ID: 1015003480

View in Genome Browser
Species Human (GRCh38)
Location 6:128249238-128249260
Sequence CAGGGTTATCAATTTCAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015003480_1015003484 7 Left 1015003480 6:128249238-128249260 CCCAATTGAAATTGATAACCCTG 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1015003484 6:128249268-128249290 AGTGATCAAAATCTATCATGTGG 0: 1
1: 0
2: 1
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015003480 Original CRISPR CAGGGTTATCAATTTCAATT GGG (reversed) Intronic
905245624 1:36611219-36611241 CAGGGTTTTGCCTTTCAATTTGG + Intergenic
907777082 1:57526750-57526772 CAGGGTTATTATTTTTAGTTAGG - Intronic
908511413 1:64852679-64852701 CAGGGTTAACAATGTGAATGGGG + Intronic
911945612 1:104104281-104104303 CATGGTTATCTATTCCTATTTGG + Intergenic
919104935 1:193137711-193137733 CAGAGTCAACAATTTCATTTTGG - Intronic
919269118 1:195315679-195315701 AAAGCTTATCAGTTTCAATTTGG + Intergenic
920215801 1:204360747-204360769 CAGGGTTATCAAGACCGATTTGG - Intronic
922850021 1:228724728-228724750 CAGGGTACAAAATTTCAATTAGG - Intergenic
1063110236 10:3029261-3029283 GAGGCTCATAAATTTCAATTTGG - Intergenic
1063556848 10:7088547-7088569 GAGGATTATCTATTTCAATTTGG + Intergenic
1064506014 10:16030886-16030908 CAGGATAATCAATTTCTGTTTGG - Intergenic
1066261764 10:33736248-33736270 CAGGGTCTTCTATTTCCATTTGG - Intergenic
1066283828 10:33944580-33944602 CAGGGTTCTCAATGTAAAGTCGG - Intergenic
1066349303 10:34622584-34622606 CAAGATTATCAATTCCAGTTAGG + Intronic
1072240825 10:93494577-93494599 CAGGGCTAGCAATGGCAATTAGG + Intergenic
1072878136 10:99196336-99196358 CAGGGTATTCATTTTCACTTTGG - Intronic
1075615353 10:123886890-123886912 CAGGGTCATCAATTTGAAGATGG + Intronic
1075765369 10:124888746-124888768 TAGTATTATTAATTTCAATTTGG + Intergenic
1076336634 10:129710952-129710974 CAGGTTTATCTATTTCAACCTGG + Intronic
1078148273 11:8737152-8737174 CTGGGTTATAAATTTCAATATGG + Intronic
1080335455 11:31190514-31190536 CAGTGTTTGCAATTACAATTTGG - Intronic
1080825588 11:35846326-35846348 GAGGGATATCAGTTTCAAGTGGG - Intergenic
1083121137 11:60512732-60512754 CAGGGGTCTCTATTTCATTTAGG + Intergenic
1084328943 11:68418701-68418723 CATGGCTCTGAATTTCAATTCGG - Intronic
1086314293 11:85574260-85574282 CAAGGTTAGAAATTTAAATTTGG - Intronic
1087573338 11:99959213-99959235 CATGATCATCAATTTCAAGTGGG + Intronic
1090712312 11:129398651-129398673 CAGGGTTCTAAATTTCCAATGGG - Intronic
1091877497 12:3948443-3948465 CAGGGTTATTACTTTCAAGGAGG - Intergenic
1092552020 12:9513202-9513224 CAGAGTTACCCATTTCTATTTGG + Intergenic
1093201640 12:16194189-16194211 CAGGGTAAGAAATTTCAATTTGG - Intronic
1093962541 12:25290969-25290991 AAGGGTTATCATTTATAATTAGG - Intergenic
1094520103 12:31177421-31177443 CAGAGTTACCCATTTCTATTTGG - Intergenic
1095144866 12:38714102-38714124 CAGAATCATAAATTTCAATTTGG - Intronic
1095643145 12:44508119-44508141 TAGGCATATCATTTTCAATTTGG + Intergenic
1100905736 12:99296558-99296580 GAGGGATATAAATTTAAATTGGG - Intronic
1104272843 12:127297638-127297660 CAGGGATATCAAGTTCCCTTTGG + Intergenic
1104339661 12:127936370-127936392 CATAGTTATCTATTTCAGTTAGG - Intergenic
1109636599 13:65126581-65126603 CAGGGATACAAATTTTAATTAGG + Intergenic
