ID: 1015003128

View in Genome Browser
Species Human (GRCh38)
Location 6:128244691-128244713
Sequence CCATAGCCTGATCTCAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015003128_1015003132 18 Left 1015003128 6:128244691-128244713 CCAATTCTGAGATCAGGCTATGG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1015003132 6:128244732-128244754 TGAAAACCTCTAGTAGGAGGAGG No data
1015003128_1015003130 12 Left 1015003128 6:128244691-128244713 CCAATTCTGAGATCAGGCTATGG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1015003130 6:128244726-128244748 ACAGACTGAAAACCTCTAGTAGG No data
1015003128_1015003131 15 Left 1015003128 6:128244691-128244713 CCAATTCTGAGATCAGGCTATGG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1015003131 6:128244729-128244751 GACTGAAAACCTCTAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015003128 Original CRISPR CCATAGCCTGATCTCAGAAT TGG (reversed) Intronic
900689210 1:3969756-3969778 GCATAGCCTGAGCTGATAATTGG + Intergenic
902386377 1:16078235-16078257 CCACAGGCTGACCTCAGAATGGG + Intergenic
907420084 1:54341362-54341384 CCATATCCTGACCTCACAGTGGG + Intronic
908395166 1:63718749-63718771 CAAGAGCCTGTTCTCAGAAAGGG + Intergenic
909755056 1:79215215-79215237 ATATAGCCTAATCTCAGAAGTGG - Intergenic
911742117 1:101397873-101397895 CCATAGCCTCAGGTCAGAAATGG + Intergenic
915097226 1:153471629-153471651 CCATAGCTGGAGCTCAGCATTGG + Intergenic
917543285 1:175936320-175936342 CCATCCCCAGATGTCAGAATGGG - Intergenic
917733474 1:177899177-177899199 CCACAGCTTGATAACAGAATGGG + Intergenic
917976406 1:180242181-180242203 ACAGAGCTTGATTTCAGAATTGG + Intronic
924141710 1:241030844-241030866 CCATCGCCTGATCACAGCCTTGG - Intronic
924806699 1:247367045-247367067 CCAAAGCCTCATCTGAGAAAAGG - Intergenic
1066554451 10:36595778-36595800 CCATTGCCTGATCTAAGAAAGGG - Intergenic
1066560902 10:36668752-36668774 CCATAGGCTGTTCTAAGAATTGG + Intergenic
1068014283 10:51495450-51495472 CTATAGCCTCATTTCAGATTTGG + Intronic
1068184188 10:53564142-53564164 CCATAGCCTGAGCTCTACATTGG - Intergenic
1069555876 10:69398221-69398243 CCACAGCCTTATCTGAGAACAGG - Intronic
1073115495 10:101089487-101089509 CCAGAGCCTCAGCTCAGCATAGG + Exonic
1081445093 11:43123542-43123564 CAATAGGCTGATCTCTGAACAGG + Intergenic
1083618734 11:64038665-64038687 ACATGGCCTGATCTCAGAGATGG + Intronic
1085588199 11:77731696-77731718 CCACAGCCTGAGCTCTGCATTGG - Intronic
1087611430 11:100438628-100438650 AAATAGCCTCATATCAGAATGGG + Intergenic
1090846671 11:130535245-130535267 CCATATCGTGTTCTCAGAATTGG - Intergenic
1092670617 12:10856760-10856782 CCAAAGGCTGATCTCAGACAAGG - Intronic
1096734878 12:53644906-53644928 CCAAAGCATGACCTCAGAAGAGG + Intronic
