ID: 1015005287

View in Genome Browser
Species Human (GRCh38)
Location 6:128272883-128272905
Sequence CATGCTGCTATAAAGACACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 71, 1: 42, 2: 57, 3: 102, 4: 274}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015005278_1015005287 29 Left 1015005278 6:128272831-128272853 CCATTTGACCCAGCCATCCCATT 0: 14736
1: 10354
2: 7633
3: 7237
4: 8410
Right 1015005287 6:128272883-128272905 CATGCTGCTATAAAGACACACGG 0: 71
1: 42
2: 57
3: 102
4: 274
1015005279_1015005287 21 Left 1015005279 6:128272839-128272861 CCCAGCCATCCCATTACTGAGCA 0: 8
1: 545
2: 15235
3: 11443
4: 8782
Right 1015005287 6:128272883-128272905 CATGCTGCTATAAAGACACACGG 0: 71
1: 42
2: 57
3: 102
4: 274
1015005285_1015005287 -6 Left 1015005285 6:128272866-128272888 CCCGAAGGATTATTAATCATGCT 0: 1
1: 76
2: 8485
3: 14233
4: 8239
Right 1015005287 6:128272883-128272905 CATGCTGCTATAAAGACACACGG 0: 71
1: 42
2: 57
3: 102
4: 274
1015005283_1015005287 11 Left 1015005283 6:128272849-128272871 CCATTACTGAGCATATACCCGAA 0: 1
1: 43
2: 1475
3: 21842
4: 11951
Right 1015005287 6:128272883-128272905 CATGCTGCTATAAAGACACACGG 0: 71
1: 42
2: 57
3: 102
4: 274
1015005282_1015005287 12 Left 1015005282 6:128272848-128272870 CCCATTACTGAGCATATACCCGA 0: 2
1: 42
2: 1428
3: 21529
4: 11795
Right 1015005287 6:128272883-128272905 CATGCTGCTATAAAGACACACGG 0: 71
1: 42
2: 57
3: 102
4: 274
1015005286_1015005287 -7 Left 1015005286 6:128272867-128272889 CCGAAGGATTATTAATCATGCTG 0: 5
1: 6829
2: 11817
3: 8267
4: 5828
Right 1015005287 6:128272883-128272905 CATGCTGCTATAAAGACACACGG 0: 71
1: 42
2: 57
3: 102
4: 274
1015005280_1015005287 20 Left 1015005280 6:128272840-128272862 CCAGCCATCCCATTACTGAGCAT 0: 7
1: 549
2: 15445
3: 11951
4: 11296
Right 1015005287 6:128272883-128272905 CATGCTGCTATAAAGACACACGG 0: 71
1: 42
2: 57
3: 102
4: 274
1015005281_1015005287 16 Left 1015005281 6:128272844-128272866 CCATCCCATTACTGAGCATATAC 0: 6
1: 513
2: 14333
3: 4489
4: 1221
Right 1015005287 6:128272883-128272905 CATGCTGCTATAAAGACACACGG 0: 71
1: 42
2: 57
3: 102
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015005287 Original CRISPR CATGCTGCTATAAAGACACA CGG Intronic
901949529 1:12731081-12731103 CATTCTACTATAAAGACACATGG - Intergenic
903983630 1:27208461-27208483 CATGCTGCTATAAAGTCACATGG + Intergenic
904922186 1:34016622-34016644 CATTCTGCTATAAAGATACATGG + Intronic
905545294 1:38793050-38793072 CATGCTGCTAGAAAGTGGCAAGG + Intergenic
906834512 1:49068697-49068719 CATTCTACTATAAAGACACATGG - Intronic
907561585 1:55394860-55394882 CATGCTATTATAAAGTCAAAAGG - Intergenic
907627865 1:56048709-56048731 CAGGCTGCTATAAAGACACCTGG - Intergenic
907863207 1:58373645-58373667 CATGCTGCTATAAAGACACGTGG - Intronic
908480365 1:64533444-64533466 CCAGCTGCTATAAATACATATGG - Intronic
908610013 1:65847550-65847572 CATTCTGCTATAATCACAAAGGG - Intronic
908864245 1:68528164-68528186 CATACTACTAAAAAGAGACATGG - Intergenic
908969597 1:69811444-69811466 CATTCTAATATAAAGACACATGG + Intronic
909060705 1:70875906-70875928 CATTCTACCATAAAGACTCATGG - Intronic
909734148 1:78935078-78935100 CATTCTACTATAAATACACATGG + Intronic
909770969 1:79420716-79420738 CATGCTACACTAAAGTCACAGGG + Intergenic
909874994 1:80790689-80790711 CATTCTACTATAAAGACACATGG + Intergenic
910327429 1:86026709-86026731 GTTGCTGCTATAAAGATACCTGG + Intronic
910610789 1:89139966-89139988 CATGCTGCTATAAAGACACATGG + Intronic
911185457 1:94899589-94899611 CATGCTACCAAAAAGACAGAAGG + Intronic
911298012 1:96141080-96141102 CATGCTGCTATAAAGACACATGG - Intergenic
912319441 1:108697667-108697689 CATGCTTTTTTAAAGACAGAAGG - Intronic
913310177 1:117482184-117482206 CATGCTACTGTAAAGACATACGG - Intronic
913387334 1:118272643-118272665 CATGCTGCTCATAAGACCCAGGG - Intergenic
913393653 1:118342575-118342597 CATGCTGATATAAAATCATATGG + Intergenic
913401422 1:118438686-118438708 CATGCTGCTATAAAGACACATGG + Intergenic
913987433 1:143577728-143577750 CATGCTACTATAAAGACACATGG - Intergenic
914403721 1:147348631-147348653 CATGCTGCTATAAAGACACAGGG + Intergenic
915155141 1:153869412-153869434 TATGCTGCTATAAATAAATATGG - Intronic
916125994 1:161571879-161571901 CATGCTACTGTAAGGACACATGG - Intergenic
916135910 1:161653726-161653748 CATGCTACTGTAAGGACACATGG - Intronic
917126104 1:171689301-171689323 CATGCTGCTATAAAGACACATGG - Intergenic
917228219 1:172806945-172806967 CATGCTGCTATAAAGACACCTGG - Intergenic
917515647 1:175705695-175705717 CTTGCTGAAATCAAGACACATGG - Intronic
917524872 1:175779574-175779596 CGTGCTATCATAAAGACACATGG + Intergenic
919152446 1:193718331-193718353 CATGCTGCTATAAAGACACATGG - Intergenic
919180733 1:194078063-194078085 CATTCTACTATAAAGACACATGG + Intergenic
919186450 1:194157483-194157505 CATCCTACTATAAATACAAATGG - Intergenic
919400575 1:197111599-197111621 CATTCTACCAAAAAGACACATGG + Intronic
919533905 1:198762298-198762320 CATTCTATTATAAAGATACATGG + Intergenic
921396632 1:214675565-214675587 CATGCTGCTATAAAGACACATGG + Intergenic
924206802 1:241720270-241720292 CATTCTATTATAAAGATACATGG - Intronic
