ID: 1015005280

View in Genome Browser
Species Human (GRCh38)
Location 6:128272840-128272862
Sequence ATGCTCAGTAATGGGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39248
Summary {0: 7, 1: 549, 2: 15445, 3: 11951, 4: 11296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015005280_1015005287 20 Left 1015005280 6:128272840-128272862 CCAGCCATCCCATTACTGAGCAT 0: 7
1: 549
2: 15445
3: 11951
4: 11296
Right 1015005287 6:128272883-128272905 CATGCTGCTATAAAGACACACGG 0: 71
1: 42
2: 57
3: 102
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015005280 Original CRISPR ATGCTCAGTAATGGGATGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr