTTGGG + Intergenic
1035801927 8:2417864-2417886 TATCAGCTTTAGGAGATTTTGGG - Intergenic
1036387516 8:8295090-8295112 TATGAATTTTGGTAGAGTTAAGG - Intergenic
1036551604 8:9820394-9820416 TATCAGCTTAAGGAGATTTAGGG - Intergenic
1036558396 8:9880857-9880879 TATCAGCTTAAGGAGATTTAGGG - Intergenic
1036804131 8:11816747-11816769 TATCAGCTTAAGGAGATTTAGGG + Intronic
1038932220 8:32206642-32206664 TATTAATTTTTATAGATTTAGGG + Intronic
1039053885 8:33518812-33518834 TAAAAATTTGATTAGATTTAGGG - Intergenic
1039323891 8:36464171-36464193 TATCAACTTGAGTGGATTGAAGG - Intergenic
1040098213 8:43469541-43469563 CACAAACTTTAATACATTTAAGG + Intergenic
1040326878 8:46350486-46350508 TATCAACTTAAGGAGATTTTGGG + Intergenic
1040354362 8:46602655-46602677 TATAAGCTTAAGGAGATTTTGGG + Intergenic
1040541045 8:48355991-48356013 TATCAACTTAAGGAGATTTTGGG - Intergenic
1040655447 8:49502347-49502369 TCTTAATTTTAGTATATTTAAGG - Intergenic
1040678280 8:49778307-49778329 AATAAACTTTAGGATTTTTATGG + Intergenic
1040725990 8:50382202-50382224 TATCAACTTTATTGGATTGAGGG - Intronic
1041001223 8:53456058-53456080 TATCAGCTTTAGGAGATTTGGGG + Intergenic
1041750032 8:61250793-61250815 TATCAGCTTAAGGAGATTTAGGG + Intronic
1041771434 8:61476675-61476697 TATCAACTTAAGGAGATTTTGGG + Intronic
1041772235 8:61484206-61484228 TATCAACTTAAGGAGATTTAGGG - Intronic
1042070420 8:64927326-64927348 TATCAGCTTTAGAAGATTTTGGG + Intergenic
1043240649 8:77929944-77929966 TATAACCTTTAGTAAATTTAAGG + Intergenic
1043320330 8:78976548-78976570 GATATCCTTTAGTAGATTAATGG - Intergenic
1043488190 8:80719668-80719690 TATGAATTTTAGTAAATTCATGG + Intronic
1043509227 8:80933127-80933149 GATAAGCTTTTGTAGATTTAGGG + Intergenic
1043980989 8:86639110-86639132 TATTGACTTTAGTTGATGTAAGG - Intronic
1044448819 8:92310236-92310258 TATCAACTTAAGGAGATTTTAGG + Intergenic
1044851272 8:96431341-96431363 TATCAACTTCAGTATATTCATGG + Intergenic
1044856879 8:96485461-96485483 TATAAATGTTTGTAGTTTTATGG - Intergenic
1044939863 8:97331014-97331036 TATCAACTTAAGTAGTTTTGGGG + Intergenic
1045090264 8:98734777-98734799 TAAAAACTTTAGTATATTTGTGG - Intronic
1045225302 8:100238262-100238284 TATAAACTAGAGCAGATTTAAGG + Intronic
1045624403 8:104026077-104026099 TATATAGTTTAGTAGATTTTTGG + Intronic
1045827845 8:106421858-106421880 TATCAACTTGCGTATATTTAAGG - Intronic
1046304570 8:112347200-112347222 TAAAAACTTGAGTAAATTTCTGG - Intronic
1046496527 8:115021938-115021960 TATAATTTTTATTAGACTTATGG + Intergenic
1046641075 8:116732369-116732391 TCTAAAATTTAGAAGAGTTAAGG + Intronic
1046777933 8:118183681-118183703 TTTTAATTTTAGTAGCTTTAGGG + Intergenic
1047135823 8:122077166-122077188 GAAAAAATTTAGTAGGTTTAGGG + Intergenic
1047161043 8:122379808-122379830 AATAAACATTAGTTTATTTATGG - Intergenic
1047244288 8:123125650-123125672 TGTGAATTTTAGTAGATTTGAGG + Intronic
1050194749 9:3069849-3069871 AATAAACTTTAAGCGATTTAGGG + Intergenic
1050275077 9:3988468-3988490 TATAAATTTTGGGAGAATTATGG - Intronic
1050805920 9:9677832-9677854 TATCAACTTAAGGAGATTTTGGG - Intronic
1050866484 9:10507060-10507082 TATCAACTTAAGGAGATTTTGGG - Intronic
1051325411 9:15961694-15961716 TATATATTTTAGTATAGTTATGG - Intronic
1051690566 9:19708018-19708040 TATCAGCTTAAGGAGATTTAGGG - Intronic
1051708675 9:19907590-19907612 TATCAGCTTAAGTAGATTTTGGG - Intergenic
1052258013 9:26482078-26482100 TATAAGCTTAAGGAGATTTTTGG - Intergenic
1052587059 9:30442358-30442380 TATCAACTTAAGGAGATTTTGGG + Intergenic
1052607761 9:30726931-30726953 TTTAAACTTCATAAGATTTATGG + Intergenic
1052710361 9:32048064-32048086 TAAAAAATTTTATAGATTTAGGG - Intergenic
1052888363 9:33671592-33671614 TATCAACTTAAGGAGATTTTGGG - Intergenic
1053298545 9:36932661-36932683 AATAGTTTTTAGTAGATTTAAGG - Intronic
1053619580 9:39801844-39801866 TTCAAACTTTAGATGATTTAGGG + Intergenic
1054264578 9:62905599-62905621 TTCAAACTTTAGATGATTTAGGG - Intergenic
1055230207 9:74053912-74053934 TATAAACTGTACTGTATTTAGGG - Intergenic
1056172757 9:84003668-84003690 TATAATATTTGGTATATTTAAGG + Exonic
1057096942 9:92319764-92319786 AATAAACTACAGTAGATTGATGG - Intronic
1058278015 9:103071292-103071314 TTTAAAAATTAGTGGATTTATGG - Intergenic
1058493444 9:105527908-105527930 TATAAGCTTAAGGAGATTTTGGG - Intronic
1059589193 9:115639540-115639562 TATCAACTTAAGGAGATTTTGGG + Intergenic
1059592583 9:115678078-115678100 TGTCAACTTGATTAGATTTAAGG - Intergenic
1059828439 9:118061668-118061690 TTTAAACTTTAGTTGTTCTAGGG + Intergenic
1059878119 9:118658877-118658899 TCTAAGCTTTATTAGATTTAAGG - Intergenic
1061686053 9:132279673-132279695 GATAAACTTTTGAGGATTTAGGG - Intronic
1203412884 Un_KI270589v1:11732-11754 TATCAACTTAAGGAGATTTTGGG + Intergenic
1203685309 Un_KI270757v1:48139-48161 TATCAACTTAAGGAGATTTTGGG - Intergenic
1186855714 X:13624208-13624230 TATAAAGTTTGGGAGAGTTAGGG + Intronic
1187214315 X:17261470-17261492 TAAAATTTTCAGTAGATTTATGG + Intergenic
1188355278 X:29183072-29183094 AATAAATTTTTGTAGTTTTAAGG + Intronic
1188652931 X:32654028-32654050 TATCAGCTTAAGTAGATTTTGGG + Intronic
1188876203 X:35433500-35433522 TATATATTTTAGCAGACTTAAGG + Intergenic
1188899002 X:35706340-35706362 TATTTATTTCAGTAGATTTAGGG - Intergenic
1189595463 X:42560276-42560298 TAAAAATTTTTATAGATTTAGGG + Intergenic
1189619217 X:42818129-42818151 TAAAAACATTAATAGATTTTTGG + Intergenic
1189702212 X:43723563-43723585 TATCAACTTAAGGAGATTTTGGG + Intronic
1190500092 X:51066918-51066940 TATTTACTTTTATAGATTTAGGG - Intergenic
1191096432 X:56677969-56677991 TATCAGCTTTAGAAGATTTTGGG - Intergenic
1191134351 X:57047705-57047727 TATAAGCTTAAGGAGATTTTGGG - Intergenic
1191597573 X:62962563-62962585 TATCAACTTAAGGAGATTTTGGG + Intergenic
1191748133 X:64512592-64512614 TATAAGCTTAAGGAGATTTTGGG + Intergenic
1191990544 X:67030430-67030452 TATAAGCTTAAGGAGATTTTGGG - Intergenic
1192009621 X:67254445-67254467 TATCAACTTAAGGAGATTTTAGG - Intergenic
1192010837 X:67270673-67270695 TATCAACTTAAGGAGATTTTGGG - Intergenic
1192029356 X:67492607-67492629 TATCAGCTTAAGGAGATTTAAGG - Intergenic
1192532292 X:71898950-71898972 TATCAACTTAAGGAGATTTTGGG + Intergenic
1192919546 X:75692035-75692057 TATCAGCTTTAGGAGATTTTGGG + Intergenic
1193001148 X:76563806-76563828 TATCAGCTTAAGTAGATTTTGGG - Intergenic
1193349763 X:80448393-80448415 TGTAAATTTTAGCAGTTTTAAGG + Intergenic
1193666119 X:84319724-84319746 TAGAATTTTTAATAGATTTAAGG - Exonic
1193727572 X:85060758-85060780 TATCAGCTTTAGGAGATTTTGGG + Intronic
1193788552 X:85790627-85790649 TATCAGCTTTAGGAGATTTTGGG + Intergenic
1193842579 X:86425686-86425708 TCTAACCTTTATTATATTTAAGG + Intronic
1193927049 X:87500338-87500360 TATCAGCTTAAGTAGATTTTGGG + Intergenic
1194190584 X:90831925-90831947 TATAAAATTTATAAAATTTAAGG - Intergenic
1194249474 X:91556730-91556752 TAGAAACTTTATCAGATTAAAGG - Intergenic
1194376966 X:93148591-93148613 TATATACTCTAGTAAATTAAAGG - Intergenic
1195573704 X:106425517-106425539 TGTAATTTTTAGTGGATTTATGG + Intergenic
1196561612 X:117155946-117155968 TATCAGCTTTAGGAGATTTTGGG - Intergenic
1197079435 X:122394535-122394557 TATAAGCTTAAGGAGATTTTGGG + Intergenic
1197319958 X:125016326-125016348 TATCAACTTAAGGAGATTTTGGG - Intergenic
1197465665 X:126801876-126801898 TATCAGCTTAAGGAGATTTAGGG + Intergenic
1198319667 X:135507439-135507461 AATTAATTTCAGTAGATTTAGGG + Intergenic
1198556256 X:137796569-137796591 TATCAACTTAAGGAGATTTGAGG - Intergenic
1198669780 X:139067396-139067418 TATCAACTTAAGGAGATTTTGGG - Intronic
1198974243 X:142317977-142317999 TGTAAACTTGAGAAGATTCATGG - Intergenic
1199122406 X:144071123-144071145 TATCAGCTTAAGGAGATTTAGGG + Intergenic
1199133090 X:144217899-144217921 TAAAAACTTTAATAAATTTTTGG - Intergenic
1199524533 X:148777729-148777751 TATCAACTTAAGAAGATTTTGGG + Intronic
1200537244 Y:4414348-4414370 TATAAAATTTATAAAATTTAAGG - Intergenic
1200568432 Y:4797945-4797967 TAGAAACTTTATCAGATTAAAGG - Intergenic
1201673934 Y:16558192-16558214 TAGAAACTTTAGTAGATAACTGG - Intergenic
1201930293 Y:19337546-19337568 TTTAAATTTTAGTAGTTTTGGGG + Intergenic
1201983651 Y:19936817-19936839 TATAAACATTTGTAGAATTGTGG + Intergenic
1202083034 Y:21104612-21104634 TATAGGCTTTGGTAGACTTATGG - Intergenic
1202175028 Y:22090311-22090333 TATCAGCTTAAGTAGATTTTGGG - Intronic
1202216334 Y:22496072-22496094 TATCAGCTTAAGTAGATTTTGGG + Intronic
1202326852 Y:23699992-23700014 TATCAGCTTAAGTAGATTTTGGG - Intergenic
1202543917 Y:25970060-25970082 TATCAGCTTAAGTAGATTTTGGG + Intergenic