924695631 1:246396881-246396903 CACACTGCTATAAAGACACATGG - Intronic
1063724240 10:8619638-8619660 GATGTTGCTATAAACACACCTGG - Intergenic
1064598370 10:16969040-16969062 CATGCTGCTATAATGAGAAAAGG - Intronic
1066934253 10:41805653-41805675 CATGCTGCTATAAAGACACACGG + Intergenic
1068289739 10:54987332-54987354 CATTCTACCATAAAGATACATGG - Intronic
1068449758 10:57170976-57170998 CATTCTACCATAAAGACACATGG + Intergenic
1068450656 10:57182747-57182769 CAGGGTGCTAAAAACACACAAGG + Intergenic
1068608210 10:59029581-59029603 CATACTGCTATAAAGACACATGG - Intergenic
1068959954 10:62857122-62857144 CATACTGCTAGAAAAGCACATGG - Intronic
1070659166 10:78292645-78292667 CATGGTGCTAGCTAGACACAGGG - Intergenic
1071024414 10:81095131-81095153 CATGCTGCTATATAAAAACATGG + Intergenic
1071059922 10:81557655-81557677 CATTCTGCTATAAAGACACATGG - Intergenic
1071751767 10:88486885-88486907 CATTCTACCATAAAGACACATGG + Intronic
1072312122 10:94166704-94166726 CAAGCTGCTATTGAGAGACAGGG - Intronic
1072838423 10:98742367-98742389 CAAGATGCAATAAATACACATGG + Intronic
1073880838 10:107977897-107977919 CATTCTCCCATAAAGACCCATGG + Intergenic
1074025601 10:109630573-109630595 CATGCTACTATAGAGACACATGG - Intergenic
1074980736 10:118618128-118618150 AATACTGCTATGAAGACAAAGGG + Intergenic
1075720265 10:124581346-124581368 AATGCTGCTATAAGGATTCATGG + Intronic
1075858801 10:125656008-125656030 CACGATGCTATAAAGAGATATGG - Exonic
1078867490 11:15311685-15311707 CATGATACTGTAAAAACACAAGG - Intergenic
1079833881 11:25306725-25306747 CATTCTACTAAAAAGACACATGG + Intergenic
1080513178 11:32995495-32995517 CATTCTATTATAAAGATACATGG - Intergenic
1080705403 11:34687434-34687456 CATGCTGCTGTAAAGACACATGG - Intergenic
1080754721 11:35185860-35185882 CAGTCTGCTTTTAAGACACAAGG + Intronic
1081001996 11:37685892-37685914 CATTCTATTACAAAGACACATGG + Intergenic
1081056657 11:38417516-38417538 CATTCTGTTATAAAGACCCATGG - Intergenic
1081504075 11:43696686-43696708 CATTCTACTATAAAGACACATGG + Intronic
1082108063 11:48242396-48242418 CATACTGCTTAAAAGACACCGGG - Intergenic
1082123739 11:48407982-48408004 CATGCTGCCATAAAGACACATGG + Intergenic
1082684051 11:56216619-56216641 AGTGCTGCAATAAACACACATGG + Intergenic
1084225901 11:67714679-67714701 AGTGCTGCTATGAAGAGACAAGG + Intergenic
1084263722 11:67994535-67994557 AGTGCTGCTATGAAGAGACAAGG + Intronic
1084615183 11:70231132-70231154 CATGCTGCTGTGAAGTCACCTGG - Intergenic
1084809685 11:71604585-71604607 AGTGCTGCTATGAAGAGACAAGG - Intergenic
1084984110 11:72852395-72852417 CATTCTACTATAAAGACACATGG + Intronic
1086260288 11:84931578-84931600 CATTTTATTATAAAGACACATGG - Intronic
1086731918 11:90260997-90261019 CATGAAGGAATAAAGACACAAGG - Intergenic
1086826453 11:91505145-91505167 CATGCTGCTATAAAGACACATGG - Intergenic
1086870610 11:92032419-92032441 CATGCTGCTATAAAGACACATGG + Intergenic
1087403106 11:97693390-97693412 CGTTCTACCATAAAGACACATGG - Intergenic
1088112085 11:106273792-106273814 CATTCTACCAAAAAGACACATGG - Intergenic
1088534608 11:110846817-110846839 CATTCTACTATAAAGACTTATGG - Intergenic
1088776906 11:113094060-113094082 CATGCTGCTTCAAATACAGAGGG + Intronic
1089166978 11:116484896-116484918 AATGCAGCCATAAAGAAACATGG + Intergenic
1091224223 11:133948029-133948051 CATGCTGGTAGACAGAAACAGGG - Intronic
1091300702 11:134505642-134505664 AAAGCTGCTATAAACAGACATGG + Intergenic
1093384690 12:18537953-18537975 CATGCTGCAATAGAGAGAAAAGG - Intronic
1094146363 12:27232520-27232542 AAAGATGATATAAAGACACAGGG - Intergenic
1094225775 12:28044128-28044150 CATTCTACAATAAAGACACATGG - Intergenic
1094435839 12:30419778-30419800 CATCCTACAATAAAGACAAATGG + Intergenic
1094453784 12:30609869-30609891 CATTCTATTATAAAGACACATGG + Intergenic
1095232094 12:39751576-39751598 CATGTTGCTATAAAGACACATGG + Intronic
1096356641 12:50946755-50946777 CATGCTGCTATAAAGACACAGGG + Intergenic
1096957413 12:55540593-55540615 TATGCTGCTATAAAGACACATGG - Intergenic
1097202233 12:57289109-57289131 CATGATGCTATGAATACCCAAGG + Intronic
1097214538 12:57400106-57400128 CATGCTGCTATAAAGACACATGG + Intronic
1097499262 12:60381443-60381465 CTTTCTACTATAAAGACACATGG - Intergenic
1098378874 12:69846664-69846686 CATGCTGCTATAAAGACACATGG - Intronic
1099039719 12:77636670-77636692 CATTCTACTATAAAGACACATGG + Intergenic
1099472027 12:83062329-83062351 CATGCTTCTATAAAGTAAGATGG + Intronic
1099592551 12:84613106-84613128 TATGCTGCTATAAAGACACATGG - Intergenic
1099719741 12:86345720-86345742 CATGCTGTTATAAAGGCACATGG - Intronic
1099784192 12:87239097-87239119 AGTGCTGATATAAAGATACAAGG - Intergenic
1100182420 12:92100082-92100104 CACACTGCTATAAAGACATACGG + Intronic
1101289801 12:103356491-103356513 CATGCTGCTATAAAGACACATGG - Intronic
1101379512 12:104202410-104202432 TATGCTGCTATAAACATGCATGG + Intergenic
1101407834 12:104444314-104444336 CATGCAGCTATGGAGACCCAGGG + Intergenic
1101449928 12:104766805-104766827 AATGGTGCTACAAAGAGACATGG + Intergenic
1103833311 12:123798223-123798245 CATTTTGCTATAAAGAAACTGGG + Intronic
1106175198 13:27324296-27324318 AAAGCTGCTATAAGCACACATGG - Intergenic
1106873793 13:34050092-34050114 CATTCTACTATGAAGACACTTGG - Intergenic
