ID: 1015007663

View in Genome Browser
Species Human (GRCh38)
Location 6:128303071-128303093
Sequence GTGAGTTTAGGGAAGGAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 534}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015007663_1015007670 18 Left 1015007663 6:128303071-128303093 CCGCCTTCCTTCCCTAAACTCAC 0: 1
1: 0
2: 3
3: 57
4: 534
Right 1015007670 6:128303112-128303134 TCCTATCAGTTACATCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015007663 Original CRISPR GTGAGTTTAGGGAAGGAAGG CGG (reversed) Intronic
901128788 1:6949209-6949231 GTGGGGTTAGGGCAGGAGGGTGG + Intronic
901267590 1:7923489-7923511 ATCACTCTAGGGAAGGAAGGAGG - Intronic
903598572 1:24516331-24516353 GTGCGTTGAGGTAAGAAAGGAGG + Intronic
904410602 1:30322537-30322559 GTGAGTGGGGGGGAGGAAGGGGG + Intergenic
904677672 1:32208244-32208266 ATGAGTATAGGGAAGGAGGAAGG + Exonic
904772029 1:32886120-32886142 GTGGGTATGGGGAAGGAAGCGGG + Intronic
905731032 1:40299743-40299765 GTGTGTTGAGGGGAGGAGGGAGG + Intergenic
905805534 1:40874285-40874307 GGGAGATTAGGAAAGGCAGGAGG + Intergenic
906517846 1:46449946-46449968 GTGACTTTGAGGAAGGAATGGGG + Intergenic
906905565 1:49887078-49887100 AGGAGTATAGGCAAGGAAGGTGG + Intronic
907076346 1:51582659-51582681 GTGAGTGTAGAGAAGGAGGGAGG - Intronic
908138454 1:61157305-61157327 GGGAGTGGAGGGAAGGAAAGAGG - Intronic
908408135 1:63835034-63835056 GTGACTTTAGGGGAGGATGGAGG - Intronic
909261728 1:73498686-73498708 CTGATTTTAGGGAGGGGAGGCGG - Intergenic
910131378 1:83911020-83911042 GTCTGGTTAGGGAAGGAAGTGGG + Intronic
910310282 1:85815864-85815886 ATGACATTAGGGAAGGAAAGCGG + Intronic
910869497 1:91819736-91819758 GTGGATTTAGGGGAGGGAGGGGG - Intronic
911186255 1:94908025-94908047 GCGTGTTTAAGAAAGGAAGGTGG - Intronic
911358701 1:96850716-96850738 GTGAGACTTGGGAAGGATGGCGG + Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
912320464 1:108707904-108707926 ATGAGCTTAGTGAAGGAGGGTGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
913389647 1:118296202-118296224 GTGTGTTGTGGGAGGGAAGGTGG - Intergenic
913583961 1:120254796-120254818 GGGAGGGGAGGGAAGGAAGGAGG + Intergenic
913624220 1:120643544-120643566 GGGAGGGGAGGGAAGGAAGGAGG - Intergenic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914565948 1:148866640-148866662 GGGAGGGGAGGGAAGGAAGGAGG + Intronic
915463006 1:156081040-156081062 CTGAGTGTAGGAATGGAAGGGGG - Intronic
915587097 1:156849714-156849736 GAGAGTCGAGGGAAGGATGGGGG - Intronic
915587439 1:156851865-156851887 GTGAGTGTAGGGAGGGTGGGGGG - Intronic
916570940 1:166027108-166027130 GTGAGTTTAGAGAAAGAATGTGG - Intergenic
917682975 1:177386487-177386509 GTGAGTTTTGAGAAGACAGGAGG - Intergenic
917835870 1:178941323-178941345 ATGGGTTTAGGGAAGGTAGGAGG - Intergenic
917923808 1:179772214-179772236 GTGAGCAGAGGAAAGGAAGGTGG - Intronic
918040388 1:180910844-180910866 GTGAGTTTCGGGGAGGGAAGAGG + Intergenic
918365928 1:183807561-183807583 GGGAGTTTAAGGCAGGATGGTGG + Intronic
918481813 1:184986184-184986206 CTGTGGTTAGGGAAGAAAGGAGG + Intergenic
918780615 1:188695230-188695252 GTGAGTTGAGGGTAGAAAGGGGG - Intergenic
919811742 1:201413009-201413031 GTGAGTCTAAGGAAGGGAAGGGG - Intronic
920351280 1:205339592-205339614 CTGAGCCAAGGGAAGGAAGGAGG + Intronic
920626842 1:207611065-207611087 GTGAGGGTAGGGAGGGGAGGTGG - Intronic
920816371 1:209336933-209336955 GTGGGTGGAGGGAGGGAAGGGGG + Intergenic
921946039 1:220886865-220886887 CGGAGTCTAGGGAAGAAAGGTGG + Intergenic
922548816 1:226478747-226478769 GTGATTTGATGGAAGGAAAGGGG + Intergenic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923341760 1:233013711-233013733 GGGAGCTTAGAGAAGAAAGGGGG - Intronic
923416057 1:233761446-233761468 GAGAGATCAAGGAAGGAAGGTGG + Intergenic
923561230 1:235043424-235043446 GTGAGATGTGGGAAGTAAGGAGG - Intergenic
1063740773 10:8816590-8816612 GTGAGTTCAGTGAGGGCAGGTGG + Intergenic
1064668002 10:17677256-17677278 GTGACTTTTGGAAAGGATGGTGG - Intronic
1065747730 10:28857462-28857484 GTGAGATCAAGGAGGGAAGGTGG - Intronic
1066200264 10:33137496-33137518 CTGGCTTGAGGGAAGGAAGGGGG - Intergenic
1066757124 10:38722459-38722481 GTGACGTTAGGAAAGGAAGTAGG - Intergenic
1068058061 10:52035309-52035331 TGGTGTGTAGGGAAGGAAGGGGG + Intronic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068465902 10:57391217-57391239 ATGAGCTTCTGGAAGGAAGGGGG - Intergenic
1068565361 10:58568757-58568779 CTGAGTTGAGGGAAGGCAAGGGG - Intronic
1068739831 10:60456458-60456480 GTGAGATCAGGGTAGGAGGGAGG - Intronic
1068775362 10:60862877-60862899 GAGAGAGGAGGGAAGGAAGGAGG - Intergenic
1068913240 10:62400938-62400960 GCCATTTTAGGGAGGGAAGGAGG - Intronic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1069886409 10:71626680-71626702 GAGAGGTGAGGGAAAGAAGGGGG + Intronic
1070118137 10:73549200-73549222 GTGACTTTAGGGAAGTCAAGAGG - Intronic
1071470693 10:85982102-85982124 GTGAGTCTGGGGAATGAAGTTGG + Intronic
1072333886 10:94380261-94380283 TTGAGGTTATGGAAGGAATGGGG - Intergenic
1072405986 10:95153367-95153389 GTGGGTTGGGGGAAGGAGGGAGG + Intergenic
1072687843 10:97549400-97549422 GGCAGTTTAGGAAAAGAAGGAGG - Intronic
1072756957 10:98027986-98028008 GTGAGTGTTGGGATGGAATGGGG + Intronic
1072959818 10:99919451-99919473 CTGATTTTTGGGGAGGAAGGTGG - Intronic