1110202593 13:72870140-72870162 CATGGTAATTAATTTCCATTAGG - Intronic
1112593566 13:100787276-100787298 CAAGGTTATCAATAACAAGTTGG + Intergenic
1116685112 14:48029132-48029154 CAGGTTTACTGATTTCAATTTGG + Intergenic
1117925414 14:60774041-60774063 CAGGGTCATCAATTTTAGATTGG + Intronic
1124202399 15:27689882-27689904 CAGGGTTGTCAGTTTCAGTGTGG - Intergenic
1139088024 16:63612739-63612761 CAGGCTTGTCCAATTCAATTTGG + Intergenic
1155534956 18:26807659-26807681 CAGCGTTATGAGTTTCAATGAGG + Intergenic
1156751258 18:40458686-40458708 GAAGGTTATTTATTTCAATTTGG + Intergenic
1160336650 18:78047500-78047522 CAGTGATATCCATTTCCATTAGG - Intergenic
1164643746 19:29843949-29843971 CAGGGTTATCATGTTCCCTTGGG + Intergenic
1167627341 19:50600830-50600852 CAGGGTTATAAAATTCCCTTAGG + Intergenic
925116173 2:1380056-1380078 CAGGGTTATCAAATAAAATAAGG - Intronic
925247292 2:2395365-2395387 CTAGGTTATTAATGTCAATTTGG + Intergenic
925779399 2:7367478-7367500 GAGGTTTATCAATTTTTATTAGG - Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930809254 2:55523474-55523496 CAGGATTATGAAGTTCAATGTGG - Intronic
931908023 2:66863680-66863702 CAGGGTTATCAATTTTCAGTGGG + Intergenic
932555345 2:72818909-72818931 CTGGGTTATTGCTTTCAATTAGG - Intronic
933453293 2:82486835-82486857 TAGGTTTATTAATCTCAATTTGG - Intergenic
936990035 2:118353868-118353890 CATGGTTATCTATTTCATTTGGG + Intergenic
937625167 2:124035713-124035735 TTGGGTCATCAATTTTAATTGGG - Intronic
938877136 2:135543964-135543986 CAGAGCTGTGAATTTCAATTAGG - Intronic
939565943 2:143786635-143786657 AAGGGTTAACTAATTCAATTTGG - Intergenic
941508065 2:166372473-166372495 CAAGGTTATCATTTTAGATTTGG + Intronic
945338696 2:208623728-208623750 CAATGTTATCAATTAGAATTTGG - Intronic
945712475 2:213316045-213316067 CAGGGTTGGCAATTTAAATTTGG - Intronic
947890751 2:233617094-233617116 CAGGGTTGTCAATGTCATTTCGG + Intergenic
947892366 2:233635926-233635948 CAGGGTTGTCAATCTCATTTTGG + Intronic
1177058408 21:16338574-16338596 CATCGATATCATTTTCAATTTGG + Intergenic
1178209310 21:30510253-30510275 CAGGCTTATCAAGTTCACTCAGG + Intergenic
1183478514 22:38050359-38050381 CAGGGTTCTCAAACTCAAGTGGG - Intergenic
949879493 3:8650163-8650185 CAGGGTGTTCAATTTTAAATAGG - Intronic
950034821 3:9877815-9877837 CAGCGTTATCAACATCACTTGGG - Intronic
951333351 3:21391844-21391866 CAGGGTCATCAATCTCCATCAGG + Intergenic
952922230 3:38293425-38293447 CAAGGTTACCAAGTTCAATAGGG + Intronic
956329426 3:68089179-68089201 CAGGGCTAGCAATTTAAATTTGG + Intronic
960873970 3:122278302-122278324 CAGTGTCATCAACTTCAAATTGG - Intronic
961124709 3:124406569-124406591 CTGGGTTATCAATTGCAAAATGG - Intronic
965726491 3:171722028-171722050 CACATTTATCATTTTCAATTTGG + Intronic
972020457 4:34307060-34307082 CATGATTATCACTTTCAGTTTGG + Intergenic
973898092 4:55436539-55436561 CAGGGTTCTTAATTTCAAAATGG + Intronic
978131467 4:105203148-105203170 AAGGGCTATCAATTTCAAATTGG + Intronic
979179782 4:117710542-117710564 CAGGTTGATCAATTTCCATGTGG - Intergenic
979315713 4:119259393-119259415 CAATGTTATCAATTTCAGCTAGG - Intronic
982438734 4:155408437-155408459 CAGGTTAATCAATATCAAATCGG - Intergenic
982465683 4:155728011-155728033 CAGGAATATCACTTTCATTTAGG + Intronic