1108457250 13:50628845-50628867 CATGCTGCTATAAAGACACATGG - Intronic
1108593470 13:51931136-51931158 CATTCTACTATAAAGACACATGG + Intergenic
1108611231 13:52085656-52085678 CATGTTGTAAGAAAGACACATGG - Intronic
1109399634 13:61808603-61808625 CATTCTATTATAAAGACACATGG + Intergenic
1109864663 13:68247037-68247059 CATTCTACCATAAAGACAGATGG - Intergenic
1110867595 13:80414181-80414203 CATTCTACCAAAAAGACACATGG + Intergenic
1111495819 13:89048509-89048531 CATTCTACTACAAAGACACATGG + Intergenic
1111674239 13:91367382-91367404 AATGCTTCTATCAGGACACAAGG - Intergenic
1112794372 13:103039448-103039470 CCTGCTGCCTTAAAGACAAAGGG - Intergenic
1114374385 14:22128184-22128206 CATTCTATCATAAAGACACATGG - Intergenic
1114914696 14:27248674-27248696 CATTCTACTACAAAGACATATGG - Intergenic
1115100230 14:29689647-29689669 CATTCTACTATAAAGATGCATGG + Intronic
1115340364 14:32287325-32287347 CATGCTGCTATAAAGAGACTGGG - Intergenic
1115775168 14:36707020-36707042 AATGTTGCTAGAGAGACACAAGG - Intronic
1116319840 14:43447523-43447545 CATGCTACTATAAAGACACATGG - Intergenic
1116429156 14:44826142-44826164 CATTCTATTATAAAGATACATGG + Intergenic
1116513056 14:45770388-45770410 CATGCTGCTATAAAGACACATGG - Intergenic
1116631318 14:47338350-47338372 CATGATGCTAAAAACACAAAAGG + Intronic
1116703851 14:48271332-48271354 AATGCTGCTATAAACATCCATGG - Intergenic
1116792002 14:49349046-49349068 CATTCTACTCTAAAGACACATGG - Intergenic
1116796452 14:49395969-49395991 CATTCTACTCTAAAGACACATGG + Intergenic
1117437140 14:55727090-55727112 CATGCTACTATAAAGACACATGG - Intergenic
1117465983 14:55994510-55994532 CATTCTACTATAAAGACACATGG - Intergenic
1117837043 14:59818632-59818654 CCTCCTACCATAAAGACACACGG - Intronic
1118527825 14:66665774-66665796 CATGCTGCTATAAAGACACATGG + Intronic
1118529325 14:66685217-66685239 CATGCTGCTATAAAGACACATGG - Intronic
1119214919 14:72862140-72862162 CTGGTTGCTATAAAGGCACAGGG - Intronic
1120518853 14:85502666-85502688 CATGCTGTTTTAAAGATATATGG - Intergenic
1120803645 14:88721398-88721420 GATGCTGGTATAAAAACAGATGG + Intronic
1120919313 14:89740571-89740593 AAGGCTGCTGTGAAGACACAGGG - Intergenic
1121485914 14:94314238-94314260 CAGGCTGCCATCAAGAAACAAGG + Exonic
1121995259 14:98597481-98597503 CATACTGCTGTAAAGAAATAAGG - Intergenic
1202917156 14_GL000194v1_random:186051-186073 CATGCTGCTCTAAAGACACATGG + Intergenic
1202946694 14_KI270726v1_random:34145-34167 CATGCTGCTATAAAGACACATGG - Intergenic
1124667254 15:31604118-31604140 CATTCTACTATAAAGACACATGG + Intronic
1125898686 15:43325413-43325435 AATGCTGCTCCAAAGGCACAGGG + Exonic
1126305009 15:47246075-47246097 CATAATGCTTTAAAGAAACAAGG + Intronic
1126504530 15:49389187-49389209 TGTGCTGCTATAAACATACATGG - Intronic
1126957048 15:53944735-53944757 CATTCTACCATAAGGACACACGG - Intergenic
1127134559 15:55906306-55906328 CATGCTGCTATAAAGACACATGG + Intronic
1127734783 15:61830573-61830595 CATGCTGCAGGACAGACACAAGG + Intergenic
1129263354 15:74381155-74381177 TATGCTGCTCTCAGGACACATGG - Intergenic
1130092520 15:80832954-80832976 CATGCTGTGAGAAAGCCACACGG - Intronic
1130111927 15:80972534-80972556 CATGCTCCTAGAAAGGGACATGG + Intronic
1130455993 15:84108915-84108937 CATTCTGCTAGTAAGCCACAAGG + Intergenic
1130680876 15:85995607-85995629 CATTCTGTGAAAAAGACACATGG + Intergenic
1131593838 15:93776420-93776442 CCTGCTGCTATAAAGACACATGG + Intergenic
1131665181 15:94564006-94564028 CATGCCTCTATAAAGAGAAATGG + Intergenic
1132159972 15:99531556-99531578 CATGCTGTTATAAAGATACATGG - Intergenic
1132188635 15:99828419-99828441 CATGCTGCTATAAAGACACATGG - Intergenic
1133428696 16:5716722-5716744 CATTTTACTATAAAGACACATGG - Intergenic
1133868815 16:9668964-9668986 CATGCTACTGCCAAGACACAGGG - Intronic
1134463571 16:14451682-14451704 TATACTCCTATAAAGACACAGGG - Intronic
1134902457 16:17950820-17950842 CATTCTGCTACAAAGACACCTGG + Intergenic
1136492276 16:30616998-30617020 TTTGCTGCTAGAAAGACATAGGG + Intronic
1137437976 16:48472983-48473005 CATGCTGCTATAAAGACACATGG - Intergenic
1139040367 16:62992836-62992858 CATGCTGCTATAATGACACATGG - Intergenic
1140192836 16:72832890-72832912 GATGATGGTATAAAGACAGATGG - Intronic
1140759094 16:78095327-78095349 CATTCTATTATAAAGATACATGG - Intergenic
1143226097 17:5304776-5304798 CATGATGCTATAAAGATACATGG + Intronic
1143226212 17:5306321-5306343 CACGATGCTATAAAGATACATGG + Intronic
1143983020 17:10886382-10886404 CATTCTACCAAAAAGACACAAGG - Intergenic
1146551992 17:33788577-33788599 CGTTCTACTATAAAGACTCATGG + Intronic
1146623651 17:34419593-34419615 GAGGCTGCCATAAAGACCCAGGG - Intergenic
1146821633 17:35987443-35987465 CATTATGCCATAAAGAAACATGG + Intronic
1149148437 17:53529207-53529229 CATTCTATCATAAAGACACATGG - Intergenic
1149180453 17:53930770-53930792 AATTCTGCTATTAAGACACAGGG + Intergenic
1151111980 17:71689333-71689355 CATACTGCTATGAAGAAATACGG + Intergenic
1155105765 18:22664414-22664436 CATACTATTATAAAGACACATGG - Intergenic
1156556441 18:38074072-38074094 CATGCTGCTAGGCAGTCACAAGG - Intergenic
1156577197 18:38330889-38330911 CAAACTGCTATAGAGATACAAGG + Intergenic