1073019848 10:100434044-100434066 GCCAGTTTAGGGTAGGAAAGAGG + Intergenic
1073594709 10:104788152-104788174 CTGAGTCTAGGTGAGGAAGGTGG + Intronic
1074389281 10:113043594-113043616 GGGAGTATGGGGAAGGAAGAAGG - Intronic
1075072437 10:119327846-119327868 GGGATTTTAGGGATGGAAGGTGG - Intronic
1075112927 10:119602575-119602597 GTGAAAATAGAGAAGGAAGGAGG + Intergenic
1075166663 10:120074079-120074101 GAGAATATAGGGAAGGAAGGTGG - Intergenic
1075564115 10:123491424-123491446 GTGAGCTGAGGGAGGGCAGGCGG - Intergenic
1076153472 10:128184163-128184185 GTGTGCTTAGGGGATGAAGGAGG + Intergenic
1077142450 11:1030550-1030572 GTGAGTCCAGGGAAGGGAGAGGG - Intronic
1078013413 11:7591899-7591921 GTGGGATGAGGGGAGGAAGGAGG + Intronic
1078087784 11:8244534-8244556 ATTAGTTTGGGGAAGAAAGGAGG + Intronic
1078765416 11:14292243-14292265 GGCAGATTAGGGAAGGGAGGAGG - Intronic
1079408776 11:20167202-20167224 GTCAGTGTAGGGAAGGGAGAGGG + Intergenic
1079812539 11:25013218-25013240 GTGAGTTGGGGGAGGGGAGGAGG + Intronic
1081567028 11:44266351-44266373 CTGAGTTTAGGGAGGGAGAGGGG + Intronic
1082856663 11:57814210-57814232 GTGAATGAAGGGAAGGAAGGAGG + Intronic
1082912117 11:58389465-58389487 ATTAGTTTAGGAAAGGTAGGTGG + Intergenic
1083016473 11:59459293-59459315 GTGAGTATAGAGGAAGAAGGAGG - Intergenic
1083176406 11:60952552-60952574 GTGGGGCTAGGGCAGGAAGGTGG + Intergenic
1083187140 11:61024276-61024298 GGGAGGGTAGGGAAGGAGGGAGG - Intergenic
1083397151 11:62399963-62399985 GAGAGTTCAGGGAAGGAGGTGGG - Intergenic
1084001811 11:66299735-66299757 GCTGGTTTAAGGAAGGAAGGTGG + Intergenic
1084546005 11:69815362-69815384 GTGAGTGGATGGGAGGAAGGAGG + Intronic
1085627085 11:78081804-78081826 GTAAGTTTAGAGAAAGGAGGAGG - Intergenic
1085793497 11:79516464-79516486 GGGAGTTTAGGCAAGGAATGAGG - Intergenic
1085908095 11:80788809-80788831 GTGAGGATATGGAAAGAAGGTGG - Intergenic
1086241267 11:84695091-84695113 GTGATTTTAAGCAAAGAAGGGGG - Intronic
1086686550 11:89740315-89740337 GTGTGTTTAGCAAAGGAAGTTGG - Intergenic
1087171974 11:95058410-95058432 GAGAGTTGAGGGAGGGAGGGAGG - Intergenic
1087207656 11:95414269-95414291 GATAGTTTAGGGAAGGGAGAGGG - Intergenic
1087779307 11:102286293-102286315 CTCACTTCAGGGAAGGAAGGTGG - Intergenic
1087815872 11:102658140-102658162 GGAAGTGTAGGGAAGAAAGGAGG + Intergenic
1088075049 11:105837577-105837599 GTGAGATTAGTACAGGAAGGGGG + Intronic
1088598735 11:111457727-111457749 GTGAGCTGTGGGAGGGAAGGAGG - Intronic
1088763238 11:112951677-112951699 GAGAGTTTTGTAAAGGAAGGAGG - Intergenic
1089221012 11:116871670-116871692 CTGAGTTAAGGAAAGGAAAGTGG + Intronic
1089362290 11:117899044-117899066 GTGTGTTTTGGGCAGGGAGGTGG - Intergenic
1091565315 12:1643884-1643906 TTGAATTCAGGGAAGGATGGAGG + Intronic
1091597192 12:1886051-1886073 GTGAGTTGAGGGGAGGTGGGGGG + Intronic
1091916202 12:4273088-4273110 GTGGGTATTAGGAAGGAAGGGGG - Intergenic
1092171350 12:6375636-6375658 GGGAGTTTTCCGAAGGAAGGAGG + Intronic
1092255672 12:6925780-6925802 CTGCCTTCAGGGAAGGAAGGAGG - Intronic
1093206660 12:16259425-16259447 GGGAAATAAGGGAAGGAAGGAGG - Intronic
1094039794 12:26110658-26110680 GAGAGTTTGGGGAGGGGAGGGGG + Intergenic
1094778821 12:33765593-33765615 GAGAGTGAAGGGAAGGAAGGTGG - Intergenic
1095223110 12:39642420-39642442 GTGGGTACAGGGAAGGGAGGAGG - Intronic
1095271771 12:40226883-40226905 CAGAGTCTAGGGAATGAAGGTGG - Intronic
1095713508 12:45315954-45315976 ATGAGTCCAGGGAAGAAAGGTGG - Intronic
1095810056 12:46364337-46364359 AAGAGTTTAGGGAAGAAAAGAGG - Intronic
1096096377 12:48938327-48938349 GTGAGATTAAGGGAAGAAGGTGG - Exonic
1096231637 12:49900114-49900136 GGGTGTGTAGGGAAGGGAGGAGG + Intronic
1096269239 12:50151128-50151150 GTGAGTTTGGGGAAGGCCAGAGG - Intronic
1096289654 12:50331029-50331051 AGGAGCTTTGGGAAGGAAGGGGG - Intronic
1096770909 12:53935448-53935470 GTGAGTTTAGGGATGGGTGCAGG - Intergenic
1097158158 12:57027505-57027527 GTGAGTTAAGGGAAGGAAGCGGG + Intronic
1097179511 12:57163157-57163179 GGGAGTTTAGGGAAGATGGGAGG + Intronic
1097927663 12:65147812-65147834 GTGAGTTTAGGGTAAGAAACAGG + Intergenic
1098348787 12:69534633-69534655 GTGAGCTGAGGGAAGGAATGTGG + Intronic
1098637319 12:72800537-72800559 GTGAGTATAGGGATGGAGGTTGG - Intergenic
1099131135 12:78833133-78833155 GTGAGTATAGGAAATGATGGTGG - Intergenic
1099140969 12:78974964-78974986 GTGAGTTTAGAGAAACACGGAGG - Intronic
1100125878 12:91424250-91424272 GTAAGTTTCGGGAGGGAATGTGG + Intergenic
1100184497 12:92124788-92124810 ATGAGTTTAGGGAAGGAAGCCGG - Intronic
1100381966 12:94070756-94070778 ATGAGATCAAGGAAGGAAGGAGG + Intergenic
1100591047 12:96029943-96029965 TGGAGTTTAAGGAAGGAAGGAGG - Intronic
1101406429 12:104433132-104433154 GTGTTTTTAGGGAAGGAAGGCGG - Intergenic
1101941748 12:109104443-109104465 GTGAGTGAAGGGAAAGAGGGAGG - Intronic
1101997820 12:109537615-109537637 GTGTGTTTTGGGGAGGCAGGTGG - Intergenic
1102561974 12:113768845-113768867 GTGATTTTAGTGAAGGGAAGAGG + Intergenic
1102769465 12:115462322-115462344 GTGGGTTTAGGGAAAGATTGGGG + Intergenic
1103325597 12:120117677-120117699 GTCAGTTTAGGTAGGGCAGGTGG - Intergenic
1103966043 12:124640265-124640287 GGGGGTTTGGGGAAGGAAAGAGG + Intergenic
1104225565 12:126829523-126829545 GTGAGTTTAGGGGATGGAGGAGG - Intergenic
1104273693 12:127305408-127305430 GTGAGGTCAGGGCAGGGAGGAGG + Intergenic