984279499 4:177652220-177652242 CAGGTTTATCAATTTATATTTGG + Intergenic
984305182 4:177980147-177980169 AAAGGTTACAAATTTCAATTTGG - Intronic
990515302 5:56525815-56525837 CAGCTTTGTCCATTTCAATTAGG + Intronic
991248662 5:64534775-64534797 CAGGGCTATAAATTTAAATATGG + Intronic
992125369 5:73634243-73634265 GATGTTTATCAATTTCAAGTAGG + Intronic
995220600 5:109643329-109643351 CAGGGTTGTCAGTTCCCATTAGG - Intergenic
997813209 5:136992412-136992434 TAGGGTTAGCAATATCATTTGGG - Intronic
998774689 5:145586155-145586177 CAGGGTGAGCACTGTCAATTTGG - Intronic
998895847 5:146799244-146799266 CTGTGTTAACAATTTAAATTAGG - Intronic
1000153815 5:158530734-158530756 CAGGGGTATGAATCTCAATTTGG + Intergenic
1000683820 5:164222066-164222088 AAGAGTCATCAGTTTCAATTTGG + Intergenic
1000755283 5:165150987-165151009 CAGATTTATCAACTTAAATTTGG + Intergenic
1001169966 5:169410042-169410064 CAGAGTTATCAAGTTAAAATGGG + Intergenic
1003862620 6:10336361-10336383 CATGGTAATCAATTTAAATGTGG + Intergenic
1004258241 6:14084741-14084763 GAGTGTTAACAATTTCCATTTGG - Intergenic
1005076473 6:21913165-21913187 CACAGTTTTCAATTTCAGTTGGG + Intergenic
1010419565 6:75656621-75656643 CAGGGTTAAGAAATTCCATTAGG - Intronic
1015003480 6:128249238-128249260 CAGGGTTATCAATTTCAATTGGG - Intronic
1016265014 6:142222268-142222290 CACCGTTATCAGTTTCACTTGGG - Exonic
1017675848 6:156812910-156812932 CAGGATTATAATTTTCTATTTGG - Intronic
1018786563 6:167112923-167112945 CTGGTTTATCACTTTCACTTGGG - Intergenic
1019939463 7:4277726-4277748 CAGGGTTATGAATTTTAAGAAGG - Intergenic
1023310180 7:38878439-38878461 CATGGTTATCAAAATGAATTTGG - Intronic
1027868557 7:83677282-83677304 CAGGGTTTACACTTTCCATTTGG - Intergenic
1028116659 7:87004863-87004885 CAGGGTTAGCAATTTTCTTTGGG - Intronic
1028174707 7:87641469-87641491 CAGGGTTTTCAACTTGGATTTGG + Intronic
1028216457 7:88139480-88139502 CAGAGTTATCAAATTTAAATAGG - Intronic
1030590653 7:111477336-111477358 AAGGGTTAAGAATTTCAAGTTGG - Intronic
1034186715 7:149183583-149183605 CAGGGTTAGAAATATCAATCAGG - Intergenic
1037049613 8:14355007-14355029 GAAGTTTTTCAATTTCAATTTGG + Intronic
1037313095 8:17576914-17576936 CAAGGTTATCAAGTTCAAGAAGG - Intronic
1038915865 8:32021939-32021961 CATAGTTATCAATGGCAATTTGG + Intronic
1040917514 8:52578459-52578481 CAGAGTAATCAATTCCAACTGGG - Intergenic
1042203455 8:66304272-66304294 TAGGGAAATCAATTTCATTTTGG - Intergenic
1046072070 8:109267916-109267938 CAGGATCATAAATTTCTATTTGG - Intronic
1048017899 8:130513879-130513901 AATGGTTACAAATTTCAATTTGG + Intergenic
1050519338 9:6481103-6481125 TAGGGTAATCAATTACAAATAGG + Intronic
1050656520 9:7834342-7834364 CAGAGTTAGCAATTTCTACTGGG - Intronic
1052038142 9:23706477-23706499 GAGAGTCATCAATTACAATTGGG - Intronic
1052324062 9:27198082-27198104 CAGGCTTCTCAATTTCAGATTGG + Intronic
1057887759 9:98843879-98843901 CAGGCTTATCAACTTAAAATAGG + Intronic
1062719569 9:138030753-138030775 CAGTGTTATCTATTTCATATTGG + Intronic
1193332321 X:80248788-80248810 CTGGGTTCTCCATCTCAATTTGG + Intergenic
1193931434 X:87557795-87557817 CATGGATATAAATTTGAATTAGG + Intronic
1199192559 X:144987997-144988019 GAGGGATATCAATTTAAAATTGG - Intergenic
1202111044 Y:21421059-21421081 CATGGTGATGAATTTCAGTTAGG + Intergenic