ID: 1015001651

View in Genome Browser
Species Human (GRCh38)
Location 6:128224066-128224088
Sequence CAGAATAAAGAGCCTATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015001651 Original CRISPR CAGAATAAAGAGCCTATAAA AGG (reversed) Intronic
900249215 1:1658487-1658509 CTGAGTTAAGAGCCTTTAAACGG - Intronic
900260163 1:1723831-1723853 CTGAGTTAAGAGCCTTTAAACGG - Intronic
902687549 1:18088475-18088497 CAGAACAAAGAGCCTGGAGAAGG - Intergenic
904212508 1:28895269-28895291 CATAAGAAATAGCCAATAAATGG - Intronic
906071510 1:43020135-43020157 CAGATTAAACACCCAATAAATGG - Intergenic
906731711 1:48087850-48087872 CAGAATACAGAGTCCATAAATGG - Intergenic
906893900 1:49749979-49750001 CAGAATAAAGAGTACAGAAATGG + Intronic
907251052 1:53139778-53139800 AAGAATAAAGAGAATATAAAAGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907788190 1:57634910-57634932 AAGAAGAAATAGCCAATAAATGG + Intronic
907817167 1:57930209-57930231 CAGAATAGAAAGCCCAGAAATGG - Intronic
908007831 1:59744950-59744972 CATAATAAAGAGAGTTTAAAAGG + Intronic
910154896 1:84205220-84205242 CATAATACAGAGCCTTTTAATGG - Intronic
910491172 1:87773355-87773377 CAGAATAAATAGTCTCAAAAAGG + Intergenic
911065536 1:93784716-93784738 CAAAATCAAGAGCCTTTGAAAGG + Intronic
914250461 1:145917990-145918012 GAGAAAAAAGAGTCTAGAAAGGG + Intronic
914358480 1:146909355-146909377 CACAATGAAGGGCCAATAAATGG - Intergenic
914494945 1:148187652-148187674 CACAATGAAGGGCCAATAAATGG + Intergenic
914898118 1:151695205-151695227 CAGAATCAAGAGCCCATACCAGG - Exonic
914958565 1:152186435-152186457 AAGTATAAATAGCCTATGAAGGG + Intergenic
916066125 1:161137137-161137159 AAGAATAAACAGCCTGTAGAAGG + Intergenic
916551343 1:165852730-165852752 CAGAAGAAAGAACTTATATAAGG - Intronic
916591657 1:166196738-166196760 CAGAATAAAGTCCCTTTAAATGG - Intergenic
917946846 1:179982476-179982498 CAAAATAAATACCCTATTAATGG - Intronic
918673237 1:187247592-187247614 CAGAATAGAGAGCCTAGAAATGG + Intergenic
918838883 1:189507536-189507558 CAGAATAAAAAGTGTGTAAAGGG - Intergenic
918966100 1:191350723-191350745 CAGAATAGAGAGCCAAAAATTGG + Intergenic
919130990 1:193450247-193450269 AAGAATAAAGAGCCTACAGGAGG - Intergenic
919562120 1:199134855-199134877 CAGAATACAGAGCCAATTATAGG - Intergenic
921179689 1:212622205-212622227 CAGAGTCAAGAGCTTTTAAAGGG + Intergenic
921577497 1:216853888-216853910 CAGACTTAAAAACCTATAAATGG - Intronic
922121806 1:222677802-222677824 CTGAATAAATAGCCAATACATGG - Intronic
923700729 1:236298085-236298107 CATAATAAAAGGACTATAAATGG + Intergenic
924066779 1:240231731-240231753 CAGCATAAAGAGCTTATGTAAGG + Intronic
924716279 1:246577314-246577336 CAGTAGGAAGAGGCTATAAAGGG - Intronic
924902870 1:248420093-248420115 CAGAACAAAGATCCAATAAATGG - Intergenic
924918562 1:248601208-248601230 CAGAAAATAAAGCCTAGAAATGG - Intergenic
1064758156 10:18590850-18590872 GAGAAGAAAGAGCCAACAAAAGG + Intronic
1064874910 10:19983028-19983050 CAGTCTAAAGAACATATAAATGG - Intronic
1065136562 10:22676638-22676660 CAGCAGGAAGAGCCTATGAAAGG - Intronic
1065729554 10:28698584-28698606 CAGAATAACTAGCGTATCAAAGG + Intergenic
1067555886 10:47270530-47270552 CAAAGTAAAGAGCCCAGAAATGG - Intergenic
1068006893 10:51401741-51401763 CATAATTAAGAGTTTATAAAAGG + Intronic