1156626413 18:38915183-38915205 CATTCTACTATAAAGACACATGG - Intergenic
1157792677 18:50546496-50546518 CATTCTGCTATAGGCACACACGG - Intergenic
1158000604 18:52613886-52613908 CATGCTGCTTTCAGGGCACATGG + Intronic
1158812242 18:61051180-61051202 CATGCTGCTATAAAGACACATGG - Intergenic
1159686326 18:71425065-71425087 CATTCTATTATAAAGACACATGG - Intergenic
1163416025 19:17187028-17187050 GGTGTTGCTATAAAGACAAACGG - Intronic
1163644648 19:18481802-18481824 CAAGCAGCTATAAATACTCATGG + Intronic
1163954876 19:20628246-20628268 CATGCTGCTATAAAGACACATGG - Intronic
1164002049 19:21110062-21110084 CATTCTACTGTAAAGATACATGG - Intronic
1164695665 19:30241763-30241785 CGTGCTGCTCTAGAGAGACACGG + Intronic
1166425982 19:42678264-42678286 TATTCTACCATAAAGACACATGG - Intronic
1168207630 19:54863322-54863344 CATGCTGCTATAAAGACACATGG - Intronic
925558944 2:5166941-5166963 CATTCTACTATAAAGACACATGG + Intergenic
926499970 2:13641837-13641859 CATGCTGCTATAAAGACACATGG - Intergenic
926559554 2:14401300-14401322 TGTGCTTCTTTAAAGACACAGGG - Intergenic
927605185 2:24480577-24480599 CCTTCTACCATAAAGACACATGG - Intergenic
928483828 2:31709556-31709578 CATGCTGCTCTAGAGACACATGG - Intergenic
928751173 2:34472170-34472192 AATTCTACTATAGAGACACATGG + Intergenic
929079884 2:38111675-38111697 CATTCTACTATAATGACACAAGG - Intergenic
929280573 2:40073327-40073349 CATTCTACCAAAAAGACACATGG - Intergenic
929473814 2:42224496-42224518 AATGCTGCTATAAACAGTCATGG + Intronic
930175501 2:48297165-48297187 CATTCTATTATAAAGGCACATGG - Intergenic
931477144 2:62600008-62600030 CATTCTACTATAAAGACACATGG - Intergenic
931478622 2:62616877-62616899 CATTCCACTATAAAGACACATGG - Intergenic
931480937 2:62639236-62639258 CATTCTATTATAAAGACACATGG + Intergenic
932033451 2:68214801-68214823 CATTCTAACATAAAGACACATGG + Intronic
932908339 2:75778887-75778909 CATTCTATTATAAAGATACATGG + Intergenic
932938497 2:76135046-76135068 CATTCTACTATAAAGACACATGG - Intergenic
933280125 2:80323708-80323730 CATGGTGCTAAAAATACATATGG - Intronic
933366200 2:81357431-81357453 CATGCTACTATAAAGACACATGG - Intergenic
934063249 2:88316496-88316518 CACTCTACTATAAAGACACATGG - Intergenic
934866560 2:97819235-97819257 CATGCTGCTATCCAGAGAGAGGG + Intronic
935027394 2:99290312-99290334 GTTGCTGCTACAAAGTCACATGG - Intronic
936842609 2:116791044-116791066 AATGCAGCCATAAAGCCACAAGG + Intergenic
937412827 2:121691212-121691234 CATTCTACTATAAAGACACATGG - Intergenic
937462895 2:122104538-122104560 GGTGTTGCTATAAAGACACCTGG - Intergenic
937900863 2:127018057-127018079 CATGCTACTATAAAGACAAGGGG + Intergenic
938114341 2:128593009-128593031 CATTCTACCATAAAGACACACGG + Intergenic
938484472 2:131690051-131690073 AGTGCTGCTATAAACATACATGG + Intergenic
939056066 2:137365915-137365937 CATGCTACTATAAAGACACATGG + Intronic
939298664 2:140304126-140304148 CATGCTGCTGTAAAGACACATGG - Intronic
939489654 2:142861750-142861772 CATGCTGCTATAAAGACACATGG - Intergenic
939809581 2:146814306-146814328 CATTCTACTATGAAGACACAAGG + Intergenic
939945981 2:148411314-148411336 CATTCTATCATAAAGACACACGG - Intronic
939971096 2:148662341-148662363 CATGCTGCTATAAAGACACATGG + Intronic
940104061 2:150077729-150077751 CATGCTACTACAAAGACACATGG - Intergenic
940435334 2:153646930-153646952 CATGCTGCTATAAAGACACATGG - Intergenic
940457618 2:153921148-153921170 CACTCTACCATAAAGACACATGG + Intronic
941080641 2:161056912-161056934 CATTCTATTATAAAGATACATGG - Intergenic
941539831 2:166768373-166768395 CATTCTATCATAAAGACACATGG - Intergenic
941700549 2:168600020-168600042 AATGCTGCTATAACAACCCAAGG - Intronic
941707750 2:168677795-168677817 CATTCCACTATAAAGACACATGG - Intronic
943146403 2:184051260-184051282 AAGCCTGCTATAAAGAAACAGGG + Intergenic
943898676 2:193403221-193403243 CATTCTACTGTAAAGACACATGG + Intergenic
943925090 2:193766204-193766226 CATGCTGCTATAAAGACACATGG - Intergenic
944135390 2:196393827-196393849 CATGCTGCTATAAAGACACATGG + Intronic
944299302 2:198104507-198104529 CCTTCTACCATAAAGACACATGG - Intronic
944774323 2:202947150-202947172 CATTCTTCTATAAAGACACATGG + Intronic
944924151 2:204446326-204446348 CATTCTACTATAAAGACACATGG - Intergenic
945038825 2:205727533-205727555 GATGCTGCTTTAAAGAAACAAGG - Intronic
945410352 2:209499508-209499530 GGTGTTGCTATAAAGATACATGG - Intronic
945599116 2:211836219-211836241 CATTCAGATATATAGACACACGG + Intronic
948498569 2:238372598-238372620 CATTCTGCTATAAAGACACATGG - Intronic
948504526 2:238419345-238419367 AATGCTGCTATAAATAGATATGG + Intergenic
1169391188 20:5192507-5192529 CATTGTGCTATATGGACACAAGG - Exonic
1170979020 20:21193529-21193551 CATGCTGCTATAAAGACACATGG + Intronic
1171170135 20:23008412-23008434 CATGTGGCAATAAAGTCACAGGG + Intergenic
1172093484 20:32449346-32449368 TATGCTGCTATGAAGAGAGATGG + Intronic
1173712127 20:45168014-45168036 CATGCGGCTATAAAGACACATGG + Intergenic
1174594317 20:51671306-51671328 CATGTTTTTATAAAGATACAAGG - Intronic
1176916738 21:14634856-14634878 CATTCTGTTATAAAGATACATGG + Intronic
1177289089 21:19086830-19086852 CTTGCTGCTATAAAAACTCTTGG + Intergenic
1177346927 21:19885355-19885377 CCTTCTATTATAAAGACACATGG + Intergenic