1098163903 12:67673606-67673628 CCATAGCCTGAGCTCTACATTGG + Intergenic
1103036634 12:117662231-117662253 CCACAGTCTTGTCTCAGAATTGG - Intronic
1108987087 13:56605333-56605355 CCATAACCTAATCTCAGAAATGG + Intergenic
1111317593 13:86582509-86582531 CCAAAGGGTGATCTCAGCATAGG + Intergenic
1112904112 13:104396280-104396302 CCATTGTCTGATCTTAAAATAGG - Intergenic
1118225601 14:63896217-63896239 CCATAGCATGTTCTCATAAAAGG + Intronic
1121004707 14:90482664-90482686 CCAGAGCCAGTTCTCAGAAGGGG + Intergenic
1124636022 15:31365737-31365759 TCAAAGCCTGAGCTCAGACTCGG - Intronic
1131689488 15:94811232-94811254 GCAGAGCCTGATCTCAAACTAGG + Intergenic
1134830547 16:17319395-17319417 ACATAGGCTGATCAAAGAATGGG + Intronic
1135559791 16:23467467-23467489 CCAGAGCCTGACGTCAGGATAGG + Exonic
1136674800 16:31893206-31893228 CCACAGCCTGAGCTCTGTATTGG + Intronic
1137024286 16:35457329-35457351 CCCTAACCTGTTCTCAGAGTTGG - Intergenic
1139752826 16:69119776-69119798 AAAAAGCCTGATCTCAGATTGGG + Exonic
1140723787 16:77793755-77793777 CCATTGGCTGATCTGAAAATGGG + Intronic
1142539522 17:647241-647263 GCATAGCAGGATCTCAGAAGAGG - Intronic
1144237439 17:13275310-13275332 CCATGGGCTGATCTCACAGTTGG + Intergenic
1146481140 17:33205905-33205927 CCAAACCGTGGTCTCAGAATGGG - Intronic
1146664181 17:34685859-34685881 CCATTGCAAGATCTCAGACTTGG - Intergenic
1149402640 17:56313634-56313656 ACATAGACTAATCTAAGAATGGG - Intronic
1150624181 17:66830850-66830872 CCATAGCCTTATCTGGAAATAGG + Intergenic
1153621535 18:6983146-6983168 CCAGAGCCTGATTGAAGAATCGG - Exonic
1153652067 18:7249595-7249617 CCAGAACCTCATCTCAGAAAGGG - Intergenic
1157083853 18:44556802-44556824 CTATAACCTCATCTCAGAAACGG + Intergenic
1157408808 18:47446609-47446631 CCATAGCCTGAGCTCTATATTGG - Intergenic
1159562014 18:70005952-70005974 CCAAAGCCTGCTCTGAGAAAAGG - Intronic
927231525 2:20828763-20828785 TTATAACCTAATCTCAGAATTGG + Intergenic
928216439 2:29365391-29365413 CCATAACCTGTCCTCTGAATGGG - Intronic
932075706 2:68660552-68660574 CCAGAGCCTTATCTGAGAGTGGG + Intergenic
933309808 2:80646509-80646531 CTATATCCTGAGCTCAGGATTGG - Intronic
942109393 2:172665262-172665284 CCATGCTCTGATCTCAGACTAGG + Intergenic
944325488 2:198399104-198399126 CCTGAGCCTGATTTCAGACTGGG + Intronic
946575465 2:221071188-221071210 CCATAGCCTCATCTGAGATGAGG + Intergenic
947060839 2:226163280-226163302 CCATAAGCTGATCCCAGAAAAGG + Intergenic
947519902 2:230837504-230837526 CCACAGCCCAATCTCAGAATTGG + Intergenic
1172640089 20:36435673-36435695 CCAGAGCCTGAGCCTAGAATGGG - Intronic
1173752030 20:45484817-45484839 GGATAGGCTGATCACAGAATGGG - Intergenic
1174571813 20:51507373-51507395 TCATAGCCTGGTCTCAGACGTGG + Intronic
