ID: 1015010190

View in Genome Browser
Species Human (GRCh38)
Location 6:128336699-128336721
Sequence GTTCTTAGGGAGATACTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015010190 Original CRISPR GTTCTTAGGGAGATACTTGA TGG (reversed) Intronic
900388687 1:2423559-2423581 GTTCTTAAGGAGATTATGGAGGG + Intergenic
903089557 1:20899606-20899628 CTTTTTAGAGAGATACTGGATGG - Intronic
907888284 1:58614244-58614266 GTTTTTAAGGAGATCCTGGAGGG - Intergenic
909108352 1:71441740-71441762 GTTGTTTGGTAGATACTTCAAGG + Intronic
909588135 1:77313875-77313897 GTCTTTAGGGAGAATCTTGACGG - Intronic
911323517 1:96442446-96442468 CTGATTAGGGTGATACTTGATGG + Intergenic
915928625 1:160043421-160043443 GTGCTTAGGGAGCATCTTGAAGG - Intronic
921078811 1:211722380-211722402 ATTCCTAGGAACATACTTGAAGG + Intergenic
921267526 1:213435774-213435796 GTTCTTTGTTAAATACTTGATGG + Intergenic
921616668 1:217276467-217276489 GTTCATAGTGAGAAACCTGATGG - Intergenic
922443605 1:225677627-225677649 GCCCTTAGGGAGAGAATTGATGG + Intergenic
1066506857 10:36054489-36054511 GTTCATAGGGAAATTCTTGCAGG + Intergenic
1068066958 10:52143734-52143756 GGTATTGGGGAGATACTTCAAGG - Intronic
1070666778 10:78350572-78350594 GTTGTTAGGAAAATAATTGAGGG - Intergenic
1075855215 10:125624228-125624250 GTTCTTAGGGGGATAGTGAATGG - Intronic
1076918454 10:133438928-133438950 GTGCTTAGAGACTTACTTGAGGG + Intergenic
1080746534 11:35112942-35112964 GTTCTTAGTTAAATATTTGATGG - Intergenic
1088098372 11:106126334-106126356 GTCCTGAGGGAGCTACATGAAGG + Intergenic
1091455773 12:606754-606776 TTTCTTAGGGAGTTACTGGAAGG + Intronic
1092853892 12:12655059-12655081 GTTCTTTGGAAGATACTGCAGGG + Intergenic
1093280171 12:17184625-17184647 GTGTTTAGGGAGAGACCTGATGG + Intergenic
1095307906 12:40660037-40660059 GTTCTAAGGAAGATACTTCTTGG + Intergenic
1096214765 12:49792886-49792908 GGTCTTAGGAAGATTCTTGCTGG + Exonic
1102442713 12:112975631-112975653 GTTCATAGGGACAGACTAGATGG + Intergenic
1104188854 12:126458580-126458602 GTTCTCCTGGAGATTCTTGAAGG + Intergenic
1105603840 13:21910585-21910607 CTTCTGAGGGAGACATTTGATGG + Intergenic
1106451667 13:29887964-29887986 ATTCTTAGGCAGATTTTTGACGG - Intergenic
1106589650 13:31088551-31088573 GTCACTAGGGAGATATTTGAAGG - Intergenic
1109385998 13:61629508-61629530 GTTCTTACTGATATGCTTGAAGG + Intergenic
1109967141 13:69715252-69715274 GTGCTGAGGGAGAAACTTGGTGG + Intronic
1112136340 13:96582559-96582581 GTTTTCATGGAGATACTGGAGGG + Intronic
1113903744 13:113809727-113809749 GTTCCTAGGGAGTTACTCCATGG + Intronic
1114851279 14:26385186-26385208 ATTCTTAGGGAAATCCTTAATGG - Intergenic
1116449930 14:45052997-45053019 ATTTTTAGGGAGCTCCTTGAGGG + Intronic
1116507824 14:45706788-45706810 GTTCTTAGAGATATTCCTGAGGG + Intergenic
1118179632 14:63479349-63479371 GTTCTGAGGATGATCCTTGAGGG - Intronic
1120847732 14:89140698-89140720 GTTCTTAGGGATGTACTAAATGG - Intronic
1124909865 15:33909065-33909087 GTACTTGGGGAGATGTTTGAGGG - Intronic
1127183034 15:56444876-56444898 GTCCTGAGAGAGCTACTTGAAGG - Intronic
1127665851 15:61146655-61146677 TTTCTTAGGCAGACACTTGTAGG - Intronic
1128454084 15:67823085-67823107 GTTCTTGGGGACAAACTTTATGG + Intronic
1130382398 15:83381781-83381803 GTTCCTAGGAAGATAATTGCTGG + Intergenic