1104463183 12:128971301-128971323 GGGAGATGAAGGAAGGAAGGAGG - Intronic
1104545995 12:129713464-129713486 GTGTGTTTTGGGAAGGAGGAGGG + Intronic
1105891723 13:24686919-24686941 GTGAGAGCAGGGAAGGCAGGAGG + Intronic
1106451769 13:29888821-29888843 GTGAGTTATCAGAAGGAAGGAGG + Intergenic
1107237697 13:38192753-38192775 ATGAGGTCAGGGAAGGAGGGCGG - Intergenic
1107793502 13:44026624-44026646 GTGAGTTTAGGAAACAAAGATGG + Intergenic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1107834919 13:44405299-44405321 GGGAGAGTGGGGAAGGAAGGTGG - Intergenic
1110311700 13:74057384-74057406 GTGAGATTAGGGATGGGAGGAGG - Intronic
1111587311 13:90298724-90298746 CTGAGTTTGGGGAAGTGAGGAGG + Intergenic
1112435332 13:99387835-99387857 GTGAGTTTGGGTTAGAAAGGTGG + Intergenic
1112691700 13:101903620-101903642 GTGACTATAGGGAAGGAGGGAGG + Intronic
1112829317 13:103429157-103429179 GTGAGGTTTGGGGAGGAAGAAGG - Intergenic
1113030074 13:105983277-105983299 GTGACTCTTAGGAAGGAAGGAGG + Intergenic
1113600212 13:111563250-111563272 GTGAGGGGAGGGAAGGAAAGAGG - Intergenic
1113600236 13:111563325-111563347 GTGAGGGGAGGGAAGGAAAGAGG - Intergenic
1115012144 14:28561801-28561823 GGGAGTTTAGGGAAGAGGGGAGG + Intergenic
1116475094 14:45331009-45331031 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
1116610852 14:47070202-47070224 GTGGGATTGGGGGAGGAAGGTGG - Intronic
1118467777 14:66046373-66046395 GTGAAGAAAGGGAAGGAAGGAGG - Intergenic
1118992987 14:70812364-70812386 GTGTGTTCAGGAAAGGAGGGTGG + Intergenic
1119535826 14:75401718-75401740 GTGTGTCAAGGGAAGGAAGAGGG + Intergenic
1122325383 14:100878457-100878479 GGCAGTGCAGGGAAGGAAGGAGG + Intergenic
1124074499 15:26431888-26431910 GGGAGTTGGGGGAAGGAAGTGGG + Intergenic
1124329294 15:28795371-28795393 TAGAGTTTTGGGAGGGAAGGTGG + Intergenic
1125299945 15:38244718-38244740 GAGAGTTGAGGGCGGGAAGGCGG + Intergenic
1125907214 15:43404073-43404095 GTTAGTTCAAGGAAGTAAGGAGG - Exonic
1126257137 15:46641130-46641152 GTGAATTTAGAGAAGTCAGGAGG - Intergenic
1127761705 15:62146180-62146202 GTGAGGGTAGGGAAGGAGGGTGG - Intergenic
1129293799 15:74588384-74588406 GTGCCTTTAGGGAAAGAAGGCGG + Intronic
1129597154 15:76974035-76974057 GTGAGATTAGGGTAGGAGAGTGG + Intergenic
1129850349 15:78790160-78790182 CGGAGGTTAGGGGAGGAAGGTGG + Intronic
1129893629 15:79088630-79088652 GTGGGTTGAGGGATGGAGGGGGG + Intronic
1130145957 15:81273791-81273813 GTGGGTTGATGGAAGAAAGGTGG - Intronic
1130428669 15:83824386-83824408 GTGCGTTTAAGGAAGCAGGGGGG - Intronic
1131036636 15:89226852-89226874 GTGACTCTTGGGAAGGGAGGAGG - Intergenic
1131434499 15:92412265-92412287 ATGAGAGGAGGGAAGGAAGGGGG + Intronic
1131756317 15:95566695-95566717 GTGAGTAGAAGGAAGGAAGGTGG - Intergenic
1131888761 15:96949286-96949308 ATGTGTTTGGGGAAGGAATGTGG + Intergenic
1132346384 15:101111510-101111532 GTGAGCTGGGAGAAGGAAGGAGG - Intergenic
1133577661 16:7109458-7109480 GTGGATGTATGGAAGGAAGGTGG + Intronic
1134353424 16:13459367-13459389 ATGACTTGAGGGGAGGAAGGTGG - Intergenic
1134752288 16:16635595-16635617 GTGAGTGTAGAGCAGGAGGGAGG - Intergenic
1134811623 16:17172184-17172206 GAGAGAGGAGGGAAGGAAGGAGG - Intronic
1135486060 16:22865794-22865816 GAGAATTTAGGGAGGCAAGGTGG + Intronic
1135527955 16:23228349-23228371 GGGAGTTTAGGGAAGGCCGAGGG - Intergenic
1136124576 16:28168552-28168574 GGGGCTTTAGGGAAGGATGGGGG + Intronic
1136290667 16:29269498-29269520 GTGAGTTTGGGGACACAAGGCGG - Intergenic
1136720401 16:32315272-32315294 GTGAGGTTAGGAAAGGAAGTAGG + Intergenic
1136838778 16:33521546-33521568 GTGAGGTTAGGAAAGGAAGTAGG + Intergenic
1137533641 16:49300406-49300428 GGGACCATAGGGAAGGAAGGGGG - Intergenic
1138376745 16:56569504-56569526 GGGAGGTGAGGCAAGGAAGGAGG - Intergenic
1139186537 16:64812405-64812427 ATGAGTTTAGGTAAGGAAGTTGG + Intergenic
1140091613 16:71844096-71844118 GTTATTTTTGGGAAGGAAAGTGG - Intergenic
1140917703 16:79508632-79508654 GTCAGTATAGGGTAGGAAAGTGG - Intergenic
1141225411 16:82110437-82110459 GTGAGTTCTGGGAAGGGGGGTGG - Intergenic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1142346872 16:89559769-89559791 GTGAGGGTAGGGAAGAAAGAGGG + Intergenic
1203006031 16_KI270728v1_random:202497-202519 GTGAGGTTAGGAAAGGAAGTAGG - Intergenic
1203148943 16_KI270728v1_random:1821834-1821856 GTGAGGTTAGGAAAGGAAGTAGG + Intergenic
1143376507 17:6470574-6470596 GTGGGTTTTGAGAAGGAAGGAGG - Intronic
1144391448 17:14797356-14797378 GGGAGTGTGGGTAAGGAAGGTGG + Intergenic
1144674012 17:17150234-17150256 GTGAGTCCAGGGATGGAAGTGGG + Intronic
1146485772 17:33241402-33241424 GTGAGAGCAGAGAAGGAAGGGGG - Intronic
1146704745 17:34992800-34992822 AGAAGTTTAGGGAAGGAAGAGGG + Intronic
1147170232 17:38614214-38614236 ATGTGTGTAAGGAAGGAAGGGGG - Intergenic
1147816414 17:43213898-43213920 GTGAAGCTAGGGGAGGAAGGGGG - Intronic
1147891925 17:43723357-43723379 GGGAGTTCAGGGAATGAGGGTGG + Intergenic
1149338500 17:55662627-55662649 ATGGGTGAAGGGAAGGAAGGAGG - Intergenic
1149814809 17:59713250-59713272 GTGGGTTGGGGGAAGGAGGGAGG + Intronic
1149980659 17:61308633-61308655 GGTAGTTAAGGGAAGGCAGGAGG + Intronic
1150343453 17:64386939-64386961 GTGAACTTAGGGGAGGAGGGGGG + Intronic
1151329184 17:73396775-73396797 GTGAGATTCAGGAAGGAAGCAGG + Intronic
1152087663 17:78230612-78230634 GTGTGTTTAGGGGGGGAACGAGG + Intergenic
1152399873 17:80059393-80059415 GGGAGTGGAGGGAACGAAGGGGG + Intronic
1152497178 17:80681495-80681517 GGGAGTGTAGGGAAGGCCGGTGG + Intronic
1153225387 18:2895830-2895852 GTATGTTTGGGGAGGGAAGGGGG + Intronic
1154263160 18:12855474-12855496 GGGACTTTAGGGAAGGATAGGGG + Intronic
1154492099 18:14930336-14930358 GTGAGTTTCTGGGAGGAAGGTGG + Intergenic
1155267047 18:24104349-24104371 GTGCATTTAAGGAAGGAAGGAGG - Intronic
1156009825 18:32483789-32483811 GTGAGAGGAGGGAGGGAAGGGGG + Intergenic
1156425409 18:37005947-37005969 GTGAGTGGAGGGGAGGAGGGAGG + Intronic
1156763341 18:40620460-40620482 GTCAGTTTGGAGAATGAAGGAGG - Intergenic
1158024336 18:52878057-52878079 GGGAGTTTTGGGGAGGGAGGAGG - Intronic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1159684614 18:71402590-71402612 GTGAGGTTAAGGAGGGAAAGAGG - Intergenic
1161134173 19:2610009-2610031 GAGAGTTTAGGGGAGGGAGGGGG - Intronic
1161934597 19:7363896-7363918 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1161934631 19:7364105-7364127 GTGAGTGGAAGGAAGGAAGATGG + Intronic
1161934655 19:7364241-7364263 ATGGGTTGATGGAAGGAAGGAGG + Intronic
1162332296 19:10037737-10037759 GTGAGTCTGGGGAATGGAGGGGG + Intergenic
1163123356 19:15231482-15231504 GGAAGTTTAGAGCAGGAAGGAGG - Intronic
1163752167 19:19084375-19084397 GCGGGTTTGGGGAGGGAAGGTGG - Intronic
1164333216 19:24281123-24281145 GTGAGGTTAGGGTATGGAGGAGG + Intergenic
1164441097 19:28281621-28281643 GAGGGTGTGGGGAAGGAAGGCGG - Intergenic
1165254836 19:34570077-34570099 GTGATTTTAGGGAACAAGGGAGG + Intergenic
1165700463 19:37933309-37933331 GAGACTTGAGGGAAGGAGGGAGG - Intronic
1165746335 19:38232045-38232067 GTTAGCCAAGGGAAGGAAGGAGG - Intergenic
1166370201 19:42296047-42296069 GTGAGTTTGGGGAAGGCCTGAGG + Intergenic
1166414489 19:42583864-42583886 GTGAGTTTAGGCAAGGCTGATGG - Intronic
1166443654 19:42839175-42839197 AGGAGTTTAGTGGAGGAAGGAGG + Intronic
1166469494 19:43066397-43066419 AGGAGTTTAGTGGAGGAAGGAGG + Intronic
1166480625 19:43169935-43169957 AGGAGTTTAGTGGAGGAAGGAGG + Intronic
1166891538 19:45997026-45997048 GGGAGTTGAGGGGAGGGAGGAGG - Intronic
1166956310 19:46467845-46467867 GTGATTATAGGGAAGGACGCAGG - Exonic
1168108504 19:54179108-54179130 GTGCCTGTAGGGTAGGAAGGTGG + Intronic
1168500408 19:56888247-56888269 GGGAGTATAGAGAAGGAAAGGGG - Intergenic
925199191 2:1952732-1952754 GGGAGGGAAGGGAAGGAAGGAGG - Intronic
925466716 2:4112486-4112508 GGGAGTTCAGGAAAGGATGGAGG - Intergenic
926666098 2:15524926-15524948 GTGGGTTGAGGGAAGGAAACAGG - Intronic
926802507 2:16671479-16671501 GTGATAATAGGGAAGGAAAGTGG + Intergenic
926822870 2:16872418-16872440 GTGAGTTTGGGGGAGGCATGAGG + Intergenic
926918367 2:17915157-17915179 GAGAGTTTTGTGAAGAAAGGAGG + Intronic
927877811 2:26670501-26670523 GTGGGAGAAGGGAAGGAAGGAGG + Intergenic
928686722 2:33757562-33757584 GTGAGTATAAGAAAAGAAGGAGG - Intergenic
929116739 2:38451057-38451079 GAGAGCTTAGGGAAGGCAGGTGG + Intergenic
929351511 2:40961671-40961693 GTGAGTTTAGGGAATCAGAGAGG + Intergenic
929451993 2:42044112-42044134 GAGAGAGGAGGGAAGGAAGGAGG + Intergenic
929455054 2:42059585-42059607 GTGAGTTCAGCTAGGGAAGGAGG - Intergenic
929751442 2:44718195-44718217 GTTACTTTAGGCAAGGATGGTGG - Intronic
930086377 2:47500430-47500452 CTGAGTCGATGGAAGGAAGGAGG + Intronic
930441620 2:51415353-51415375 TTGAGTTTAGGGAGGGCAAGTGG - Intergenic
931578058 2:63741102-63741124 CTGCCTTTAGGGAAGGAAGCTGG + Intronic
932455946 2:71850216-71850238 GTCAGTGTATGGAAGTAAGGGGG - Intergenic
932689066 2:73897070-73897092 GTGAGGGTGGGGAAGGCAGGGGG - Exonic
932714160 2:74089622-74089644 ATGGGTTTACGGAAGTAAGGGGG - Intronic
932881206 2:75503767-75503789 GTGAGTGGAGGGTAGGAGGGAGG + Intronic
932882447 2:75516454-75516476 ATGAGTATGGGGCAGGAAGGAGG + Intronic
933309131 2:80638482-80638504 GTAAGTATAGGAAAAGAAGGTGG + Intronic
933521247 2:83377202-83377224 AGGAGTTAAGGGAAGGAAGGAGG - Intergenic
934018229 2:87913392-87913414 GTGGGGTTGGGGAAGGGAGGAGG + Intergenic
934320433 2:91966901-91966923 GTGACGTTAGGAAAGGAAGTAGG - Intergenic
935083489 2:99822345-99822367 GTGGGTTTGGGGTAGGGAGGTGG + Intronic
935467038 2:103411004-103411026 GTGAGTTCTTGGAAGAAAGGAGG - Intergenic
935698266 2:105788141-105788163 GTGAGAGTTGGGGAGGAAGGAGG + Intronic
936561611 2:113543418-113543440 GAGAGGGTTGGGAAGGAAGGAGG - Intergenic
936835391 2:116703594-116703616 GTGAGTAGAGGGAAGGGTGGAGG - Intergenic
936886490 2:117317306-117317328 GTGAATTTAGCAAAGGAAGCTGG - Intergenic
937815935 2:126251065-126251087 GTGAGCTTTGGGAAGTAGGGAGG - Intergenic
938772005 2:134508733-134508755 GAGAGTTGAGGGAAGAAATGAGG - Intronic
940667437 2:156625747-156625769 TTGAGTTCAAGGAAGGAAGTGGG - Intergenic
940677272 2:156739796-156739818 ATGAGATTAGGGATGGAATGAGG + Intergenic
941509294 2:166386007-166386029 GAGAGTTAAGGGAACGTAGGCGG + Intergenic
941689563 2:168485254-168485276 GTGAGTGTAGGGGAGTAATGTGG - Intronic
941763023 2:169265316-169265338 GTGAGCTTCAGGCAGGAAGGTGG - Intronic
941785872 2:169497484-169497506 GGCAGTTTAATGAAGGAAGGAGG + Intronic
942685524 2:178527055-178527077 CTGAGTTTAGGGAATGAATTTGG - Exonic
943639889 2:190346264-190346286 GTGAGTTTGGGAAATGCAGGTGG + Intronic
944128980 2:196325460-196325482 GTCAGTTTAGGGATGTGAGGTGG - Intronic
945058417 2:205887959-205887981 GGGAGTTGTGGGGAGGAAGGAGG + Intergenic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
945685602 2:212965779-212965801 GTGATTTTAGGGAAAGAATGAGG - Intergenic
946226412 2:218266269-218266291 GTGAGTTCAGAGCAGGAAGGAGG + Intronic
946311119 2:218883201-218883223 TTGACTTTTGGGAAGGATGGGGG + Intronic
946428359 2:219611861-219611883 ATGAGTTTGGGGAAGGGAAGGGG + Intronic
947331670 2:229035451-229035473 GTGAGTAGAGGGAAGGAGGGGGG - Intronic
947408469 2:229807639-229807661 GTGGGTGTAGGGATGGAATGGGG - Intronic
947489682 2:230582846-230582868 GTGTTTTTTGGGAGGGAAGGAGG - Intergenic
947897198 2:233686730-233686752 GTGAGGCTAGGGAAGGCAAGAGG - Intronic
947973068 2:234340615-234340637 GTGAGTTTAAGGAGAAAAGGAGG + Intergenic
948154699 2:235771716-235771738 GTGAGTTGGAAGAAGGAAGGAGG - Intronic
948330635 2:237161622-237161644 GGGAGCTTTAGGAAGGAAGGTGG + Intergenic
948487638 2:238290996-238291018 GTCAGATTGGAGAAGGAAGGGGG + Intergenic
948839019 2:240640340-240640362 GGTAGGTCAGGGAAGGAAGGAGG - Intergenic
948839062 2:240640486-240640508 GGTAGGTCAGGGAAGGAAGGAGG - Intergenic
948839077 2:240640536-240640558 GGTAGGTCAGGGAAGGAAGGAGG - Intergenic
948839107 2:240640640-240640662 GGTAGGTCAGGGAAGGAAGGAGG - Intergenic
948839121 2:240640686-240640708 GGTAGGTCAGGGAAGGAAGGAGG - Intergenic
948839179 2:240640874-240640896 GGTAGGTCAGGGAAGGAAGGAGG - Intergenic
948839210 2:240640974-240640996 GGTAGGTCAGGGAAGGAAGGAGG - Intergenic
1169265825 20:4166901-4166923 ATGATTTTAGGGAAGAAATGTGG + Intronic
1169595233 20:7190923-7190945 GTGAGTATAGGGATGGGAGATGG + Intergenic
1170188552 20:13620001-13620023 TAGAGTTTTGGGAGGGAAGGTGG - Intronic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1170956324 20:20983209-20983231 GTGATTCCAGGGAGGGAAGGTGG + Intergenic
1173266443 20:41487386-41487408 GTGAAATTAGTGAAGCAAGGAGG + Intronic
1174720779 20:52809787-52809809 GTGGGGTGAGGGAAGGAGGGAGG + Intergenic
1174783634 20:53412775-53412797 GTTTGTTTAGGGAAGGAGTGGGG - Intronic
1175024049 20:55882716-55882738 GTGATTTGAGGGAAGAAACGGGG + Intergenic
1175186125 20:57180558-57180580 GTTAATTTAGGACAGGAAGGAGG - Intronic
1175231902 20:57479226-57479248 GTGAAATTAGGGAAGAAAGGAGG - Intergenic
1175341196 20:58230525-58230547 GTAGGATAAGGGAAGGAAGGAGG - Intergenic
1175476816 20:59281715-59281737 GTGTGTTCGGGGTAGGAAGGAGG - Intergenic
1177748936 21:25256126-25256148 GTGAGCTTAGGGAAGAGGGGAGG + Intergenic
1177824847 21:26071232-26071254 GTGGGGTCAGGAAAGGAAGGCGG - Intronic
1179156807 21:38858120-38858142 GAGAGTACAGGAAAGGAAGGAGG + Intergenic
1179289417 21:40005788-40005810 GTGAGTTCAGGGAAAGTGGGTGG + Intergenic
1179440903 21:41393488-41393510 GGGAGTTTCAGGAAGGAGGGAGG - Intronic
1179793383 21:43768413-43768435 GGGAGAATAGGGAAGGAAGAAGG + Intergenic
1180308677 22:11150957-11150979 GTGATGTTAGGAAAGGAAGTAGG - Intergenic
1180547154 22:16512768-16512790 GTGATGTTAGGAAAGGAAGTAGG - Intergenic
1181906646 22:26202514-26202536 GAGAGTTTTGGGGAGGAAGCTGG - Intronic
1182123934 22:27802918-27802940 GTGTGTGTAGGGAAGGAGGGGGG + Intergenic
1183027719 22:35078495-35078517 GTGGACTTAGGGAGGGAAGGGGG + Intronic
1183383747 22:37503371-37503393 GGGAGTTTAGGGGAGCCAGGTGG - Intronic
1183483475 22:38077248-38077270 GGGAGTTTGCGGAGGGAAGGCGG + Intergenic
1184103368 22:42353396-42353418 TGGAGAGTAGGGAAGGAAGGAGG + Intergenic
1184878194 22:47288775-47288797 GTGAGTCTAGTGAAGGAGGCTGG + Intergenic
950046406 3:9951068-9951090 GGAAGATGAGGGAAGGAAGGCGG - Intronic
950156272 3:10723765-10723787 CTGAGTGTTGGGAAGGAGGGTGG + Intergenic
951420789 3:22482364-22482386 GTGAGCTGAGGGAAGGCAGGAGG - Intergenic
951483214 3:23183642-23183664 GTGAGATCAGGAAAGGAAGAAGG + Intergenic
951700966 3:25496480-25496502 ATGAGTATCGGCAAGGAAGGTGG + Intronic
953564650 3:44021432-44021454 TTGGGTATAGGGAGGGAAGGAGG - Intergenic
954460826 3:50625921-50625943 GTGGGGGTGGGGAAGGAAGGAGG + Intronic
954493187 3:50927225-50927247 GTCAGTGAGGGGAAGGAAGGAGG - Intronic
955021054 3:55121542-55121564 ATGAGTTTCAGAAAGGAAGGAGG + Intergenic
955763049 3:62309966-62309988 ATGAGTTTAGAGAAGTAAGCAGG + Intergenic
956176450 3:66477677-66477699 GTGAGATAAAGGAAGAAAGGTGG - Intronic
957039423 3:75325981-75326003 GTGAGTGAAGGGACAGAAGGTGG + Intergenic
957410692 3:79835859-79835881 GTCAGTATTGGGCAGGAAGGGGG - Intergenic
957989882 3:87614441-87614463 GTGTGGTTAGGGAAGGCAGGGGG + Intergenic
958680103 3:97318669-97318691 GTGAGTTCAGAGAATTAAGGAGG - Intronic
959142933 3:102507544-102507566 GGGAGTTAGGAGAAGGAAGGAGG + Intergenic
959145205 3:102535676-102535698 GAGAGAGTAGGGAAGGCAGGAGG - Intergenic
959151112 3:102609388-102609410 GGGAATTTAGAGAAGGAAAGTGG - Intergenic
959311695 3:104745955-104745977 GAGAGTAATGGGAAGGAAGGGGG + Intergenic
959378826 3:105617600-105617622 GTGGTTTGAGGGAAGGAGGGAGG - Intergenic
960087867 3:113609903-113609925 TTGCCTTTAGGGGAGGAAGGAGG - Intronic
960322049 3:116248702-116248724 GTGAGTCGGGGGAAGGAAAGGGG - Intronic
960644153 3:119860017-119860039 GAGAGTGTAGGGTAGGATGGGGG - Intronic
961175835 3:124834500-124834522 GGGAGAGGAGGGAAGGAAGGAGG + Intronic
961624664 3:128253636-128253658 GTGAGGAGAGGGAAGGAAAGAGG - Intronic
962060070 3:131916562-131916584 GTGTGTTTTGGGAAAGAAGAGGG + Intronic
962438141 3:135385134-135385156 GTAAGGATAGGGAAGGCAGGTGG + Intergenic
962480450 3:135793699-135793721 GTGAGAACAGGGAAGGAAGAAGG - Intergenic
962791382 3:138814620-138814642 TTGAGTGGAGGAAAGGAAGGTGG - Intronic
963285614 3:143431787-143431809 CTGAGTTTAGAGAAGTAAGAGGG - Intronic
964504579 3:157384791-157384813 GTAATATTAGGGCAGGAAGGGGG + Intronic
965111972 3:164436986-164437008 GTGATTTTAGGGAAGGATTAAGG + Intergenic
965519397 3:169658312-169658334 GTGAGTTTGGGGAAGAGATGGGG - Intronic
965628892 3:170710412-170710434 GTGAGTTTAGGAAAGGAACTAGG - Intronic
966626192 3:182019585-182019607 GTGAGTTCAGGGAAAGAAAATGG + Intergenic
966743994 3:183258439-183258461 GTGGGTTTGGGGAGGAAAGGAGG - Intronic
967293805 3:187946705-187946727 GTGAGTTTAGGGAGGCAGGCAGG + Intergenic
967515864 3:190367887-190367909 GAGACTTTTGGGAAGGAAAGGGG - Intronic
969234765 4:5858109-5858131 GCGAGTTTAAGGAAGGAGGGAGG - Intronic
969504960 4:7579969-7579991 GTGAGCATAGGCAAGGAAGTGGG + Intronic
969705059 4:8787193-8787215 GGGAGTTAAGGGAAGGAGAGAGG + Intergenic
970546669 4:17137400-17137422 GTGAGCTTGGGGAAGGGAAGAGG - Intergenic
970672399 4:18411972-18411994 ATGAGAGGAGGGAAGGAAGGAGG - Intergenic
971059993 4:22957093-22957115 CTGATTGGAGGGAAGGAAGGTGG + Intergenic
971432945 4:26587992-26588014 GACAGTATAAGGAAGGAAGGAGG - Intronic
972374759 4:38459991-38460013 GAGAGTTTAGGGTAAGCAGGGGG - Intergenic
973180213 4:47257548-47257570 GTGGGTGTAGGGAGGGAGGGTGG + Intronic
973612461 4:52649114-52649136 GTGACATTGGGGAAGGAAGTTGG - Intronic
974514970 4:62897213-62897235 ATGAGTTCAGGGAAGGAGGCTGG + Intergenic
975937795 4:79602295-79602317 GGGAGTTGAGGGAAGGGAAGTGG - Intergenic
977101858 4:92826156-92826178 ATGAGTTCAGAGAAGGTAGGAGG - Intronic
977355711 4:95943358-95943380 GTGAGTTTAGGAGAGGAAAATGG - Intergenic
977493455 4:97742213-97742235 GTGGGGTTGGGGGAGGAAGGAGG + Intronic
977960626 4:103081061-103081083 GTGAGAAGAGGGAAGGAAAGGGG - Intronic
978141678 4:105324328-105324350 GTGGGGTTAGGGGAGGAGGGAGG + Intergenic
978167948 4:105631455-105631477 GTGAGTTTGGGGAAAGAAGACGG - Intronic
978495094 4:109350451-109350473 GGGAATGTAGGGATGGAAGGTGG - Intergenic
979215469 4:118158848-118158870 ATGACTCTATGGAAGGAAGGAGG - Intronic
980741561 4:136956314-136956336 GTCAGGGTAGGGAAGGGAGGTGG + Intergenic
981212446 4:142124067-142124089 TTGGGTGTAGGCAAGGAAGGTGG + Intronic
981319548 4:143375554-143375576 GGGAGATAAGGGAAGAAAGGGGG + Intronic
983711789 4:170726199-170726221 GTGAGGTGGTGGAAGGAAGGTGG + Intergenic
985585352 5:729493-729515 GTGAGGTGAAGGCAGGAAGGAGG + Intronic
985598864 5:813820-813842 GTGAGGTGAAGGCAGGAAGGAGG + Intronic
986233144 5:5885180-5885202 GTGAGGTGAGGGAAGAAAGATGG - Intergenic
986283978 5:6346517-6346539 GTGAGAGGAGGGAAGGAAGGAGG + Intergenic
986422580 5:7599474-7599496 ATAATTTTAGGGAAGGAAGATGG + Intronic
986506795 5:8459845-8459867 GAGAGTTTAGGGATTTAAGGAGG + Intergenic
986986981 5:13511519-13511541 GTGAATGTAGGGAAGGCAGCAGG + Intergenic
987110362 5:14680451-14680473 GTGAGTGCAGGGTAGGAAGTGGG + Intronic
988452008 5:31352675-31352697 AGGAGTAGAGGGAAGGAAGGAGG - Intergenic
988614872 5:32765674-32765696 GTGCAGTTATGGAAGGAAGGAGG + Intronic
988628479 5:32902177-32902199 GTGATTCTGGGGAAGGATGGGGG + Intergenic
988755472 5:34244431-34244453 GTGAGATAAGGGAAGAAAAGCGG - Intergenic
988821233 5:34888140-34888162 GTGAGTTTACAGAAAGAAGATGG + Intronic
989128787 5:38083473-38083495 GTCAGATGTGGGAAGGAAGGGGG - Intergenic
990133931 5:52621855-52621877 CTCAGTTTAGGGAAATAAGGGGG - Intergenic
990669747 5:58114760-58114782 GTGAGTTTAGGCAATGAGAGGGG + Intergenic
990866823 5:60389180-60389202 GTAAGCTTAGGGAAGGAAGAGGG - Intronic
990946418 5:61254286-61254308 ATGAGCTAAGGGAAGGAATGAGG + Intergenic
992324775 5:75650065-75650087 GTGATTTCAGAGAAAGAAGGGGG + Intronic
992556005 5:77904249-77904271 GGGGCTTTAGGGAAGGAAGGAGG - Intergenic
993996146 5:94725618-94725640 GAGAGTTTAGAGAAGGAGGTGGG + Intronic
994203120 5:97001402-97001424 GTAGGTTTAGGGAAAGAAGGGGG + Intronic
994548069 5:101194306-101194328 ATTATTTTAGGGAAGGAAAGAGG + Intergenic
996765946 5:127034108-127034130 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
997193227 5:131959555-131959577 GTGAGGTTAGGAAAAGAAAGTGG - Exonic
997549527 5:134739507-134739529 ATGTGTTTGGGGGAGGAAGGAGG - Intronic
997817404 5:137032655-137032677 AAGAGTTTGCGGAAGGAAGGAGG + Intronic
998417997 5:141959346-141959368 GTGAAATTCAGGAAGGAAGGAGG + Intronic
998662110 5:144250389-144250411 GTGAGTATGGGGAGGGAAGTGGG + Intronic
998820747 5:146055753-146055775 GTGTGCTGAGGGAAGGAAGGGGG - Intronic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999389240 5:151178220-151178242 GTGGGTTTTGGGGAGGAAGATGG - Intergenic
999696827 5:154194593-154194615 GTGAGTTTAGGGCAGGAGAAAGG - Intronic
1000442124 5:161276518-161276540 GTTAGTTTAGGTCATGAAGGTGG - Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000935359 5:167299472-167299494 ATGTGTGTAGGGAAGGGAGGGGG + Intronic
1001231672 5:169994086-169994108 GTGGGTGTAGGGAGGGCAGGTGG + Intronic
1001408725 5:171495344-171495366 GGGAGTCGAAGGAAGGAAGGAGG + Intergenic
1001464033 5:171946484-171946506 ATGAAATCAGGGAAGGAAGGAGG - Intronic
1002401285 5:178992763-178992785 GGGAGTTTCTGGAAGGAGGGAGG + Intronic
1003068233 6:2921045-2921067 GTGAGCTTAGGGAAAGGAAGCGG - Intergenic
1003496095 6:6664491-6664513 ATGACTTCAGGGAAGGAAGAGGG - Intergenic
1004047994 6:12044881-12044903 GTCAGCTTGGAGAAGGAAGGAGG - Intronic
1004287332 6:14333813-14333835 ATGAGTTTTGGGAGGGAGGGTGG - Intergenic
1006295409 6:33167912-33167934 GTGTGTCTAGGACAGGAAGGGGG - Intronic
1006818956 6:36875048-36875070 GTTCGTTTAGGCATGGAAGGCGG + Intronic
1006894727 6:37460273-37460295 GTGTGGCTAGTGAAGGAAGGTGG + Intronic
1006987144 6:38183470-38183492 GTGAGTGGAAGGAAGGGAGGGGG - Intronic
1007151425 6:39696132-39696154 GGGAGTGGAGGGGAGGAAGGAGG + Intronic
1007284876 6:40740505-40740527 CCGAGTTTGGTGAAGGAAGGTGG - Intergenic
1007370109 6:41421229-41421251 ATGTGTTTGGGGAAGGCAGGTGG + Intergenic
1008702660 6:54119989-54120011 GTGAGAGTAGAGAAGGAAAGGGG - Intronic
1009297510 6:61971790-61971812 ATGTGTTTAAGGAAGGATGGTGG - Intronic
1009778582 6:68238524-68238546 TTGAGTAGAGAGAAGGAAGGAGG + Intergenic
1010923903 6:81720104-81720126 ATGAGATTAAGGAAGGAAGTAGG + Intronic
1011419470 6:87155996-87156018 CCGAGTTCAGGGAAGGAAAGGGG - Intronic
1011449573 6:87478476-87478498 GTGAGTGAAGGGAAGCAGGGAGG + Intronic
1012271891 6:97223405-97223427 TTGGGTTTAGGTAAGGAAGATGG - Intronic
1012813952 6:103998351-103998373 GTGCTCTTAGGGAAGGATGGAGG + Intergenic
1013230290 6:108156604-108156626 GTTTCTTTGGGGAAGGAAGGAGG - Intronic
1014613688 6:123576622-123576644 GAGTGATTAGGGCAGGAAGGTGG - Intronic
1015007663 6:128303071-128303093 GTGAGTTTAGGGAAGGAAGGCGG - Intronic
1015127871 6:129774598-129774620 GTGAGTTTACCCAAGGAAGGAGG + Intergenic
1015195419 6:130520477-130520499 GCTAGTTTGGGAAAGGAAGGAGG - Intergenic
1015483794 6:133745620-133745642 GACATTTCAGGGAAGGAAGGAGG - Intergenic
1015579048 6:134703525-134703547 GTGAGTGGTGGGAAGGAGGGAGG + Intergenic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1015849006 6:137552417-137552439 GGGAGGGAAGGGAAGGAAGGGGG - Intergenic
1016278447 6:142382878-142382900 GTGAGAGTAGGGCAGGCAGGAGG + Intronic
1016317657 6:142808313-142808335 GTGAATGGATGGAAGGAAGGAGG + Intronic
1016882497 6:148924454-148924476 GTGAGTTCAGGGAATGAAAGGGG + Intronic
1017926015 6:158912323-158912345 GTGACTTTAGAGGAGGGAGGTGG - Intergenic
1019346521 7:533427-533449 GTGGGTGGAGGGAAGGAGGGAGG + Intergenic
1019935008 7:4249091-4249113 GTGAGTGTGGGGAGGGAGGGAGG + Intronic
1020440848 7:8215125-8215147 GAGGGTGTAGGGAAGGCAGGAGG - Intronic
1020638684 7:10728442-10728464 GTGGGTGGAGGGAAGGGAGGTGG - Intergenic
1021846541 7:24768483-24768505 GAGAGCTTAGGGCAAGAAGGGGG - Intergenic
1021948815 7:25754279-25754301 GGGAGTTGAGGGCAGGGAGGGGG - Intergenic
1022972796 7:35532623-35532645 GTCATATTAGGGAAGGATGGAGG - Intergenic
1023224169 7:37951972-37951994 TGGAGTTTAGGGAAGGTAAGAGG - Intronic
1023302118 7:38784221-38784243 GTTATTTTAGAGAGGGAAGGAGG + Intronic
1023565146 7:41516684-41516706 GTGGGAGTAGGGCAGGAAGGTGG - Intergenic
1023882652 7:44329292-44329314 GTGTGTTTAGGGAATGAAGACGG + Intronic
1023913771 7:44573549-44573571 GAGAGCTGAGGGGAGGAAGGAGG - Intronic
1026040744 7:66865910-66865932 GTGAGGGGAGGGAAGGGAGGAGG - Intergenic
1026110503 7:67455371-67455393 TAGGGTTTGGGGAAGGAAGGGGG + Intergenic
1026423710 7:70268288-70268310 AGGAGTCTAGGGAAGGGAGGAGG + Intronic
1026582725 7:71631666-71631688 AGGAGATAAGGGAAGGAAGGAGG + Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1028163081 7:87507978-87508000 ATTAGTGTAGGGAGGGAAGGGGG + Intronic
1028828977 7:95305944-95305966 GGGAGGAGAGGGAAGGAAGGTGG + Intronic
1028831262 7:95328697-95328719 GTAGGTTAAGGGAAGGAAGGAGG - Intergenic
1029323778 7:99788282-99788304 TAGAGTTTAGGGAAGAAAGAAGG - Intergenic
1030098338 7:105921436-105921458 GTGGGTTGAGGGGAGGGAGGAGG + Intronic
1031837219 7:126692008-126692030 GCAAGTTTAGGGTAGGATGGAGG + Intronic
1032465938 7:132145096-132145118 GTGAGTGAAGGGAGGGCAGGGGG - Intronic
1032495829 7:132361425-132361447 GTGAATTTAGTAAAGGAAGGAGG + Intronic
1032739149 7:134721583-134721605 GTGTGTTTAGGGGAGGTGGGGGG + Intergenic
1032799836 7:135309149-135309171 GGGAGAATAGGGAAGGAGGGAGG + Intergenic
1033061780 7:138116396-138116418 GTGTGTTGAGGGAAGGTTGGTGG - Intronic
1033252819 7:139775943-139775965 GTGAGTTGAGAGAAGGAACTTGG - Intronic
1033467465 7:141608514-141608536 ATGAGGTTAGAGAAGTAAGGAGG + Intronic
1033470573 7:141644754-141644776 GTGAGTTTTGTGAATGATGGAGG + Intronic
1034275358 7:149821550-149821572 GTGAGTGCAGGGCAGGGAGGGGG + Intergenic
1034551111 7:151821279-151821301 GTGTGTCTAGGGAACAAAGGAGG - Intronic
1035295642 7:157865551-157865573 GGGGGTTGGGGGAAGGAAGGCGG + Intronic
1035564881 8:634945-634967 GTGCCTCTGGGGAAGGAAGGAGG + Intronic
1036145986 8:6255300-6255322 GTGGTTTTTGGGAAGGAATGTGG - Intergenic
1036445523 8:8818794-8818816 GGGACTTTAGAGAAGGAAGTAGG - Intronic
1036823390 8:11957407-11957429 GTGCATTTAAGGAAGGAAGTTGG - Intergenic
1037538157 8:19846654-19846676 GTGAGTTCAGGGGAGCATGGTGG - Intronic
1037650834 8:20837016-20837038 GTGACATTAGAGAAGGAAGCAGG - Intergenic
1037712185 8:21363572-21363594 GAAATTTTAGGGAAGGAAGAAGG + Intergenic
1038029949 8:23629131-23629153 GTCAGTGTAGGGTAGGGAGGTGG - Intergenic
1039027673 8:33275521-33275543 GTGAGAGAAGGGAAGGGAGGTGG - Intergenic
1039740406 8:40377760-40377782 CTGAGTTTAGGGAAGGGAGATGG + Intergenic
1041101210 8:54397934-54397956 GTGAGTGTAGTGAAGGTAGTGGG - Intergenic
1043061390 8:75509050-75509072 GTGAGTTTAAGGTATCAAGGAGG + Intronic
1043370117 8:79581513-79581535 GTGTATTTAGGCAAGCAAGGAGG + Intergenic
1043734952 8:83730630-83730652 GGAAGTTGAAGGAAGGAAGGTGG - Intergenic
1043809956 8:84727053-84727075 GTGTGTTTAGAGAATGAAGAGGG + Intronic
1045085768 8:98682866-98682888 GTGTGCATAGGGTAGGAAGGTGG - Intronic
1046075346 8:109305901-109305923 GTGAGTTTAAGGGAAGTAGGGGG - Intronic
1046994083 8:120496254-120496276 GTGAGTGATGGGAAGGAAGAGGG + Intronic
1047172672 8:122509228-122509250 TTGACTCCAGGGAAGGAAGGAGG - Intergenic
1047188985 8:122661019-122661041 CTGAATGTAGGGGAGGAAGGTGG - Intergenic
1047442787 8:124893448-124893470 GTGAGTGTGGGGAAGGCTGGTGG + Intergenic
1047733188 8:127743417-127743439 CTGACTTTCGGGAAGGAAGTTGG - Intergenic
1048216424 8:132499684-132499706 GGGAGTTAAGGCAGGGAAGGGGG - Intergenic
1048314112 8:133349572-133349594 GTGAGGGAAGGGAAGGAAGGGGG + Intergenic
1049246554 8:141565812-141565834 GTGAGGGTGGGGAAGGAGGGGGG + Intergenic
1049569860 8:143364334-143364356 GTGTGCTTAGGGAGGGAGGGAGG - Intergenic
1049717444 8:144099631-144099653 GTGGGTTCAGGGATGGATGGGGG + Intronic
1049891071 9:71900-71922 GAGAGGGTTGGGAAGGAAGGAGG + Intergenic
1050158396 9:2692388-2692410 ATGAGTTTAGGAAAGGACTGAGG + Intergenic
1051092376 9:13424828-13424850 GAGACTTCAAGGAAGGAAGGAGG + Intergenic
1051181128 9:14412985-14413007 GTGATTTGAGGGAAGGAGGAGGG - Intergenic
1052488611 9:29133932-29133954 GTGTCTTTAGTGAGGGAAGGAGG - Intergenic
1053129378 9:35606286-35606308 GTGAGGATAGGCCAGGAAGGAGG + Intronic
1053718629 9:40922433-40922455 GTGAGTTGGGGGAAGCAGGGAGG + Intergenic
1053732512 9:41072955-41072977 GAGAGGGTTGGGAAGGAAGGAGG + Intergenic
1053887063 9:42651687-42651709 ATGAGATTAGGGAAAGCAGGTGG - Intergenic
1054226083 9:62459137-62459159 ATGAGATTAGGGAAAGCAGGTGG - Intergenic
1054452997 9:65413266-65413288 GTGGGTTCTGGGAAGGATGGGGG - Intergenic
1054695919 9:68358620-68358642 GAGAGGGTTGGGAAGGAAGGAGG - Intronic
1054967555 9:71046617-71046639 GTGACAATAGGGAAGGAGGGTGG - Intronic
1055058550 9:72045935-72045957 GTGTGTGGGGGGAAGGAAGGTGG + Intergenic
1055115143 9:72597872-72597894 GTGAGGTTATGGAATGAAGATGG - Intronic
1055879177 9:80978273-80978295 GCAAGTTTAGAGAAGGAAAGTGG - Intergenic
1056252211 9:84761267-84761289 GACAGTGTAAGGAAGGAAGGGGG + Intronic
1058093593 9:100833745-100833767 GTGACTTATGTGAAGGAAGGAGG - Intergenic
1059613671 9:115925746-115925768 GTGAGTTCAGGGAGGGAACAGGG - Intergenic
1060145413 9:121248483-121248505 ATAAATTTATGGAAGGAAGGAGG - Intronic
1060266331 9:122113591-122113613 GGGAGATGAGTGAAGGAAGGGGG + Intergenic
1060328364 9:122641067-122641089 GTGAGGTCAGGGATGGAATGAGG + Intergenic
1061246077 9:129401825-129401847 GGGAGATGAGGGAGGGAAGGTGG - Intergenic
1061504066 9:131020805-131020827 GAGAGACTAGGGGAGGAAGGAGG + Intronic
1061700509 9:132411465-132411487 CCGAGTTTAGGGAAGGCAAGAGG - Intronic
1061963110 9:133998273-133998295 GTGAATGGAGGGAAGGACGGCGG - Intergenic
1061963326 9:133999002-133999024 GTGGGTTGAGGGATGGATGGGGG - Intergenic
1062680837 9:137779106-137779128 GTGAGTTTTGGGAGGGACAGAGG + Intronic
1185820211 X:3195879-3195901 GAGAGTTAAAGGAAGGAAGGAGG + Intergenic
1187252883 X:17614910-17614932 GTGAGATTAGGGAACACAGGAGG - Intronic
1187357597 X:18591778-18591800 CTGAGTCTAGGGGAGGAAGGAGG - Intronic
1187952638 X:24485828-24485850 GTCAGGTTTGGGAAGGAAGCAGG - Intronic
1189101780 X:38197987-38198009 GTGAGATGAGGGAAGTAGGGTGG + Intronic
1189358671 X:40331196-40331218 GTGAGATTAGTCAAGGCAGGAGG + Intergenic
1192173720 X:68873196-68873218 GGGAGCCCAGGGAAGGAAGGAGG - Intergenic
1192220844 X:69196439-69196461 GAGAGTTCAGGGAGGGAGGGGGG - Intergenic
1192552186 X:72063224-72063246 GTGAGTTTGGGGGAGGCAGGAGG - Intergenic
1194189592 X:90818506-90818528 GCCAGTTGAGGGAAGGTAGGGGG - Intergenic
1195045632 X:101052082-101052104 GAGAACTTAGAGAAGGAAGGCGG - Exonic
1195066026 X:101239167-101239189 ATGAGTTTGGGGAAGGCAGGAGG - Intronic
1195109977 X:101638348-101638370 GTGAGTTTCGAGTGGGAAGGGGG + Intergenic
1196124025 X:112081250-112081272 GTGTGTCTAGGGAGGGAGGGAGG + Intronic
1197198992 X:123732750-123732772 GGGAGGCCAGGGAAGGAAGGAGG + Intronic
1197586633 X:128355943-128355965 CTGAGTCTAGGGAAGGTAGGAGG - Intergenic
1197927334 X:131660622-131660644 GTGTGTGTAGGGAAAGAAAGAGG - Intergenic
1198640525 X:138751012-138751034 GAGAGTTTCAGGAAGGAAGAAGG + Intronic
1199351748 X:146810060-146810082 GTTGGTTTTGGGAAAGAAGGTGG - Intergenic
1199352159 X:146814433-146814455 GTTGGTTTTGGGAAAGAAGGTGG + Intergenic
1199518559 X:148707515-148707537 GTCATTTGGGGGAAGGAAGGTGG + Intronic
1200056874 X:153466167-153466189 GCGGGGTTGGGGAAGGAAGGGGG + Intronic
1200064135 X:153496690-153496712 GGGAGTCTGGGAAAGGAAGGGGG + Intronic
1200536172 Y:4400391-4400413 GCCAGTTGAGGGAAGGTAGGGGG - Intergenic
1200954184 Y:8928493-8928515 GTGTGTGTAGTGAAGGAATGTGG - Intergenic
1201187934 Y:11422003-11422025 GTGACCTTAGGAAAGGAAGTAGG - Intergenic
1201486295 Y:14497991-14498013 GTGTTTTTAGAGTAGGAAGGTGG + Intergenic
1202232312 Y:22669875-22669897 GTGTGTGTAGCGAAGGAATGTGG - Intergenic
1202310844 Y:23526283-23526305 GTGTGTGTAGCGAAGGAATGTGG + Intergenic
1202559958 Y:26144311-26144333 GTGTGTGTAGCGAAGGAATGTGG - Intergenic