1177351222 21:19944368-19944390 CATTCTATTATAAAGACACATGG - Intergenic
1177541502 21:22499150-22499172 CATTCTACTGTAAAGACACATGG + Intergenic
1179335871 21:40452986-40453008 CCTGCTGCTAGACAGAAACATGG + Intronic
1181027450 22:20134158-20134180 CATCCTGCTACAGGGACACATGG - Intronic
1181361066 22:22336426-22336448 CATTCTACCATAAAGACACATGG + Intergenic
1183160272 22:36108650-36108672 CATGTTGCTGCAAAAACACATGG + Intergenic
950439007 3:12997001-12997023 CATGCTAATATAAAAATACAAGG + Intronic
950471215 3:13187696-13187718 CATGCTGCTATAAAAATACCAGG + Intergenic
951092248 3:18587846-18587868 CATTCAGATGTAAAGACACAGGG - Intergenic
952549315 3:34457785-34457807 CATGCTTCTATAAAAACACTGGG - Intergenic
952661420 3:35853904-35853926 CATCCTATTATAAAGATACATGG - Intergenic
952813492 3:37425823-37425845 CATGCTACTATAAAGACACATGG - Intronic
954496972 3:50973605-50973627 CATGCTGCTATAAAGACACATGG - Intronic
954513329 3:51147807-51147829 CATGCTACTATTAAGACACATGG - Intronic
954757905 3:52851981-52852003 CAGGCTGCTATGAGGACAAAGGG + Intronic
955024359 3:55153148-55153170 CAGGATGCCATAAAGACAGAAGG + Intergenic
956331136 3:68110444-68110466 CATTCTATTATAAAGATACATGG - Intronic
956460408 3:69465858-69465880 CATGCTCCTATAAAGACACATGG - Intronic
956544154 3:70381010-70381032 CATGCTGCTATAAAGACACATGG - Intergenic
956555862 3:70521704-70521726 TTTGCTGATATAAGGACACAGGG + Intergenic
956940637 3:74157427-74157449 CATGCTGCTATAAAGACACATGG - Intergenic
957079155 3:75622487-75622509 AGTGCTGCTATGAAGAGACAAGG + Intergenic
957548206 3:81667894-81667916 CATTCTACTCTAAAGACACATGG + Intronic
957798054 3:85037556-85037578 CATGCTGCTGTAAAGATAGAAGG - Intronic
957924380 3:86789774-86789796 AAAGTTGCTATGAAGACACAGGG - Intergenic
958060285 3:88471035-88471057 CATTCTACTATAAAGACACATGG + Intergenic
958077502 3:88701247-88701269 CATTCTATTATAAAGTCACATGG + Intergenic
958102925 3:89036628-89036650 CATGCTGCTATAAAGACACATGG + Intergenic
958455629 3:94327482-94327504 CATTCTACTATAAAGACACATGG - Intergenic
959274856 3:104265703-104265725 TGTGCTGCTATAAACACACATGG + Intergenic
959446956 3:106452224-106452246 CATGCTGCTAGGAAGTGACAGGG + Intergenic
962552704 3:136511320-136511342 CATTCTATCATAAAGACACATGG + Intronic
962656483 3:137549301-137549323 CATGCTACTAGAAAGACACATGG + Intergenic
963075048 3:141338321-141338343 CGTTCTGCTGTAAAGACACATGG + Intronic
963450879 3:145480697-145480719 TATGCAGCCAAAAAGACACATGG + Intergenic
963452063 3:145494373-145494395 TATGCAGCCAAAAAGACACATGG + Intergenic
964242377 3:154611558-154611580 CATTCTACTGTAAAGACACATGG - Intergenic
964438659 3:156680032-156680054 TAAGTTGCTAAAAAGACACATGG - Intronic
964653099 3:159033815-159033837 CATTCGACTATAAAGACACATGG - Intronic
964842596 3:161010490-161010512 CATGCTGCTATAAAGACACATGG - Intronic
964968408 3:162527514-162527536 CATTCTACTATAAAAATACATGG - Intergenic
965262060 3:166499763-166499785 CATCCTACCATAAAGACACATGG - Intergenic
965349288 3:167594132-167594154 AGTGCTGCTATAAAGATACCTGG + Intronic
965457338 3:168919124-168919146 CATTCTACCGTAAAGACACATGG + Intergenic
965506990 3:169527346-169527368 CATGCTGCTATAGTGATACATGG - Intronic
966134239 3:176680505-176680527 CATTCTACTATGAAGACATATGG + Intergenic
966501499 3:180646617-180646639 CATGGTGTTTTAAAGACAAAGGG + Intronic
966563543 3:181350282-181350304 GATGCAGCTATAAATTCACACGG + Intergenic
966742278 3:183244933-183244955 CATGGTGTTATAAAAACACAGGG + Intronic
967264673 3:187679919-187679941 CATGCTGCTGTAAAGTGCCAGGG + Intergenic
967564302 3:190955841-190955863 CATGCTGCTATAAAGACACACGG + Intergenic
967607529 3:191465575-191465597 CATGCTGCTATAAAGACACACGG - Intergenic
968267569 3:197374273-197374295 CATGCAGATAAAAAGACTCAAGG - Intergenic
969064202 4:4465269-4465291 CATTCTATTATAAAGACACATGG + Intronic
969642610 4:8408040-8408062 AAAGCTGCTTTAGAGACACATGG + Intronic
969699325 4:8758038-8758060 TATGCTGCTATAAACATACATGG - Intergenic
969731631 4:8960951-8960973 AGTGCTGCTATGAAGAGACAAGG - Intergenic
969791225 4:9495058-9495080 AGTGCTGCTATGAAGAGACAAGG - Intergenic
969988957 4:11240771-11240793 CATGCTGCTATAAAGACACATGG + Intergenic
970754297 4:19405760-19405782 CATTCTTCCAAAAAGACACATGG + Intergenic
970895915 4:21104051-21104073 CATGCTGCTATAAAGAGACAAGG - Intronic
971768819 4:30869750-30869772 CATTCTACTATAAAGACACGTGG - Intronic
971845106 4:31908339-31908361 CACTCTGCTATAAAGACATATGG + Intergenic
973231734 4:47846585-47846607 CATGCTGCTATAAAGACACATGG + Intergenic
976199956 4:82568049-82568071 CATTCTACCATAAAAACACATGG - Intergenic
976446098 4:85130722-85130744 CATTCTACCAAAAAGACACATGG - Intergenic
976501275 4:85792401-85792423 CAAACTGCTTTAAAGAAACATGG + Intronic
977656265 4:99524290-99524312 GATGATGATATAAAAACACACGG - Intronic
977677695 4:99765901-99765923 CATGCTGCTATAAAGACACATGG - Intergenic
978237981 4:106483111-106483133 TATTCTACCATAAAGACACATGG - Intergenic
978558145 4:110003131-110003153 CATTCTACCATAAAGACACATGG - Intronic
979075717 4:116266876-116266898 CATTCTACCAAAAAGACACATGG + Intergenic
979746290 4:124217655-124217677 CATGCTGCTATAAAGACACATGG + Intergenic
