ID: 1015003126

View in Genome Browser
Species Human (GRCh38)
Location 6:128244676-128244698
Sequence AGAATTGGCAGATACTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015003126_1015003130 27 Left 1015003126 6:128244676-128244698 CCATGGGAGTATCTGCCAATTCT 0: 1
1: 0
2: 3
3: 20
4: 137
Right 1015003130 6:128244726-128244748 ACAGACTGAAAACCTCTAGTAGG No data
1015003126_1015003131 30 Left 1015003126 6:128244676-128244698 CCATGGGAGTATCTGCCAATTCT 0: 1
1: 0
2: 3
3: 20
4: 137
Right 1015003131 6:128244729-128244751 GACTGAAAACCTCTAGTAGGAGG No data
1015003126_1015003129 -8 Left 1015003126 6:128244676-128244698 CCATGGGAGTATCTGCCAATTCT 0: 1
1: 0
2: 3
3: 20
4: 137
Right 1015003129 6:128244691-128244713 CCAATTCTGAGATCAGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015003126 Original CRISPR AGAATTGGCAGATACTCCCA TGG (reversed) Intronic
900886957 1:5421983-5422005 AGACTTGGCAGACAGTGCCAAGG - Intergenic
901281893 1:8043897-8043919 GGAATTGGCAGATGCCCTCAGGG + Intergenic
906765069 1:48422349-48422371 AGAATTAGCAGATGCTCTTAGGG - Intronic
909079149 1:71087987-71088009 TGAATAGGCAAATACTCCAAAGG + Intergenic
910641792 1:89472160-89472182 GGAATTGGCAGATATCCCTAGGG - Intergenic
915053157 1:153098043-153098065 AAAATTGGCAGATCTTCCTAGGG + Intronic
916890965 1:169111985-169112007 GGAATGGGCAGCTACTCACAGGG + Intronic
919487697 1:198164270-198164292 AGAAGAGGCAGAAACTCCCTTGG - Intronic
921555642 1:216595766-216595788 AAAATTGGCAGTTGATCCCAGGG - Intronic
921792428 1:219305496-219305518 AAAATTGGATGATACTTCCAAGG + Intergenic
922635609 1:227167630-227167652 AGAAATGACAGGTACTTCCAAGG - Intronic
1064541077 10:16405912-16405934 AGAATTGTCAGCTGTTCCCAGGG + Intergenic
1070408279 10:76115803-76115825 AAAATGGGCAGAAACTCCTAAGG + Intronic
1071830897 10:89371053-89371075 AGTATTGCCAGATGCCCCCAGGG + Intronic
1072047978 10:91676068-91676090 TGAATTGTCAGATACTCCTTAGG + Intergenic
1072338712 10:94424690-94424712 AGACATGCCAGGTACTCCCAGGG - Intronic
1072457973 10:95593236-95593258 AGATTTGGCAAATACCCCCTGGG + Intergenic
1075251831 10:120885176-120885198 ACAATTGGCTGATGCACCCATGG + Intronic
1075390489 10:122087558-122087580 AGAAGTGGCAGACACTCCCCTGG + Exonic
1077954377 11:6999074-6999096 AGAAATGGAAGATACTCCATTGG - Intergenic
1082165306 11:48942755-48942777 AGAAATGGCAGAAAATACCACGG + Intergenic
1085166763 11:74408275-74408297 AAGATTGGCAAATACTCTCAGGG + Intergenic
1085711527 11:78833354-78833376 AGAAGTGGCAGATAATGCAATGG - Intronic
1087071015 11:94080784-94080806 AGAAATGGCAGATGCTGGCAAGG + Intronic
1087400793 11:97665062-97665084 AGAAATGGAAGATACACACATGG + Intergenic
1088215671 11:107505789-107505811 TGAATTTGCAGATAATCTCAGGG - Intronic
1094251074 12:28362146-28362168 AGAATTGGCAGATGCCCCAAGGG + Intronic
1095971000 12:47901960-47901982 AGAATTGGCTGATAACACCAGGG + Intronic
1096256941 12:50068792-50068814 AAAATTGGCAGATCCTGTCAAGG - Intronic
1097258487 12:57698733-57698755 GGAACTGACAGATACTCACAGGG + Intronic
1098363092 12:69674533-69674555 AGAAAGGGCAGATAGCCCCATGG - Intronic