1068404038 10:56567420-56567442 CAGTATAAAGATTCTAAAAATGG + Intergenic
1068406393 10:56595130-56595152 CAGAATTAAGAGTCTACAGAGGG - Intergenic
1071613229 10:87050727-87050749 CAGAATGCAAAGCCTCTAAAAGG + Exonic
1071727476 10:88214042-88214064 CAGAAGACAGAGCCGAGAAATGG - Intergenic
1071757880 10:88565634-88565656 CATCATAAAGAGCCTACATATGG + Intronic
1071775213 10:88778947-88778969 AAGAACAAAAAGCCTGTAAAGGG - Intergenic
1071783099 10:88868998-88869020 AAGAATAAAGAGCTTGTAAGTGG + Intergenic
1073633280 10:105170556-105170578 CAGTATCAACATCCTATAAATGG - Intronic
1073762673 10:106647534-106647556 CAGAATAGAGTGCCTAGAAATGG + Intronic
1074548441 10:114420542-114420564 GAGAATAAAGTGGCTATTAATGG - Intergenic
1074855133 10:117467716-117467738 CAGAATCAAGTGCCTATGAAAGG - Intergenic
1075347684 10:121696185-121696207 CAGAATCATGAGCAAATAAATGG + Intergenic
1075514195 10:123096272-123096294 CAAAACAAAGAGCCTAGAAAGGG + Intergenic
1075669635 10:124255570-124255592 CAGATTAAGCAGCCTTTAAATGG - Intergenic
1076283429 10:129271065-129271087 AAGAATAAAGAGCATAGAACAGG + Intergenic
1076991009 11:274054-274076 CAGAATACAGAGCCCAGAATTGG - Intergenic
1077764112 11:5138663-5138685 AAAAATAATGAGCCAATAAAGGG + Intergenic
1079615887 11:22492449-22492471 CAGAATAAAATGTCTTTAAAAGG - Intergenic
1080250733 11:30230234-30230256 AGGAAACAAGAGCCTATAAATGG + Intergenic
1080769840 11:35330444-35330466 CAGAATAAAAAGTCAATAAATGG - Intronic
1081042393 11:38227336-38227358 CAGAATAAATAGCATATTTATGG + Intergenic
1081190334 11:40096440-40096462 AACAATAAAGAGCATATAACTGG + Intergenic
1081365022 11:42224266-42224288 CAGCATACAGAGCATGTAAATGG - Intergenic
1081560545 11:44211122-44211144 CAGAATAAAGAGTTTAGAAATGG + Intronic
1082663144 11:55939729-55939751 GAAAATAAAGAGACTATAATTGG - Intergenic
1083549076 11:63572361-63572383 AAAAATAAAGAGCCTTTAATTGG + Intergenic
1083565284 11:63710131-63710153 CAGAATAAACAGTATATGAAGGG + Intronic
1084474160 11:69379226-69379248 GAGAAAAAAGAGGCTAGAAATGG - Intergenic
1084686910 11:70701703-70701725 CAGAAAAAGAAGCCTTTAAAAGG + Intronic
1084928194 11:72531212-72531234 CAGAATAAAGAACCCAGAAATGG - Intergenic
1086393059 11:86385684-86385706 CAGAATAGACACCCGATAAACGG + Intronic
1086516150 11:87615559-87615581 TAGAAGAAAGAGCTTACAAAGGG + Intergenic
1086763041 11:90657858-90657880 CAAAATAAAGAACCTAGAAAAGG - Intergenic
1086785129 11:90959421-90959443 CAGAATAGAGAGCCCAGCAAAGG + Intergenic
1087276704 11:96168113-96168135 AAGATTAGAGAGCCTGTAAATGG - Intronic
1088000252 11:104870833-104870855 CAGAATACAGAGACTATAGGAGG + Intergenic
1088060289 11:105641451-105641473 TAGAATATAGAGTGTATAAATGG + Intronic
1088412112 11:109545637-109545659 CAGAATAAATAACCTAGAAATGG + Intergenic
1088559012 11:111093423-111093445 CACAATAAACACTCTATAAACGG - Intergenic
1089838861 11:121396309-121396331 CAGAAGAAATAGCTTAAAAATGG - Intergenic
1090448540 11:126785575-126785597 CTGATTAAAAAGCCTATAGAAGG + Intronic
1090937951 11:131361896-131361918 GTGAATTAAGTGCCTATAAAAGG - Intergenic
1091234852 11:134014541-134014563 TAGAAGAAGGAGCCTAAAAATGG + Intergenic
1091527832 12:1322689-1322711 CAGAATAAAGAGCTTAGAATTGG - Intronic
1092758021 12:11783201-11783223 GAGAAGGAAGAGCCTATAAGAGG + Intronic
1092935929 12:13364433-13364455 CAGGATAAAGATCAAATAAAAGG - Intergenic
