ID: 1015003131

View in Genome Browser
Species Human (GRCh38)
Location 6:128244729-128244751
Sequence GACTGAAAACCTCTAGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015003128_1015003131 15 Left 1015003128 6:128244691-128244713 CCAATTCTGAGATCAGGCTATGG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1015003131 6:128244729-128244751 GACTGAAAACCTCTAGTAGGAGG No data
1015003126_1015003131 30 Left 1015003126 6:128244676-128244698 CCATGGGAGTATCTGCCAATTCT 0: 1
1: 0
2: 3
3: 20
4: 137
Right 1015003131 6:128244729-128244751 GACTGAAAACCTCTAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015003131 Original CRISPR GACTGAAAACCTCTAGTAGG AGG Intronic
No off target data available for this crispr