1099867178 12:88297606-88297628 AGAATTGGCAGATAGTCACCAGG - Intergenic
1101672232 12:106886298-106886320 AGAATTGCCAGATTCAACCAGGG - Exonic
1102850844 12:116243402-116243424 TTAAGTGGCAGATACTCCCCTGG + Intronic
1104231312 12:126887129-126887151 ATTTTTGGCAGAGACTCCCAGGG + Intergenic
1106316571 13:28599557-28599579 AGAATTGGCAGATACCCTCCAGG - Intergenic
1108032608 13:46251489-46251511 AGAAATGGCAGATAGTGTCAGGG - Intronic
1108052178 13:46456624-46456646 AGAGTTGGCAGTTACTGGCATGG + Intergenic
1109754836 13:66743369-66743391 AGCATTGGGAGATACACCTAAGG + Intronic
1111496294 13:89055072-89055094 ATAATTGCCAGATATTACCATGG + Intergenic
1113185393 13:107681441-107681463 AGAGTTGGCAGATGCACCCCAGG - Intronic
1116805503 14:49490549-49490571 TCAATTCGCAGATACTCCGAAGG - Intergenic
1118858872 14:69646183-69646205 AGAAGTGGCAGATACAGCAAAGG - Intronic
1120365024 14:83556834-83556856 AGAATTGTCTGCTCCTCCCATGG - Intergenic
1122722490 14:103730157-103730179 AGTGTTGGCAGAGGCTCCCAAGG - Intronic
1128942629 15:71801034-71801056 ACAATGGGGTGATACTCCCAGGG + Intronic
1130784988 15:87086113-87086135 AGAATTGCCAGATACACCAAGGG - Intergenic
1131336700 15:91555963-91555985 GGAAGTGGCAGATACTCACCAGG + Intergenic
1141282165 16:82638667-82638689 GGAATTGGCAAATCCTCCCTGGG - Intronic
1142835988 17:2587128-2587150 AGAATTGGCGGATACCCTCCAGG + Intergenic
1142881201 17:2883751-2883773 ATGATTGGCAGAGAATCCCAGGG + Intronic
1142895369 17:2973620-2973642 TGAATTGGAAGATAGACCCAAGG + Intronic
1143593430 17:7899686-7899708 AGATATGGCAGGTACTCCCAGGG + Intronic
1149043104 17:52213779-52213801 AAAATTTGCAGATACTACAATGG + Intergenic
1151542950 17:74774364-74774386 AGGATGGGCAGCTCCTCCCAAGG + Intronic
1155150102 18:23116434-23116456 AGAATCAGCAGAGACTACCACGG + Intergenic
1157820767 18:50767003-50767025 AGAGTTGGCAGATAATTCCTAGG - Intergenic
1159674565 18:71265618-71265640 AGAATTGGCAGGTTCTTCCAAGG - Intergenic
1160925157 19:1540781-1540803 AGAATTTGGAGATGCCCCCAGGG + Intergenic
1161697368 19:5776968-5776990 GGAATTGGCAGACACTACCCAGG + Intronic
1164924629 19:32119979-32120001 ACATTTGGCAGAGACTCACAGGG + Intergenic
1165180817 19:33966492-33966514 AGAATTGGCAGATACCTTCTTGG - Intergenic
927941540 2:27106315-27106337 TGGTTTGGCAGATACTCCTAAGG - Intronic
928744196 2:34392140-34392162 TGGATTAGCAGATACTCCTAAGG - Intergenic
929447150 2:42010606-42010628 AGAATGGCCAGAGACTTCCAGGG - Intergenic
929532411 2:42761426-42761448 GAAATGGACAGATACTCCCATGG - Intergenic
931471317 2:62540356-62540378 GAATTTGGCAGATACTCTCAAGG - Intergenic
932782344 2:74568453-74568475 AGAATCAACATATACTCCCAGGG - Intronic
935535433 2:104287565-104287587 AGAAGTGGCACCTACTCCCAAGG - Intergenic
935537510 2:104311125-104311147 GGAATTGACAGATACTCTCTTGG - Intergenic
936638373 2:114285020-114285042 AGAATTAAGAGAAACTCCCAGGG + Intergenic
937843232 2:126548224-126548246 AAAAGTGGCAGCTCCTCCCATGG + Intergenic
941127091 2:161597097-161597119 AGAATTGGCAGCTATTCTCAAGG - Intronic
942807470 2:179949168-179949190 TGAATCAGCAGATGCTCCCAGGG - Intronic