1093216938 12:16373638-16373660 TTGAATAAAAAGCATATAAATGG + Intronic
1094214818 12:27929689-27929711 CAGAACAAAGAGAATATTAAAGG - Intergenic
1094280827 12:28735883-28735905 TAGAAGAAAGAGCCTTTTAATGG + Intergenic
1096510811 12:52127099-52127121 CAGAAAACAGAGACTGTAAAAGG - Intergenic
1096796331 12:54080353-54080375 TTTAATAAAGAGCCTAGAAAGGG + Intergenic
1097559865 12:61189632-61189654 AAGAATCAAAAGCCTCTAAAAGG - Intergenic
1097642508 12:62199320-62199342 CAGAATAAATAGCTTATGCATGG - Intronic
1097647944 12:62259778-62259800 CGTCACAAAGAGCCTATAAAGGG + Intronic
1097720459 12:63014392-63014414 GAGAATAAAGAGCCTTTCTAGGG - Intergenic
1097909149 12:64950473-64950495 CAGAATACAGAGGATAAAAAGGG - Intergenic
1097938864 12:65281794-65281816 CAGATGAAATAGCCTATAATGGG + Intronic
1098066144 12:66619260-66619282 CAGAGTACAAAGCCTATAAAAGG + Intronic
1098855417 12:75647312-75647334 CAGAATATACAGAATATAAAGGG + Intergenic
1098940936 12:76534821-76534843 TAGAATAAGGAGTCTAGAAATGG + Intronic
1099162840 12:79266328-79266350 CAAAATAAAGGGCTTATATATGG + Intronic
1099318891 12:81119649-81119671 TAGCATAGACAGCCTATAAATGG - Intronic
1099775550 12:87123367-87123389 CAGAATAAAGAGCCACAAAAAGG - Intergenic
1099775700 12:87125308-87125330 CAGAATAAAGAGCCATGAAAGGG - Intergenic
1099812308 12:87599123-87599145 AAGTATAAAGTGCCTAAAAATGG + Intergenic
1101191187 12:102334680-102334702 AAGAATGAAGAGCATAGAAATGG - Intergenic
1101558835 12:105836379-105836401 CAGAAGAAACAGCTTATAAAAGG + Intergenic
1101939733 12:109090957-109090979 CAGAATAAAGAGGCTGAAATTGG + Intronic
1102707859 12:114897600-114897622 CAGACTAAAAAGGCTATGAATGG - Intergenic
1102724131 12:115043775-115043797 CATAATACAGGGCCTATGAATGG - Intergenic
1103131991 12:118477224-118477246 CAGAAGAAAGAGCTAATAACGGG + Intergenic
1104248453 12:127065456-127065478 ATGAAAAAAGAGCTTATAAATGG + Intergenic
1104888746 12:132128546-132128568 CCAAAAATAGAGCCTATAAAAGG + Intronic
1105628564 13:22137914-22137936 CAAAATAAAACACCTATAAATGG + Intergenic
1108008099 13:45973080-45973102 CAGAATCATGAGCAAATAAATGG + Intronic
1108490558 13:50977256-50977278 CAGAATAAAGAGCCATAAAAAGG + Intergenic
1108705145 13:52978620-52978642 CAGAGTAAAGAGGCCAAAAAAGG - Intergenic
1109323729 13:60841293-60841315 CAGAATAGAAAGCCCAGAAACGG - Intergenic
1109872827 13:68357919-68357941 CAGAAAAAGGAGCGAATAAAGGG + Intergenic
1110610338 13:77480668-77480690 CAGAATACAGAGGCCACAAATGG + Intergenic
1111578505 13:90190776-90190798 CAGAACAAAGAGTTTATCAATGG - Intergenic
1111600402 13:90466539-90466561 TAGAATTAAAAGCCTGTAAAGGG + Intergenic
1112495694 13:99902413-99902435 CAAAATAAATAGCCAATGAATGG + Intergenic
1112569769 13:100583276-100583298 CAAAACAAAGACACTATAAAGGG + Intronic
1113288678 13:108881572-108881594 CAGAATAAAAAGCATAGACAAGG + Intronic
1113476786 13:110588863-110588885 CAGAATAAAGAACCCAGAAATGG + Intergenic
1114844758 14:26308168-26308190 GAGAGTAAACTGCCTATAAAAGG + Intergenic
1115297214 14:31842224-31842246 TAGAATAAAGAGCCCAGAACAGG - Intronic
1115671314 14:35615361-35615383 GAAAATAAAGAATCTATAAATGG + Intronic
1115976981 14:39007694-39007716 TAGTATAAAGAACCTAAAAATGG - Intergenic
1116471823 14:45294537-45294559 CAGAATAAACAACCTATGGAAGG + Intergenic
1117505005 14:56393076-56393098 CAGAATAGAGAGTCCAGAAACGG + Intergenic
1117940089 14:60954028-60954050 CAGAACAGAGAACCTAGAAAGGG - Intronic
1118537712 14:66787647-66787669 CAGAATAGAGAACCTATAATAGG + Intronic
1119000554 14:70877911-70877933 CCGAATAAAGTGCTTATAAAAGG - Intergenic
1121766997 14:96496265-96496287 CAGAATCAGGAACCTAGAAATGG + Intergenic
1123798699 15:23799158-23799180 CAGAATAGAGAGCTTAGAAATGG + Intergenic
1123960081 15:25389128-25389150 CAGAATAGAGAGCCCAGAAATGG + Intronic
1124074010 15:26424853-26424875 CAGAATAGAGAGCCCAGAAATGG - Intergenic
1124108941 15:26769454-26769476 GGAAATAAGGAGCCTATAAATGG - Intronic
1124709458 15:31993906-31993928 CAGAATAGAGAACCCAGAAATGG - Intergenic
1125433902 15:39625772-39625794 TTGCATAAAGAGCCTAAAAAGGG + Intronic
1125588368 15:40838439-40838461 CAGAATCATGAGCAAATAAATGG - Intergenic
1125649432 15:41302526-41302548 CTGGATAAAGAGCATATGAAAGG + Intergenic
1125844169 15:42835941-42835963 CATAATAAAAAGCTTTTAAAAGG + Intronic
1125986957 15:44062935-44062957 CAGAATAGAGAGTCCAGAAATGG - Intronic
1125987358 15:44067094-44067116 CAAAAGAAAGAGAGTATAAAAGG + Intronic
1126398362 15:48243355-48243377 CAGATAAAAGAGTCTATAATTGG + Intronic
1126831331 15:52609475-52609497 TGGAGTAAAGAGCCTATCAAAGG + Exonic
1127527836 15:59811396-59811418 CAGAATATAAACCCTATTAAAGG + Intergenic
1129021927 15:72527946-72527968 CAGAAAAGAAAACCTATAAATGG - Intronic
1130638234 15:85645645-85645667 CAAAATTAAGAAGCTATAAAAGG - Intronic
1131505349 15:93013275-93013297 CATTATAAAAAGTCTATAAATGG + Intronic
1131816550 15:96227150-96227172 AAGAATAAAAAACTTATAAATGG + Intergenic
1132477859 16:150927-150949 CAGAACAGAGAGCCCAGAAATGG + Intergenic
1136664682 16:31799500-31799522 CAAAATAAAGCTCCAATAAAAGG + Intergenic
1138932962 16:61683888-61683910 CAGAACAAAGATTCTATGAAAGG + Intronic
1139154645 16:64425856-64425878 CAGAAGAAAGAGCTTATAGTTGG + Intergenic
1141240778 16:82263059-82263081 AAAAATAAAGAGCCTTTAATAGG - Intergenic
1142432311 16:90036300-90036322 CAGAACATGGAGCCTGTAAACGG - Intronic
1143852704 17:9824627-9824649 TAGAACAAAGACCCTAGAAATGG - Intronic
1143991569 17:10968045-10968067 CAGGATGAAAAGCCTAGAAATGG + Intergenic
1148498080 17:48066643-48066665 CAAAACAAAAAGCCTTTAAAAGG + Intergenic
1149920870 17:60658097-60658119 GAGAATAAAGAGGCTTTAAAGGG - Intronic
1153145249 18:2024346-2024368 CAGAATTGAGAGCTAATAAATGG - Intergenic
1153760480 18:8326603-8326625 CAGAATAGAGAGCCCAGAAATGG + Intronic
1155372561 18:25117571-25117593 GAGGAAAAATAGCCTATAAAAGG + Intronic
1156699178 18:39804241-39804263 CAAAATAAATAGCATAGAAAAGG - Intergenic
1157022294 18:43799170-43799192 AAGAATAAATAGCAGATAAAGGG - Intergenic
1157035197 18:43963485-43963507 GGGCATAAAGAGCCAATAAAGGG + Intergenic
1157044611 18:44085781-44085803 CAGAATAAAGAGCCCTAAAATGG + Intergenic
1157055880 18:44227986-44228008 CAGAAGAAAGAAGCTAAAAATGG + Intergenic
1157535768 18:48456275-48456297 GAGAACAAAGAGCCTATTGAGGG + Intergenic
1157839233 18:50940223-50940245 CAGAATAAGGACCCAGTAAATGG - Intronic
1164225783 19:23244593-23244615 CAGAATAAAAATACCATAAAAGG - Intronic
925610699 2:5699108-5699130 GAGTATAAAGATTCTATAAATGG - Exonic
925620838 2:5791267-5791289 CAGTATTAAATGCCTATAAATGG + Intergenic