1174812559 20:53659646-53659668 CCATCTCCTGACCTCATAATCGG + Intergenic
1174892133 20:54406930-54406952 CCAGAGCCTCTTCTCATAATGGG - Intergenic
1175752215 20:61506931-61506953 CCACAGCCTCATGTCTGAATAGG - Intronic
1178661522 21:34511015-34511037 CCTTAGCCTGATGTCAGGGTGGG + Intergenic
1179217078 21:39376825-39376847 CCTCAGCCTGACCTGAGAATAGG - Intergenic
1180146942 21:45926793-45926815 TCGTCCCCTGATCTCAGAATAGG - Intronic
1181436059 22:22911650-22911672 CCAGAGCCTGACTTTAGAATTGG - Intergenic
1181560733 22:23698069-23698091 CCCCAGCCTGTTCTCAGAGTTGG - Intronic
949411407 3:3769030-3769052 CCTTGACCTGATCTCAGAAATGG - Intronic
950401845 3:12775114-12775136 CCAGAGCCAGAGCTCAAAATGGG - Intergenic
952674264 3:36008236-36008258 CCAAAGCCTCATCTAAGAAAAGG + Intergenic
955338652 3:58107794-58107816 CCATAGGCTGATGTCAGTCTGGG + Intronic
955892868 3:63668723-63668745 GCAAATCCTGATCTCAGAGTTGG - Intronic
956322164 3:68008756-68008778 CCATGGCCACCTCTCAGAATGGG - Intronic
956935533 3:74096618-74096640 GCATTGCCTGATCTCAGACAAGG - Intergenic
956938607 3:74131983-74132005 CCATAGCCTGAGCTCTATATTGG + Intergenic
959214714 3:103437080-103437102 CCAAAGTCTCATCTGAGAATAGG + Intergenic
960004630 3:112769442-112769464 CCATCCCTTGCTCTCAGAATGGG + Intronic
960179179 3:114554431-114554453 CAATATCCTCATTTCAGAATTGG + Intronic
961052298 3:123757245-123757267 CCATAGCCTGTGCTCAGAGCAGG + Intronic
964630770 3:158807958-158807980 CCCAAGGCTGGTCTCAGAATAGG - Intronic
966123299 3:176547433-176547455 CCAAAGCCTCATCTGAGAAAAGG + Intergenic
969202909 4:5619984-5620006 CCATACCCAGATCTCAGTGTGGG + Intronic
969277095 4:6143325-6143347 CCACACCCAGATCCCAGAATTGG - Intronic
970150294 4:13082190-13082212 CCATAGCCTGAGCTCCACATTGG + Intergenic
970554230 4:17215263-17215285 CCACAGCCTGAGCTCTGCATTGG + Intergenic
975589977 4:75990309-75990331 ACACAGCCTGCTCTCAGAAACGG + Intronic
980960797 4:139472675-139472697 CCATAGCTGGATCTAAAAATGGG - Exonic
983091219 4:163505016-163505038 TGATAACCTAATCTCAGAATTGG + Intronic
984472653 4:180196122-180196144 CCATAACCTTATCTAAGAATTGG - Intergenic
990514826 5:56521297-56521319 GCCTTGCCTCATCTCAGAATTGG - Intronic
991603009 5:68372384-68372406 CCAAAGCCTGATCTGAAAATAGG - Intergenic
994549239 5:101209262-101209284 CCAAAGCCTCATCTAAGAAAAGG - Intergenic
994798064 5:104332006-104332028 CCACAGTCTGATCTCTGATTTGG - Intergenic
994926256 5:106120738-106120760 TCACAGGCTGATCTCAGAAATGG + Intergenic
999229808 5:150055073-150055095 CCATAGCTTGAACTCAAAAGGGG + Intronic
1001665777 5:173432742-173432764 CCATAGCCTGATCTAGGTAGTGG - Intergenic
1002125837 5:177043375-177043397 AGAAAGCCTGATCTCTGAATAGG - Intronic