980009794 4:127581957-127581979 CATGGTGGTATAGAGCCACATGG - Intergenic
980273935 4:130623448-130623470 CATTCTATTATAAAGACACATGG - Intergenic
980673470 4:136042464-136042486 CATTCTATTATAAAGACACATGG - Intergenic
980894510 4:138849208-138849230 CATGCTACTATAAAGACACATGG - Intergenic
981385358 4:144123966-144123988 CATGCTGCTATAAAGACACATGG - Intronic
981500202 4:145442067-145442089 CATTCTGTTATAAAGACACGCGG + Intergenic
981630235 4:146809937-146809959 CATTCTACCATAAAGACACATGG + Intronic
981771743 4:148318342-148318364 CATGCTGCTATAAAGACACATGG - Intronic
981834258 4:149036846-149036868 CATTGTACCATAAAGACACATGG - Intergenic
982747193 4:159116583-159116605 AATTCTGTTATAAAGATACATGG + Intronic
982797230 4:159660977-159660999 CATTCTACCATAAAGAAACATGG - Intergenic
982871368 4:160582783-160582805 CATGCTGCTATAAAGACACATGG - Intergenic
984942690 4:184947943-184947965 CACACTGCTATAAAGATACTAGG - Intergenic
985202170 4:187494869-187494891 CACACTGGTATAAAGAAACAGGG - Intergenic
985736936 5:1588730-1588752 AGTGCTGCGATAAATACACAAGG - Intergenic
985810454 5:2079618-2079640 CACACTGCTATAAAGAGACTGGG - Intergenic
986353066 5:6898304-6898326 CATTCTACCATAAAGACACATGG + Intergenic
986479414 5:8170711-8170733 CATTCTATTATAAAGACACATGG + Intergenic
987128454 5:14837798-14837820 CATGCTGCTATAAAGACACATGG + Intronic
987492185 5:18595165-18595187 CGCACTGCTATAAAGAAACAGGG + Intergenic
988152595 5:27405405-27405427 CATGCTGCTGTAAAGACACATGG + Intergenic
988337377 5:29923650-29923672 TATTCTACTATAAAAACACATGG + Intergenic
988347486 5:30057024-30057046 CATTCTACTGTAGAGACACATGG + Intergenic
989013489 5:36901413-36901435 CATTCTACCATAAAGACACATGG - Intronic
989026936 5:37078517-37078539 CATTCTATTATAAAGATACATGG - Intergenic
989273627 5:39560924-39560946 AATGCTGCCATGAAGACATATGG + Intergenic
989971842 5:50534505-50534527 CATGCGGCTATAAAGACACATGG + Intergenic
990934161 5:61129316-61129338 CATGCTACTATAAAGACACATGG + Intronic
990936364 5:61154534-61154556 CATGCTACTATAAAGACACATGG - Intergenic
992361809 5:76046308-76046330 TATGCTAAAATAAAGACACAAGG + Intergenic
992424027 5:76637133-76637155 CATGCTTGTATAAAGAATCATGG + Exonic
992697739 5:79307195-79307217 AAAGCTGCTATAAACACCCATGG + Intronic
992772679 5:80063001-80063023 CATGCTGCTATAAAGACACATGG - Intronic
992824209 5:80531911-80531933 CATGCAGCTATAAAGACATATGG + Intronic
994161407 5:96560876-96560898 CATGCTGCTATAAAGACACATGG + Intronic
994536696 5:101040029-101040051 CATTCTATTATAAAGACCCATGG + Intergenic
994583384 5:101675961-101675983 CATGCTGCTATAAACAAACTGGG - Intergenic
994652937 5:102552030-102552052 CATTCTACTATAAAGACACATGG - Intergenic
995375966 5:111474853-111474875 CAAGCTTTTCTAAAGACACAAGG - Intronic
995560873 5:113380465-113380487 CATGCTACTTTAGGGACACAGGG - Intronic
995630306 5:114125774-114125796 GAAGATGCTGTAAAGACACAGGG - Intergenic
997171298 5:131724176-131724198 CATTCTAGTATAAAGACACATGG - Intronic
997442386 5:133918028-133918050 GATTTTGCTATAAAGCCACACGG + Intergenic
997917992 5:137948341-137948363 CATACAGCTATTAAGACACAAGG + Intronic
998041503 5:138953563-138953585 CAGGCTGCTCTGCAGACACAGGG - Intronic
998661548 5:144244222-144244244 CATGCTTCTATAAAAAGAGATGG + Intronic
999078672 5:148822766-148822788 CATTCTACTATAAAGACACATGG - Intergenic
999906292 5:156144204-156144226 CATGCTGCTATAAAGACACATGG - Intronic
999958712 5:156730691-156730713 TATTCTATTATAAAGACACATGG - Intronic
1000944485 5:167403871-167403893 CATCATGCTATAAAGAAACTTGG - Intronic
1202775903 5_GL000208v1_random:70812-70834 CATGCTGCTATAAAGACACATGG + Intergenic
1003470800 6:6429741-6429763 CATGCTTCTGTAAAGACACATGG + Intergenic
1003529531 6:6926468-6926490 CCTGCTGCAATAGAGAAACAAGG + Intergenic
1003967508 6:11267028-11267050 CATGGTGCTATAAAAACTCTTGG - Intronic
1004537726 6:16518934-16518956 AATGCAGATATAAAGTCACAAGG - Intronic
1005777775 6:29155485-29155507 CATGCTATTATAAAGACACATGG - Intergenic
1006005060 6:30995053-30995075 CATTCTGTTATAAAAGCACATGG - Intergenic
1006489566 6:34375432-34375454 CATGCTGCTTTATACACAGAAGG + Intronic
1009285891 6:61816517-61816539 CGTGCTCCTTTTAAGACACAGGG - Intronic
1009771914 6:68154193-68154215 CATTCTACTACAAAGACACATGG - Intergenic
1009866075 6:69399402-69399424 CATCCTGCTATATAAACACATGG - Intergenic
1010558395 6:77315143-77315165 CATGTGGTTATAAAGACACATGG - Intergenic
1010901279 6:81431312-81431334 CATGCTGCTATAAAGACGTATGG - Intergenic
1011021309 6:82816283-82816305 CATTCTACTATAAAGACACATGG + Intergenic
1011105180 6:83771760-83771782 CATTCTACCATAAAGACACATGG - Intergenic
1011250744 6:85369472-85369494 CCTGCTGCTATAAAGACACATGG - Intergenic
1011282970 6:85695264-85695286 CATGCTGCTATAAAGACACATGG - Intergenic
1011302326 6:85889383-85889405 TATTCTACTATAAAGACACATGG - Intergenic
1011405810 6:87014480-87014502 TATTCTACTCTAAAGACACATGG + Intronic
1011761230 6:90567737-90567759 CATGCTGCTATAAAGACACATGG + Intronic
1012882317 6:104805378-104805400 CATGCTACTATAAAGACACATGG + Intronic
1013995368 6:116302102-116302124 CATTCTACTATAAAGACACATGG - Intronic