1134563292 16:15229160-15229182 TTTCTTAGGGAGAAAGATGAGGG - Intergenic
1134871773 16:17658367-17658389 GTGTTTAGGGAAAGACTTGATGG - Intergenic
1134923819 16:18140789-18140811 TTTCTTAGGGAGAAAGATGAGGG - Intergenic
1135985822 16:27183361-27183383 GTTCTTAGGGTGCTATTTAAAGG - Intergenic
1136702810 16:32158739-32158761 GTAGTTAGGGATATACTTCATGG - Intergenic
1136764889 16:32768857-32768879 GTAGTTAGGGATATACTTCATGG + Intergenic
1136803210 16:33101527-33101549 GTAGTTAGGGATATACTTCATGG - Intergenic
1141074991 16:80997480-80997502 GTTCTTATGAAGATACTTTTAGG - Intronic
1141120062 16:81346714-81346736 GTTCATGGGAAGGTACTTGAAGG + Intronic
1203067246 16_KI270728v1_random:1030982-1031004 GTAGTTAGGGATATACTTCATGG + Intergenic
1144996310 17:19271624-19271646 TTTCTGAGGGAGTTACTTGCAGG - Intronic
1145122355 17:20271790-20271812 ATTCTCAGGGAGATACTGAAGGG - Intronic
1145856310 17:28161849-28161871 ATTCTCATGGACATACTTGATGG - Intronic
1150260348 17:63784836-63784858 GTTCCTAAGGAAATAATTGAAGG + Intronic
1153115702 18:1652916-1652938 TTTCTTAGGCAGGCACTTGAAGG - Intergenic
1153873449 18:9342803-9342825 TTTCTTAGGAAGTTACTTGAGGG - Intronic
1155714583 18:28925700-28925722 GATTTAAGGGAGATATTTGAGGG + Intergenic
1159755360 18:72357798-72357820 ATTCTTATGGATAAACTTGAGGG - Intergenic
1164017914 19:21269265-21269287 GGTCTATGGGAGAGACTTGAAGG - Intronic
1164198514 19:22995328-22995350 CTTCTTAGGGAGATATTTTCTGG - Intronic
1167393158 19:49210391-49210413 GTTCTTACGGAAATGCTCGAGGG - Exonic
927213410 2:20652268-20652290 GTTCTGAGGGAGACCCTTGAAGG + Intergenic
927717900 2:25364348-25364370 CTTCTCAGGGAGGTACCTGAGGG - Intergenic
928191693 2:29176427-29176449 ATTCTTGGGTAGAAACTTGAAGG + Intronic
929055036 2:37869328-37869350 GGTCTTAGGGACCTCCTTGAAGG + Intergenic
943256637 2:185602099-185602121 GTTTTTAGGGAGATACCTGATGG - Intergenic
943570818 2:189572819-189572841 GTTCTCAATGAGATTCTTGATGG - Intronic
945396194 2:209321781-209321803 GTACTTACGGACAGACTTGAGGG - Intergenic
947382555 2:229559301-229559323 GTACTTAGGGAGAGAATAGAGGG + Intronic
1169730457 20:8780197-8780219 ATTCTTAGGGATTTACCTGAGGG + Intronic
1179169257 21:38960031-38960053 GTTCTTGTTGAGATATTTGAAGG - Intergenic
1180108976 21:45638901-45638923 GTTCTCAGGAAGAGACTGGAGGG - Intergenic
949193528 3:1278713-1278735 GTTTTTAAGGAGATACATCATGG + Intronic
951547362 3:23840734-23840756 ATGCTTAGGTAAATACTTGACGG + Intronic
952465171 3:33576656-33576678 GTGGTTAGGGAGATCCATGAAGG + Intronic
957197570 3:77089871-77089893 GTTGTTATGGACAGACTTGATGG + Intronic
959417524 3:106094532-106094554 GTTGTTAGGGAGAGAGGTGATGG + Intergenic
964677533 3:159300405-159300427 GTTCTAAGGCAGAGACTTCAAGG + Intronic
966647375 3:182261671-182261693 GAACATAGGGAGAAACTTGATGG - Intergenic
970939191 4:21611440-21611462 GTATCTAGGGAGAGACTTGATGG - Intronic
972019711 4:34296400-34296422 GTGTTTAGGGAGATACTTGGTGG - Intergenic
977264883 4:94841907-94841929 TTCCTTAGGGAGCTACTTAAAGG + Intronic
978903803 4:113983280-113983302 ATTTTCAGGGAGAGACTTGAGGG + Intergenic
988213528 5:28241167-28241189 GTGTCTAGGGAGAGACTTGATGG - Intergenic
989304014 5:39930538-39930560 ATTTTTAAGGAGATCCTTGAAGG - Intergenic