945482083 2:210356629-210356651 AGAATTGGGAGATATACCTAAGG + Intergenic
946462806 2:219884611-219884633 AGAATTGGCAGTTGCTTCAAGGG + Intergenic
947705252 2:232269715-232269737 AGAAATGGCAGATTGTTCCAGGG + Intronic
1172982425 20:38954245-38954267 AGAAATGGCAGTTACTGCAATGG + Intergenic
1173378766 20:42516129-42516151 AGCATTGGGAGATACACCTAAGG + Intronic
1173763113 20:45581864-45581886 GGCATTGGCAGATACTCCCAGGG + Intergenic
1174055949 20:47798622-47798644 AGAAGTGGCAGTCACTCCAAAGG - Intergenic
1174551155 20:51362638-51362660 AGAATAAGCAGCTCCTCCCAAGG + Intergenic
1177283141 21:19011347-19011369 AGTATTGGCACATGCTTCCATGG - Intergenic
1177937442 21:27367212-27367234 AGAATTGGTGGATACTCTCCAGG + Intergenic
1178178194 21:30129295-30129317 AGAATTTTAAAATACTCCCAAGG + Intergenic
1178425188 21:32473551-32473573 AGAATTTGCAGACAGTCCCAGGG + Intronic
1182016782 22:27047032-27047054 AGAAATAGCAGAAACTCACAAGG + Intergenic
950849860 3:16052057-16052079 ATATTTGGCAGAAAATCCCAGGG + Intergenic
951713638 3:25612959-25612981 AGAATTGGCAGAGACTTCTCAGG - Intronic
956520555 3:70098779-70098801 AGAATAAGGAGAAACTCCCAGGG + Intergenic
956829840 3:73035415-73035437 AGAAATGGCAGATTCTGGCAAGG + Intronic
960686482 3:120299560-120299582 AGAATGGGCATACACTGCCAAGG + Intergenic
960701434 3:120442968-120442990 AGCATTGGGAGATACACCTAAGG + Intronic
961436317 3:126920816-126920838 AGAATTGGCAGAAACTTTGAGGG + Intronic
962079772 3:132125706-132125728 AGAATTAGCAGAAAAACCCATGG + Intronic
962860772 3:139398680-139398702 AGTATTGACAGATACTTCTAAGG + Intergenic
963960319 3:151302728-151302750 AGAAGTAGCAGAGATTCCCAAGG - Intronic
964597695 3:158455377-158455399 AGAATTGGAAAATACTGACAGGG - Intronic
967810688 3:193758564-193758586 AGAATGGGCAGATGCTCTCATGG - Intergenic
968711032 4:2117756-2117778 GGACTAGGAAGATACTCCCAAGG - Intronic
970088449 4:12374613-12374635 AGAATTGACACATAATCACAAGG + Intergenic
973835431 4:54804696-54804718 AAAAATGGCAGATACCCCAATGG + Intergenic
973906365 4:55535887-55535909 ATAATTAGGAAATACTCCCAGGG - Intronic
974878783 4:67729365-67729387 AGGATTGGGTGATATTCCCAAGG + Intergenic
978733101 4:112053988-112054010 TGAATAGGCATATAATCCCATGG - Intergenic
982199954 4:152950503-152950525 AGAATTGGGTGATATTCCTAAGG - Intronic
983069451 4:163251887-163251909 AAAATTGCCAAATGCTCCCATGG - Intergenic
984426103 4:179587777-179587799 AGAATAAGCAGATACACCAATGG - Intergenic
986139626 5:5017616-5017638 AGACATGGCAGATACTCCCAGGG - Intergenic
987322802 5:16785959-16785981 AGAAGTGGCTGATAGCCCCATGG - Intronic
988827222 5:34950259-34950281 AGAATTGGAAGATAGTCCCCAGG + Exonic
991177282 5:63704030-63704052 ATAATTAGAAGATACTCACAAGG - Intergenic
994641727 5:102419074-102419096 AGAATCAGCAAATACTCTCAGGG + Intronic
998704919 5:144747986-144748008 AGAATTTGCAAATGCTTCCATGG + Intergenic
1001575353 5:172759701-172759723 AGAATTGGCAGATACCCTTTGGG - Intergenic
1003325466 6:5086841-5086863 AGAATAGGAAGAAACTTCCAAGG + Exonic
1008767670 6:54939208-54939230 AGAATAGGCACATACACCAATGG - Intronic
1012095511 6:94953746-94953768 AGAATTGTCAATTACTTCCAAGG + Intergenic