926871357 2:17421421-17421443 CATAAAAAAGAGCCAATGAAAGG - Intergenic
927042674 2:19245576-19245598 CAGAATCGAGAACCAATAAATGG + Intergenic
927104925 2:19815681-19815703 TGGAATAAAGAACCTATGAAGGG - Intergenic
927331794 2:21873660-21873682 CAGAATAAATATCGTTTAAAAGG - Intergenic
927355289 2:22166066-22166088 CAGAATAAAGAGACAATAAATGG - Intergenic
928018042 2:27677455-27677477 CAGAATATGGAGCCTTTTAAAGG + Intronic
928542377 2:32295085-32295107 CAGAATTATGAGTCAATAAAAGG - Intronic
928559539 2:32465219-32465241 AAGAATAATGAGTCTTTAAAAGG - Intronic
929206646 2:39303384-39303406 CAGATTAAGGAGCCTGAAAATGG + Intronic
929397976 2:41545383-41545405 TAGAATAAAGAGCTTAAAATTGG + Intergenic
929476251 2:42252518-42252540 AAGAATAAAGAACCACTAAAGGG - Intronic
930429526 2:51256359-51256381 CAGAATAGAAAACCCATAAAAGG + Intergenic
930648989 2:53945433-53945455 GAGGATAAAGAGACTAAAAAGGG + Intronic
931641906 2:64388416-64388438 CAGAACAAAGAGTCCAGAAATGG - Intergenic
932536316 2:72600524-72600546 CAGAATACTGAGTCTAGAAATGG + Intronic
932641718 2:73454427-73454449 CAGAATAAGGATACTATAATGGG - Intronic
932743358 2:74309350-74309372 CAGAATAAATAGCCCAGAAATGG - Intronic
933534139 2:83551545-83551567 CAGTATAAAGTACTTATAAAAGG + Intergenic
935589295 2:104830990-104831012 CAGAATAAAGAGCTAATATGAGG - Intergenic
936807210 2:116349364-116349386 CAAAATATAGAGGCTATGAAAGG + Intergenic
936926519 2:117742467-117742489 AAGAATAAAGAGCTTGGAAATGG + Intergenic
937330566 2:121025637-121025659 GAGAATAAAGAGAATATATATGG + Intergenic
939728939 2:145757490-145757512 CTGAATATGGAGCCTAAAAAGGG - Intergenic
940040370 2:149353795-149353817 CAGAGAAAAGAGCCTTAAAAAGG - Intronic
941207063 2:162586550-162586572 CAGAATCATGAGCAAATAAATGG + Intronic
941265091 2:163351404-163351426 TAAAACATAGAGCCTATAAAAGG + Intergenic
942886233 2:180927346-180927368 CAAAATAATGAGGCTAAAAATGG + Intergenic
945691977 2:213047495-213047517 CAGAGTAAAAAGCCTTTAAATGG - Intronic
946086454 2:217178320-217178342 CAGAATAAAGAGCTAAATAATGG - Intergenic
947949006 2:234131574-234131596 CAGAATGAAGACCCCATATATGG + Intergenic
1171118302 20:22546347-22546369 CAGTAAAAAGAACCTCTAAAGGG + Intergenic
1174837626 20:53873336-53873358 CAGAAAAAAGAACCTCAAAAGGG + Intergenic
1176957640 21:15124477-15124499 CAGATAAAAGAGGCTCTAAAAGG + Intergenic
1177015947 21:15787420-15787442 CAAAATAGAGAGCCCAGAAATGG + Intronic
1177659918 21:24069328-24069350 CAGACTAAAGGGCATAGAAAAGG + Intergenic
1178058135 21:28822093-28822115 CAGAATAAAATGTCCATAAAAGG - Intergenic
1178128465 21:29542836-29542858 TTGAATAAGGAGCCTATTAAAGG - Intronic
1178266063 21:31143683-31143705 AAGACTAAAGATGCTATAAAAGG + Intronic
1178876226 21:36416184-36416206 CAGAATACAGAGCCAAGACACGG - Intronic
1178940883 21:36904483-36904505 CAGAACAAAGAGAATCTAAAAGG + Intronic
1179384246 21:40927430-40927452 TAGAAAAAAGAGCCTATGGAAGG - Intergenic
1183398459 22:37587002-37587024 CATAATAAAGTCCCCATAAAAGG + Intergenic
1184994044 22:48190814-48190836 CAGAATAAACATACTTTAAAGGG - Intergenic
949711841 3:6879984-6880006 CAGAAGAAAGAACATTTAAAAGG + Intronic
951384793 3:22029490-22029512 CAGAATAAATAGTAGATAAAAGG + Intronic
952227544 3:31394416-31394438 CAGGATAAAGAACCATTAAAGGG - Intergenic
952826054 3:37526134-37526156 CAGAGGAAAGAGCCCATGAATGG - Intronic
953834833 3:46333548-46333570 CACACAAAAGAGCCTAAAAAGGG + Intergenic
955773249 3:62407013-62407035 CATCAGAAAAAGCCTATAAAAGG - Intronic
956146285 3:66194577-66194599 CAGAATAAGGACCCTAGAGAGGG - Intronic
956367014 3:68515200-68515222 CAGAAATAAGAGTCTAAAAAGGG + Intronic
956398842 3:68854577-68854599 CAGAATAAAGAACAAATATATGG + Intronic
956804136 3:72791699-72791721 CAAAACAAAAAACCTATAAAGGG - Intronic
956923986 3:73962607-73962629 AAGAATAAAGGGCATATAGAAGG + Intergenic
959737435 3:109676072-109676094 CAGGACACAGAGCCCATAAATGG + Intergenic
960779964 3:121309731-121309753 TAGAATAAAGATCTTTTAAAAGG - Intronic
961591218 3:127983219-127983241 CTGAATAAAGATACTTTAAATGG - Intronic
962565455 3:136653761-136653783 CTGAATCCAGAGCATATAAAAGG + Intronic
962640864 3:137385016-137385038 CAGACTAAAGAGCATAGTAATGG + Intergenic
962849832 3:139300007-139300029 CAGAGTAAATACTCTATAAAGGG - Intronic
963150589 3:142041979-142042001 CAGAATAAAGAGTGCAGAAATGG - Intronic
965754352 3:172010078-172010100 CAGAGGAGAGAGCCAATAAAAGG - Intergenic
965762649 3:172095621-172095643 CAGAACAAAGAGCATCTTAAGGG - Intronic
966019898 3:175195949-175195971 CTGAATAAAGAGCTTATATTTGG + Intronic
967879425 3:194289141-194289163 CAGAATAGAGAACCCAGAAATGG + Intergenic
971530104 4:27676590-27676612 CATAGTAAATAGTCTATAAATGG + Intergenic
973313836 4:48739075-48739097 CAGAACAGAGAGCCCAGAAATGG + Intronic
974415755 4:61604397-61604419 TGGAATAAAATGCCTATAAAAGG + Intronic
976002610 4:80389027-80389049 CTTATTAAAGAGCATATAAAAGG - Intronic
978104874 4:104889797-104889819 AACAAGAAGGAGCCTATAAAGGG - Intergenic
978592057 4:110334926-110334948 CAGAATAGAAAGCCCAGAAATGG + Intergenic
978714575 4:111825899-111825921 CATAATAATTAGCCTCTAAAAGG - Intergenic
978997092 4:115170235-115170257 CAGAATAAAGAGACTAGTCAAGG - Intergenic
979204249 4:118016713-118016735 CAGAATACAAAGCTTATATAAGG + Intergenic
979385726 4:120063662-120063684 CAGGATAAAGACCCTGAAAAAGG + Intronic
981723686 4:147826174-147826196 CAGAATACTGAGCCTAACAATGG - Intronic
982096639 4:151929375-151929397 CACAATAAAAACCCTCTAAAAGG - Intergenic
982382741 4:154766707-154766729 AAGTATAAATAGACTATAAATGG - Intergenic
984316159 4:178135317-178135339 GAGAATAAAGAGCCCAGAAATGG + Intergenic
984371109 4:178865167-178865189 CTGGAAAAAGAGGCTATAAATGG + Intergenic
987900801 5:24009189-24009211 CAGAATAAAATACCTAGAAATGG - Intronic
989091573 5:37739357-37739379 CAAAAGCAAAAGCCTATAAAGGG - Intronic
990259085 5:54001909-54001931 CATTATAAAGAGCCTAAAATGGG - Intronic
990332768 5:54743982-54744004 CATAGTAAAGAGCCTGTAAGAGG - Intergenic
991225107 5:64261261-64261283 CAGGAAAAAGAGATTATAAATGG + Intronic
992355436 5:75977657-75977679 CAGAACAAAGAACCCATCAAAGG + Intergenic
992381259 5:76240025-76240047 CAGAATAAAAAGCATAAGAAAGG - Intronic
993562434 5:89427623-89427645 CAGTTTAAAGAGCCTATAAGTGG - Intergenic
994063957 5:95513633-95513655 CAGCAATAAGAGCCTATAAAAGG + Exonic
994577671 5:101600326-101600348 CAGAATGAAGAGACAATATATGG + Intergenic
995669057 5:114579612-114579634 CAGAATAAAGAGGATAAAATAGG - Intergenic
996926760 5:128836059-128836081 AAGAAATATGAGCCTATAAATGG + Intronic
997310616 5:132877715-132877737 CTGAAGCAAGAGCCTACAAAAGG - Exonic
997492663 5:134291305-134291327 CAGAATCATCAGCATATAAATGG + Intronic
999186400 5:149713832-149713854 CAGAATTAAGAACAAATAAATGG - Intergenic
999908668 5:156171726-156171748 CAAAATAAAGAGTTTAAAAATGG + Intronic
1001582786 5:172810556-172810578 CAGAATGAAGGGCCTCAAAATGG + Intergenic
1004161054 6:13213257-13213279 TAGAATAAAGAAAATATAAAAGG - Intronic
1005150959 6:22750014-22750036 AAGAATAAAAAGCTTTTAAATGG + Intergenic
1005564741 6:27079636-27079658 CAGAATGAATAACCTATAGAAGG + Intergenic
1005595123 6:27371667-27371689 CAGAATAAAGCCCCTATGAGAGG + Intergenic
1007066406 6:38994945-38994967 CAGAATAGAAAGCCCAGAAATGG - Intronic
1008124141 6:47649699-47649721 CAGAATAAACAGGCTATACACGG + Intergenic
1008246614 6:49182589-49182611 CAAAATAATGTGCCCATAAAAGG + Intergenic
1008960888 6:57264157-57264179 AGGAAAAAAGAGCCAATAAATGG - Intergenic
1009681528 6:66899355-66899377 GAAAATAAAGAGCCTTTTAAGGG - Intergenic
1009980758 6:70723090-70723112 CAAACAAAAGAGTCTATAAAGGG - Intronic
1011031348 6:82927172-82927194 CAGAATAGAAAGCCCAGAAATGG - Intronic
1011734990 6:90301636-90301658 TGAAATAAAGAGCCTATAAGTGG + Intergenic
1012519422 6:100103214-100103236 CAGACTAAAGAGCCTGTGATTGG - Intergenic
1012603490 6:101128456-101128478 CAGAATCATCAGCATATAAATGG - Intergenic
1013164204 6:107575124-107575146 AAGACCAAAGAGCCCATAAAAGG - Intronic
1013166211 6:107594747-107594769 GAGAATAAAGGGCCTTAAAAGGG - Intronic
1013384209 6:109608354-109608376 CAGAACGAAGAGTCTATAAAGGG + Intronic
1013701241 6:112772388-112772410 AAGAATAAATAGTCTAGAAATGG - Intergenic
1013759070 6:113495287-113495309 CAGAATAAAGCTCCTAGACAAGG + Intergenic
1015001651 6:128224066-128224088 CAGAATAAAGAGCCTATAAAAGG - Intronic
1015325604 6:131919694-131919716 CAGAATAGAGAACCCAGAAATGG + Intergenic
1016051486 6:139534917-139534939 CAGAAGTAAGAGCCTTTGAAAGG + Intergenic
1016903504 6:149126457-149126479 CAGAATAGAGAACCTAAAACTGG + Intergenic
1016918306 6:149265636-149265658 TAGAATAAAGGGACTATAACAGG + Intronic
1019679705 7:2339840-2339862 CAGAATAGAGAGCCCAGAAACGG + Intronic
1020514961 7:9106709-9106731 CAGAAGCTAGAGCCTAGAAAAGG - Intergenic
1021301691 7:18981171-18981193 AAGAATATAGAGCCTATACTTGG + Intronic
1021470807 7:21000528-21000550 CAGAATGAACAGCTTAAAAAGGG - Intergenic
1021879731 7:25083025-25083047 CAGAAGAAAGAGACTGTACAGGG - Intergenic
1022845575 7:34206518-34206540 CAGAATAAAGAGCTTCTCAGGGG + Intergenic
1023662561 7:42485521-42485543 AAAAAAAAAGAGCCTTTAAATGG - Intergenic
1024470306 7:49763041-49763063 CATAATAATTAGACTATAAATGG - Intergenic
1025626045 7:63223285-63223307 CTGAAAAATGAGTCTATAAATGG + Intergenic
1025856086 7:65280345-65280367 CAAAATCAAGAGCATATACATGG - Intergenic
1026480050 7:70770613-70770635 CTGAATCAACAGCCTATAAAAGG - Intronic
1026871361 7:73854342-73854364 CAAAATAAAGTGCCGAGAAATGG - Intergenic
1028896142 7:96044224-96044246 TATAATAAAGAACCTTTAAAAGG + Intronic
1030290357 7:107866005-107866027 CAGATTAAACAACATATAAAGGG + Intergenic
1030757692 7:113308613-113308635 TAGAATGACAAGCCTATAAAAGG - Intergenic
1031316526 7:120264746-120264768 AAGAATAAAGTCCCTGTAAATGG + Intergenic
1032742843 7:134756380-134756402 CAGAATTCAGAGCCTCAAAATGG - Intronic
1032778343 7:135139514-135139536 CACAGTAAACAGCCTATAGAAGG - Intronic
1036238670 8:7064530-7064552 CAGAATAAAGAGATCATAACTGG + Intergenic