1014141248 6:117945728-117945750 AATCCTGCTGTGAAGACACATGG - Intronic
1014422827 6:121266586-121266608 CATTCTATTATAAAGATACATGG + Intronic
1015005287 6:128272883-128272905 CATGCTGCTATAAAGACACACGG + Intronic
1015491560 6:133832529-133832551 CATTCTATTATAAAGACACGTGG + Intergenic
1015967208 6:138706389-138706411 CATGCTACCATAAAGACACATGG - Intergenic
1016265473 6:142228003-142228025 CATTCTATTATAAAGATACATGG - Intergenic
1017355163 6:153496399-153496421 CAAGCAGCTATAAAGAAACAAGG + Intergenic
1017369158 6:153684154-153684176 CATTCTACCATAAAGAAACATGG + Intergenic
1018877768 6:167840629-167840651 CATGATGCTATGAAAACACATGG - Intronic
1019683184 7:2364531-2364553 TAAGCTGCTAGAAAAACACAGGG + Intronic
1020001708 7:4759727-4759749 CATGCTGATTTAAAGGGACAAGG - Intronic
1020309665 7:6858484-6858506 AGTGCTGCTATGAAGAGACAAGG + Intergenic
1020592282 7:10155640-10155662 CAGACTGAAATAAAGACACAGGG + Intergenic
1020833545 7:13121287-13121309 CGTGCTACTATAAAGACATATGG - Intergenic
1020847525 7:13306283-13306305 CATTCTACCGTAAAGACACATGG + Intergenic
1021008388 7:15429477-15429499 AATGCTCCTATAAAGACACTAGG - Intronic
1021173003 7:17418286-17418308 CATGCTGCTATATAGGCTGATGG + Intergenic
1021427311 7:20516433-20516455 CATGCTACTATAAAGACACATGG + Intergenic
1021760051 7:23894726-23894748 AATGCTGATCTAAAGCCACAGGG - Intergenic
1021780432 7:24100664-24100686 CATGCTGCTATAAAGACACATGG - Intergenic
1022039249 7:26564504-26564526 CTTTCTACTATAAAGGCACATGG + Intergenic
1023294073 7:38697062-38697084 AATGCTGCAATAAAGATACAGGG - Intergenic
1024188264 7:46977045-46977067 CAAGCTAATATAAAGACACCTGG + Intergenic
1024493582 7:50016086-50016108 CATTCTGCTATAAAGACACATGG + Intronic
1024938432 7:54737038-54737060 TATGCTACTATAAAGACACATGG + Intergenic
1024969769 7:55058093-55058115 CATTCTATTATAAAAACACATGG + Intronic
1026432275 7:70359052-70359074 CATACTGCTAACCAGACACAAGG + Intronic
1026568233 7:71507663-71507685 CATGCTGCATTAAAGGGACACGG - Intronic
1027575752 7:79928941-79928963 CATTCTATTATAAAGACACATGG - Intergenic
1027843862 7:83347262-83347284 CATTCTACTATAAAGACACATGG + Intergenic
1028423860 7:90664463-90664485 CATGCTGCCATAAAGACACATGG + Intronic
1028723576 7:94061218-94061240 CATCCTGATATAAAGGAACAAGG + Intergenic
1029341699 7:99950334-99950356 CATTCTACCATAAAGACACATGG + Intergenic
1029888761 7:103904322-103904344 CATTCTACTATGAAGACACATGG - Intronic
1030462525 7:109858344-109858366 CATGCTCCTACAAAGACACATGG + Intergenic
1030584127 7:111396156-111396178 CATTTTACTATAAAGACACATGG + Intronic
1030700002 7:112627744-112627766 CATTCTACCATAAAGACACATGG - Intergenic
1030702406 7:112655914-112655936 CATTCTGTCATAAAGACACATGG - Intergenic
1031103843 7:117514625-117514647 CATTCTACTATAAAGACACATGG - Intronic
1031668688 7:124517437-124517459 GATACTGCTATAAAGATACCTGG + Intergenic
1032648851 7:133856086-133856108 CATGCTCTTTTAATGACACAGGG - Intronic
1034057982 7:148056577-148056599 CATGTTGCAACAAAGACAGATGG - Intronic
1034746164 7:153525600-153525622 CATGCTGCCAGGAAGGCACACGG - Intergenic
1035763977 8:2090936-2090958 CATTCTACCATAAAGACATATGG - Intronic
1037849942 8:22319228-22319250 CATTATTCTATAAAGAGACAAGG - Intronic
1038396809 8:27252277-27252299 CATGCTGCTATAAAGACACATGG - Intronic
1038973241 8:32661564-32661586 CATGCAGCTAGTAAGAAACACGG + Intronic
1039134361 8:34303236-34303258 TATTCTACTATAAAGACACATGG + Intergenic
1040374381 8:46809901-46809923 CATGCTGATATAAAATCAGAAGG + Intergenic
1040591246 8:48794373-48794395 CATGCTGCTATAAAGACACATGG - Intergenic
1040832285 8:51690636-51690658 CATACTGCTATAACGACACATGG - Intronic
1041823729 8:62068092-62068114 GGTGCTGCTATAAAGATACATGG + Intergenic
1042300956 8:67280419-67280441 AATGCTGCAATAAACACAGAAGG + Intronic
1043311985 8:78872038-78872060 CATTCTACTATAAAGTCACATGG - Intergenic
1044168752 8:89022759-89022781 CATGCTGCTGTAAAGACACATGG - Intergenic
1044185719 8:89249197-89249219 CATGTTGCTGTAAGGAGACATGG + Intergenic
1044483542 8:92722399-92722421 CATTCTACCATAAAGATACATGG + Intergenic
1044751151 8:95416813-95416835 CATGCTCCTACATAGCCACAAGG + Intergenic
1044787572 8:95810677-95810699 AATGCTGCTATAAAAAGACAAGG + Intergenic
1044960255 8:97523495-97523517 CATGCTGCTATAAAGACACATGG - Intergenic
1045878030 8:107005388-107005410 AATTCTACTATAAAGACACATGG + Intergenic
1045882715 8:107060160-107060182 CATTCTACTATAAAAACATATGG - Intergenic
1046103539 8:109641978-109642000 CATTCCACTATAAAGACACATGG + Intronic
1046333191 8:112748807-112748829 CATTCTAATATAAATACACATGG - Intronic
1046391495 8:113578455-113578477 CATGCTGCTTTAATGAAACAAGG - Intergenic
1046557741 8:115796449-115796471 CATGCTGCTATAAAGACACATGG - Intronic
1047692811 8:127373547-127373569 CATTCTACTTTAAAGACACATGG - Intergenic
1049072392 8:140366236-140366258 CATTCTATTATAAAGACACATGG - Intronic
1050942677 9:11480220-11480242 AATTATTCTATAAAGACACATGG - Intergenic
1051373363 9:16378225-16378247 CATTCTACTATAAAGACCCATGG - Intergenic
1051514076 9:17908787-17908809 CATGCTGCTATAAAGACACATGG - Intergenic
1052257817 9:26479902-26479924 CATGCTACTGTAAAGACACATGG - Intergenic