1012642449 6:101636375-101636397 AGCATTGGGAGAAACTCCTAAGG + Intronic
1015003126 6:128244676-128244698 AGAATTGGCAGATACTCCCATGG - Intronic
1017047731 6:150363331-150363353 AGACTTGGAAACTACTCCCAAGG + Intergenic
1017047963 6:150364856-150364878 AGAATTGGCAGATGCTACCAGGG - Intergenic
1018426277 6:163685587-163685609 AGACTTGGCAGAAACTGCCAAGG - Intergenic
1018595659 6:165478004-165478026 AGAAGTGTCACCTACTCCCACGG + Intronic
1021903098 7:25307111-25307133 AGAATTGGCAGTTATTCACAAGG + Intergenic
1028827043 7:95285717-95285739 AGAAATGGCAGATCCTCTCCTGG - Intronic
1028832011 7:95338540-95338562 AAAATTAGCAGATACTTCTATGG + Intergenic
1029572690 7:101380900-101380922 AGAGATGGCAAATTCTCCCAGGG + Intronic
1030160560 7:106504457-106504479 AGATTTGGCACATACCCCCAAGG - Intergenic
1031019805 7:116614770-116614792 GGAATTGGCAGATACTCTCTCGG - Intergenic
1032506549 7:132439289-132439311 AGAATTTTCAGAGACCCCCAGGG - Intronic
1034648751 7:152672659-152672681 AGAATGTGCAGATATTCACAGGG + Intronic
1035697816 8:1613417-1613439 AGAATTGGGAGATATACCTAAGG + Intronic
1035965585 8:4187942-4187964 ACAAGTGGTAGATACTACCATGG + Intronic
1037345040 8:17889691-17889713 AGATTTGGGAGATATTCCCAGGG - Intronic
1037479340 8:19289533-19289555 AGAAAGGACAGATATTCCCAAGG - Intergenic
1037912591 8:22752766-22752788 AGAATTTGCATAAACTCCTAGGG + Intronic
1039831489 8:41218751-41218773 ATGATTGGCTGATTCTCCCAGGG - Intergenic
1047518543 8:125576417-125576439 AGTATTGGCAGATAGAGCCAGGG - Intergenic
1048494719 8:134925643-134925665 AGAAGTAGCAGACACTCCCCAGG - Intergenic
1048882800 8:138884115-138884137 AGCATTGCCAGAGGCTCCCAGGG - Intronic
1049226513 8:141453830-141453852 AGAATTGTCAGATGCCCCCAAGG - Intergenic
1049267806 8:141678530-141678552 AGAATTGGCTGGAGCTCCCATGG - Intergenic
1056220195 9:84444297-84444319 AGAATCAGGAGCTACTCCCATGG - Intergenic
1057501030 9:95596759-95596781 AGTACTGGCAGCTGCTCCCAGGG + Intergenic
1058130256 9:101243878-101243900 AGGAATGTCATATACTCCCAGGG - Intronic
1058284143 9:103154466-103154488 AGAACTGACAGATTCTCACAAGG + Intergenic
1059953166 9:119488971-119488993 AGACATGGCAGATACTGCCAGGG - Intergenic
1059974978 9:119706346-119706368 AGAATAGGCAGATGATACCATGG - Intergenic
1187850536 X:23587430-23587452 AGATATGGCAGATACTCCAAAGG + Intergenic
1188870593 X:35366045-35366067 AGAATTGGAAAACAGTCCCAAGG + Intergenic
1188948943 X:36344105-36344127 AGCATTGGGAGATACACCTAAGG + Intronic
1192264795 X:69530874-69530896 AGAAGGTGCACATACTCCCAAGG + Exonic
1194294701 X:92113714-92113736 AGAATTGGCGGATACCCTCCAGG + Intronic
1195526476 X:105896250-105896272 TGTAGTGGCAGATAATCCCATGG + Intronic
1196002148 X:110796831-110796853 AGAATTGTCAGAAACTTCTAGGG + Intergenic
1196330288 X:114464991-114465013 AAGATTGGCAAACACTCCCAGGG - Intergenic
1198122503 X:133607926-133607948 GGAATTGGCAGAGGCTCCCTGGG - Intronic
1198562749 X:137868498-137868520 AGAATTTATAGATACTCTCATGG - Intergenic
1200235466 X:154465888-154465910 AGAGTTGGCTCAGACTCCCAGGG - Intronic
1201928739 Y:19318179-19318201 AGGATTGAAAGAAACTCCCAGGG + Intergenic