ID: 1014999773

View in Genome Browser
Species Human (GRCh38)
Location 6:128200827-128200849
Sequence AAGAAGAAGGATGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4799
Summary {0: 1, 1: 45, 2: 197, 3: 793, 4: 3763}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1014999773 Original CRISPR AAGAAGAAGGATGAGGAGGA GGG Intronic
Too many off-targets to display for this crispr