1053522423 9:38793474-38793496 CATTCTACTATAAAGACACATGG - Intergenic
1053754883 9:41295850-41295872 CATACTGCTATCAAGAAATAGGG - Intergenic
1054194652 9:62017897-62017919 CATTCTACTATAAAGACACATGG - Intergenic
1054260407 9:62860146-62860168 CATACTGCTATCAAGAAATAGGG - Intergenic
1054331363 9:63759843-63759865 CATACTGCTATCAAGAAATAGGG + Intergenic
1054643756 9:67570793-67570815 CATTCTACTATAAAGACACATGG + Intergenic
1055069048 9:72148084-72148106 ATTGCTGCTTTTAAGACACAGGG - Intronic
1055294330 9:74818746-74818768 CATGCTGCTAATTAGAAACATGG + Intronic
1056296169 9:85195294-85195316 CATGCTGCTATAAAGACACATGG - Intergenic
1058570400 9:106336040-106336062 CATGCTACTATAAAGACGCATGG - Intergenic
1060850200 9:126868743-126868765 GATGCTGCCAAGAAGACACAGGG - Intronic
1061499826 9:130995443-130995465 TATGCTGCAATACAGACAGATGG + Intergenic
1202798742 9_KI270719v1_random:152767-152789 CATACTGCTATCAAGAAATAGGG + Intergenic
1186119412 X:6343287-6343309 CAAGCTACTATGAAGACACTGGG - Intergenic
1186704727 X:12129118-12129140 GGTGCTGCTATAAAGATACCTGG - Intergenic
1188155275 X:26734128-26734150 CATTCTACCATAAAGGCACATGG - Intergenic
1188542905 X:31269552-31269574 TATGCTGCCATGAAGAGACATGG + Intronic
1188670084 X:32871467-32871489 CGTGCTACTATAAAAATACAAGG + Intronic
1188975844 X:36674605-36674627 CATTCTACCATAAAGAGACATGG - Intergenic
1190504296 X:51111260-51111282 CATGCTGCTATAAAGACACATGG - Intergenic
1190933174 X:54967995-54968017 CATGCTGCTATAAAGACACATGG + Intronic
1190933439 X:54970803-54970825 CATGCTGCTATAAAGACACATGG - Intronic
1191018585 X:55836560-55836582 TATTCTACCATAAAGACACATGG - Intergenic
1191039019 X:56058818-56058840 CATTCTACTGTAAAGACACACGG - Intergenic
1191091672 X:56630043-56630065 TCATCTGCTATAAAGACACATGG - Intergenic
1191218303 X:57956285-57956307 CATGCTGCTATAAAGACACGTGG + Intergenic
1191647491 X:63497763-63497785 CATGCTGCTATAAAGACACATGG + Intergenic
1191888000 X:65909054-65909076 CATGCTGAAATGAAGACACTAGG - Intergenic
1191911476 X:66156168-66156190 CATGCTGTTACATGGACACATGG - Intergenic
1192707857 X:73546118-73546140 CATTCTACTATAAAGACACATGG + Intergenic
1192911837 X:75612879-75612901 CATTCTACTGTAAAGACACATGG - Intergenic
1193047914 X:77071696-77071718 CATTCTACTATAAAGACACATGG - Intergenic
1193200950 X:78689935-78689957 CTTTCTACCATAAAGACACATGG - Intergenic
1193476664 X:81974446-81974468 CATTCTACTATAAAGACACATGG + Intergenic
1193572964 X:83166586-83166608 AGTGCTGCTATAAAGACATCTGG + Intergenic
1193612454 X:83649187-83649209 CATGCTGCTATAAAGACGCATGG - Intergenic
1193628015 X:83843593-83843615 CATGCTGCTATAAAGACACATGG + Intergenic
1193664227 X:84296442-84296464 CAGTCTGTTATAAAGATACATGG - Intergenic
1193687720 X:84598624-84598646 TATTCTACTGTAAAGACACATGG + Intergenic
1193800895 X:85934750-85934772 CATGCTGCTATAAAGACACATGG - Intronic
1193989674 X:88290853-88290875 CATGCTGCTATAAACATGCATGG - Intergenic
1194110640 X:89829359-89829381 CATTCTGTTATAAAGAAACATGG + Intergenic
1194224362 X:91237478-91237500 CATTCTGCTATTAATACAAAGGG - Intergenic
1194628124 X:96249806-96249828 CATGCTGCTATAAAGACACGTGG + Intergenic
1194636029 X:96345837-96345859 CATGCTTCTATAAAGGCACATGG - Intergenic
1195209228 X:102636022-102636044 CATTCTACTGTAAAGTCACATGG + Intergenic
1195456939 X:105079667-105079689 CATTCTACTATAAAGACACATGG - Intronic
1195578807 X:106478971-106478993 CATGCTGCTATAAAGACACATGG + Intergenic
1195883552 X:109617767-109617789 AATGCTGCTAAATAGTCACAAGG + Intergenic
1195918163 X:109956207-109956229 CATGATGGTATTAAGAGACAGGG - Intergenic
1196521857 X:116683181-116683203 CATTCTTTTATAAAGACATATGG - Intergenic
1197139360 X:123098779-123098801 CATTATACCATAAAGACACATGG + Intergenic
1197430585 X:126358429-126358451 CATTCTACTATAAAGACACAGGG + Intergenic
1197497609 X:127204209-127204231 CATGCTGCTATAAAGACACATGG + Intergenic
1197633490 X:128888924-128888946 CATGCTGCTATAAAGACTTGCGG + Intergenic
1198335292 X:135659987-135660009 CATGCTACTATAAAGACATATGG - Intergenic
1198879269 X:141261679-141261701 CATTCTACTATAAAAACACATGG - Intergenic
1198952688 X:142090215-142090237 AATGTTTCAATAAAGACACAAGG + Intergenic
1199330646 X:146554190-146554212 CATGGGGCCATATAGACACAGGG + Intergenic
1199511313 X:148626160-148626182 CATGCTGAACTAAAGAGACATGG + Intronic
1199642340 X:149874860-149874882 CATTCTATTATAAAGACACAAGG + Intergenic
1199842325 X:151662597-151662619 CATGCTGAAATAAATACAGATGG - Intronic
1199939014 X:152606290-152606312 CATGCTACTATAAAGACACATGG - Intergenic
1200463299 Y:3484101-3484123 CATTCTGTTATAAAGAAACATGG + Intergenic
1200560826 Y:4700841-4700863 CATTCTGCTATTAATACAAAGGG - Intergenic
1200693127 Y:6328921-6328943 CATGCTGCTATAAAGACACATGG - Intergenic
1200693757 Y:6336531-6336553 CATGCTGCTATAAAGACAGATGG + Intergenic
1201041520 Y:9838194-9838216 CATGCTGCTATAAAGACAGATGG - Intergenic
1201042145 Y:9845805-9845827 CATGCTGCTATAAAGACACATGG + Intergenic
1201547850 Y:15185380-15185402 CATTCTACGATAAAGACACATGG - Intergenic
1201893054 Y:18963484-18963506 AATTCTACTATAAAGACACATGG + Intergenic
1202041490 Y:20689948-20689970 CATGCTACTATAAAGACACATGG - Intergenic