1037036963 8:14180186-14180208 CACAATAAAAATCCCATAAAAGG + Intronic
1038097076 8:24325305-24325327 CAGAATAAAGATACGATGAAAGG + Intronic
1040891012 8:52315827-52315849 CAGAAGAAAGAGCAAATAATAGG - Intronic
1043052254 8:75398507-75398529 GAGTTTAAAGTGCCTATAAAAGG + Intergenic
1043066128 8:75572247-75572269 CAGAAGAAATAGCCTGTGAAAGG - Intergenic
1043106099 8:76112464-76112486 CAAAATAGAGAGCCCAGAAATGG + Intergenic
1043420176 8:80089624-80089646 CAGGCCAAAGAGCCTAAAAAGGG + Intronic
1045176825 8:99734602-99734624 CAGAATAAAGTGCTTATTTATGG - Intronic
1046083565 8:109402902-109402924 CAGAAGAAAGAGGATAAAAAAGG - Intronic
1046686137 8:117228695-117228717 CTTAATAGAGAGCCTCTAAAAGG - Intergenic
1046868296 8:119175329-119175351 CATAATAAGCAGCCAATAAATGG - Intronic
1047681872 8:127262228-127262250 CAGAACAGAGATCCCATAAATGG - Intergenic
1049063856 8:140297265-140297287 CAGAATCAATAGACTAAAAATGG + Intronic
1050266728 9:3898633-3898655 CAGAGTAAAAGGCCTAAAAAAGG + Intronic
1050746316 9:8880250-8880272 CTGAATAAACAGCATATAAATGG + Intronic
1051371302 9:16361713-16361735 TAGAATTATGAGCCAATAAATGG - Intergenic
1051521927 9:17999051-17999073 GACAATAAAGAGGCTATATAGGG - Intergenic
1052514118 9:29457835-29457857 CAAAATACAGAGCATATGAAAGG + Intergenic
1054159109 9:61661154-61661176 TTTAATAAAGAGCCTAGAAAGGG - Intronic
1054174657 9:61866976-61866998 TTTAATAAAGAGCCTAGAAAGGG + Intergenic
1054449514 9:65396036-65396058 TTTAATAAAGAGCCTAGAAAGGG + Intergenic
1054478883 9:65592159-65592181 TTTAATAAAGAGCCTAGAAAGGG - Intergenic
1054662881 9:67713817-67713839 TTTAATAAAGAGCCTAGAAAGGG - Intergenic
1056966384 9:91166094-91166116 CAGAATTATGAGACCATAAATGG - Intergenic
1059930962 9:119260292-119260314 CAGAATATACAGCACATAAATGG - Intronic
1060673219 9:125488844-125488866 CAGAAAGAAGTGCCTAAAAATGG + Intronic
1061059138 9:128242007-128242029 CAGGATAAAGAGCCTTTGACAGG - Intronic
1185884225 X:3767914-3767936 GAGAATTAAGAGGCTTTAAAAGG + Intergenic
1186120488 X:6355842-6355864 CATCATGGAGAGCCTATAAACGG - Intergenic
1187727413 X:22217926-22217948 CAGAATCATGAGCTAATAAATGG - Intronic
1188555128 X:31402606-31402628 CAAAAGAAAGAGCCTAGAATAGG + Intronic
1189399753 X:40656590-40656612 CACAATAAAGAGCCTTTTTATGG - Intronic
1190441848 X:50482557-50482579 CACAATAAAGAACCTCCAAAAGG - Intergenic
1192300913 X:69901673-69901695 CAGAAGAAAGAACATTTAAAGGG + Intronic
1193429877 X:81389114-81389136 CTGAAGAAACAGCCTATATAAGG + Intergenic
1193552031 X:82906309-82906331 CATAATAGAGAGCCTGGAAAAGG - Intergenic
1193626437 X:83827421-83827443 CAGAATAGAGAACCCAGAAAGGG + Intergenic
1193667915 X:84346548-84346570 CAGAATAGAGAACCCAGAAATGG + Intronic
1194507226 X:94747090-94747112 CAAAATAAAGAGCCTCTAAATGG - Intergenic
1196076279 X:111580138-111580160 CAGAATAGAGAGCCCAGAACGGG - Intergenic
1196374647 X:115019673-115019695 CAGATTTCATAGCCTATAAATGG - Intronic
1199292044 X:146115137-146115159 CAGAATAGAGATCCCAGAAACGG - Intergenic
1202177457 Y:22110962-22110984 CCTCATAGAGAGCCTATAAATGG - Intergenic
1202213904 Y:22475422-22475444 CCTCATAGAGAGCCTATAAATGG + Intergenic
1202360217 Y:24101265-24101287 CAGGAGAAAAAGCCTGTAAAAGG - Intergenic
1202510560 Y:25568849-25568871 CAGGAGAAAAAGCCTGTAAAAGG + Intergenic