990137607 5:52665728-52665750 CTTCTTAGGGAGAGATGTGAAGG - Intergenic
991062140 5:62388271-62388293 GTTCTTAGGGAGATAACTATAGG - Exonic
997090584 5:130851900-130851922 GTTCTTAAGGAGATACATAATGG + Intergenic
1000688600 5:164285667-164285689 GGTATTAGGGTGATACTTCATGG + Intergenic
1004919778 6:20365774-20365796 GTTATTGAGGAGATATTTGAAGG + Intergenic
1005632810 6:27724668-27724690 GTTCTTAAGGACATACCTTAAGG + Intergenic
1008255856 6:49298498-49298520 GATATAAGGGAGATAATTGAAGG - Intergenic
1009791534 6:68407552-68407574 GCTCTCAAGGAGAGACTTGATGG + Intergenic
1011485549 6:87837336-87837358 TTTCTTAGGAAGCTACTAGAAGG - Intergenic
1014006548 6:116425924-116425946 CTTCTTAGAAAGATATTTGAAGG + Intronic
1014401389 6:120994694-120994716 ATTCATAGGGAAATACTGGAGGG - Intergenic
1015010190 6:128336699-128336721 GTTCTTAGGGAGATACTTGATGG - Intronic
1017280345 6:152617082-152617104 GTTCCTAAGTAGATATTTGAGGG - Intronic
1024841530 7:53592700-53592722 GTTCTTTGGGAATTACTTAATGG + Intergenic
1024879422 7:54068928-54068950 TTTCTTAGGGGGATATTTGGGGG - Intergenic
1024952430 7:54878426-54878448 CTTCTCATGGAGATACTTAAGGG + Intergenic
1028231838 7:88315020-88315042 TTTCTTAGTTAGATACTTGAGGG - Intergenic
1031014548 7:116558817-116558839 GTTCTTTGTGAGATGCTTAAAGG - Intronic
1034619640 7:152446807-152446829 GGTTTTAGGAAGATACTTCAGGG - Intergenic
1038030942 8:23638620-23638642 GTGCTCAGGGAGGTACTGGATGG - Intergenic
1038809690 8:30827720-30827742 GTACTTAGTGAAATACTTAAGGG + Intergenic
1039682360 8:39754130-39754152 GTTCTTAGATGGCTACTTGATGG + Intronic
1039980459 8:42405626-42405648 CTCCTGAGGGAGATGCTTGAAGG + Intronic
1040928197 8:52707665-52707687 GTGCTAGGGAAGATACTTGAGGG - Intronic
1041234564 8:55786835-55786857 GATCATAGTGAAATACTTGATGG + Exonic
1041659240 8:60385070-60385092 TTTCTTAGGGAGTTACTTGGAGG - Intergenic
1042192449 8:66200998-66201020 GTTGTTAGGGAATTACTTAAGGG + Intergenic
1042681106 8:71385552-71385574 GCCCTTAGTGAGATACTTGTGGG - Intergenic
1044197647 8:89396687-89396709 ATTCTTAGGCAGATTCTTAATGG - Intergenic
1044375088 8:91460792-91460814 TTTCTTAGGAAGCTACTTGAGGG - Intergenic
1045056175 8:98370152-98370174 GGTGTTAGGGAGAGGCTTGATGG - Intergenic
1047479042 8:125263370-125263392 GTTCTTAGGAAGAAACTAGAAGG + Intronic
1056441035 9:86621551-86621573 TTTCTTAGGGTGATAAGTGAGGG - Intergenic
1056862832 9:90202982-90203004 ATTCTTAGGGAGCTCCTTGGTGG + Intergenic
1059109855 9:111545904-111545926 TTTCTTAGGCAGATGCCTGAGGG + Intronic
1060361956 9:122967681-122967703 GTTCTTCGGAAGATACCTGAGGG - Intronic
1060464617 9:123892101-123892123 GTACTTAGCTATATACTTGAGGG - Intronic
1185805793 X:3055867-3055889 GTTATTAGGGAGGTAATTGAGGG - Intronic
1186097502 X:6117742-6117764 ATTCTCTGGGAGATACTTCAAGG - Intronic
1186146158 X:6626219-6626241 GTATTTAGGGAGAGACCTGATGG - Intergenic
1188061645 X:25608237-25608259 GTACTGAGGGAGATATATGAAGG - Intergenic
1189173329 X:38930484-38930506 GTGCTTAGGGATATATTTTAAGG + Intergenic
1192261742 X:69509680-69509702 GTTCTTCTGGAGAGAGTTGAAGG + Intronic
1196215729 X:113049920-113049942 GTTCTTATGAAGATGCTTTATGG - Intergenic
1196614680 X:117754462-117754484 GTTATTAAGAAGATAATTGAGGG - Intergenic
1199180602 X:144849184-144849206 CTTCTAAGGAAGATACTTGGAGG + Intergenic