1002472889 5:179447730-179447752 CCATAGCCTGAACCCAGCCTGGG - Intergenic
1002481333 5:179502932-179502954 CCATAGCCTGAACCCAGCCTGGG + Intergenic
1004122137 6:12834019-12834041 CCATAGCCTACTGTCAGGATGGG - Intronic
1006044633 6:31284093-31284115 CCATAGCCTCCTCTCTGCATGGG - Intronic
1006591325 6:35160190-35160212 CCATAGCAAGCTCTTAGAATAGG - Intergenic
1008256834 6:49312181-49312203 CCATCACCTGATATCAGCATTGG - Intergenic
1009729306 6:67579187-67579209 CCATGGCCTGAGCTCTGCATTGG - Intergenic
1013222547 6:108091773-108091795 TCATAACCTGGTCTCAAAATAGG - Intronic
1015003128 6:128244691-128244713 CCATAGCCTGATCTCAGAATTGG - Intronic
1015062281 6:128981227-128981249 AAATAGCCTGATCTTAAAATAGG - Intronic
1017646026 6:156540838-156540860 CCCCAGCCTGATCCCAGAGTTGG + Intergenic
1018356132 6:163019597-163019619 CCATCTCCTGATTCCAGAATGGG - Intronic
1020822111 7:12983319-12983341 CCTGAGCCTAATCCCAGAATGGG - Intergenic
1024020296 7:45362340-45362362 CCACTGCCTCATCTCAGTATTGG - Intergenic
1025868354 7:65406783-65406805 CAAGACCCTGATCTGAGAATGGG - Intergenic
1036529436 8:9569981-9570003 CAGTTGCATGATCTCAGAATAGG - Intronic
1038490698 8:27968697-27968719 CCTTAGCCTCATGACAGAATAGG + Intronic
1043002326 8:74774186-74774208 GCAAAGCCTGAGCTCAAAATGGG + Intronic
1046129257 8:109946635-109946657 CCATAGCCTGAGCTCTACATTGG - Intergenic
1047663405 8:127063530-127063552 CCATAGCTTGATCAAAGAAGTGG + Intergenic
1048768251 8:137867663-137867685 CCATGGCCTGAGCTCTGCATTGG - Intergenic
1049491000 8:142902159-142902181 CCAAAGCGTGATCTCAGTAGAGG + Intronic
1055464688 9:76552883-76552905 CCATAGCATCCTCACAGAATAGG + Intergenic
1056550413 9:87648727-87648749 CCATAGCCTGCTCACAGATGTGG + Intronic
1056819380 9:89826665-89826687 CCAAAGCCATATCTCTGAATCGG - Intergenic
1058307288 9:103459814-103459836 CCAGAGCCTTATCTCAGCAGAGG + Intergenic
1060321462 9:122565319-122565341 CCAAAGCATGACCTCAGAAGGGG + Intergenic
1060600160 9:124871955-124871977 CCACAGCCTGTTCTCTGAAAAGG + Intronic
1185821072 X:3204981-3205003 CCAAAGCCTGACCTCAGAGCTGG - Intergenic
1186262173 X:7791298-7791320 CCCAAGCTTCATCTCAGAATTGG - Intergenic
1189794556 X:44634321-44634343 AAAAAGCCTGATCTCAGATTGGG - Intergenic
1190946341 X:55097623-55097645 CCATGGCCTGCTCTAGGAATAGG + Intronic
1192428956 X:71099992-71100014 CCAGAGCCAGTTCTCTGAATAGG - Intronic
1194248248 X:91540867-91540889 TCAAAGCCTGAACTCAGAACTGG + Intergenic
1194884934 X:99302488-99302510 CCATTGCCTCCTCTCAGAAGCGG - Intergenic
1199890285 X:152072209-152072231 CCAGAGCCTGATCTCTGAGTGGG + Intergenic
1201754507 Y:17471405-17471427 CCACAGAGTGCTCTCAGAATGGG + Intergenic
1201847045 Y:18434580-18434602 CCACAGAGTGCTCTCAGAATGGG - Intergenic