ID: 1015015424

View in Genome Browser
Species Human (GRCh38)
Location 6:128407043-128407065
Sequence AGTTGGAAGCAGAAATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 2, 2: 4, 3: 44, 4: 385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015015424 Original CRISPR AGTTGGAAGCAGAAATTGGA GGG (reversed) Intronic
900558136 1:3290229-3290251 ATTTGGAAGTAGACATGGGAAGG + Intronic
902108288 1:14056367-14056389 CGATGGAAGCAGAGCTTGGAGGG + Intergenic
902649862 1:17829973-17829995 CCTTGGCAGCAGAAATTGGCAGG - Intergenic
902661621 1:17908159-17908181 AGTTGGAGGCAGCAATAGAAGGG + Intergenic
904513083 1:31030322-31030344 AATTGTAAACAGACATTGGAAGG - Intronic
905190184 1:36227735-36227757 AGCAAGAAGCAGAGATTGGAGGG + Intronic
906470840 1:46129348-46129370 AGTTGGAAGCAAAAATTAGAGGG + Intronic
906494942 1:46298554-46298576 AGTTGGAAGCTGGAATTTCAGGG + Intronic
908086194 1:60636701-60636723 AACTGGAAGAAGAACTTGGAAGG + Intergenic
909906640 1:81204126-81204148 AGTTGGGAGACTAAATTGGATGG - Intergenic
910680561 1:89859843-89859865 TCTTGGAAGCACAAAATGGAAGG - Intronic
911117917 1:94265409-94265431 AGTAGAAAACTGAAATTGGAGGG - Intronic
912595874 1:110875284-110875306 ACTTGGCACCAGAAAGTGGAGGG + Intronic
913121058 1:115741184-115741206 ATTTGGAAACAGATTTTGGAGGG - Intronic
913711661 1:121490284-121490306 AGGTGGCAGCAGGAATTGCAAGG + Intergenic
914777124 1:150747730-150747752 AATTGGAATCAGGAATTTGAGGG - Intronic
914952440 1:152128554-152128576 AGATGGAGGCAGAGATTGGAAGG + Intergenic
915364014 1:155303848-155303870 ATTTTGAAGCTGAAATTTGAAGG + Intergenic
915687767 1:157652386-157652408 AGCTGGAATCAGAAAGTGGGAGG - Intergenic
916265240 1:162883924-162883946 ACTTGGAAGCTGAAATTAAATGG + Intergenic
916618334 1:166468303-166468325 AGTTGGAAGCAAGTCTTGGAAGG + Intergenic
916980409 1:170129798-170129820 AGCAGGAATCAGAAATGGGATGG - Intergenic
918403316 1:184186772-184186794 AATTGAAAGCAGAATCTGGATGG + Intergenic
922912720 1:229231081-229231103 AGGTAGAAGCAGAAATTAGGCGG + Intergenic
923937868 1:238784351-238784373 AGAGGGAAACAGAAGTTGGAAGG + Intergenic
924425038 1:243943017-243943039 AGTGGGATGCAGAAATTCAAGGG - Intergenic
1063258682 10:4358096-4358118 AATTTGAAGGAGAAATTGTAAGG + Intergenic
1063735903 10:8754067-8754089 AAATGCATGCAGAAATTGGAGGG + Intergenic
1063756951 10:9022107-9022129 AATTGGTGGCAGAATTTGGAGGG + Intergenic
1064735588 10:18378873-18378895 AGTTGGGAGCAGAAAGAGGAAGG - Intronic
1065179331 10:23108812-23108834 TGTTGGAAGCAGGCATTTGAGGG + Intronic
1065527663 10:26639131-26639153 AGTTATAACCAGAACTTGGAGGG - Intergenic
1067752250 10:48979337-48979359 AAGTGGAAGCAGATATGGGAGGG - Intronic
1069760331 10:70806253-70806275 AGTTGGCAGCAGCTATTGGAGGG + Intergenic
1071014344 10:80977394-80977416 AGATGGAGGCAGAGATTGGAAGG - Intergenic
1071954940 10:90747814-90747836 ACTTGGAATGAAAAATTGGAAGG - Intronic
1072174389 10:92902758-92902780 AGAAGGGAGGAGAAATTGGAAGG - Intronic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1074186606 10:111103692-111103714 AGGTGAAAGGGGAAATTGGAAGG + Intergenic
1075236312 10:120732921-120732943 AGTAGGCAGAAGAAAGTGGAAGG + Intergenic
1075656764 10:124167005-124167027 AGATGGGAGCAGAAGTGGGAAGG - Intergenic
1076056140 10:127374775-127374797 AGATGGAGGCAGAGATTGGAGGG + Intronic
1076989760 11:266723-266745 AGATGAAAGCAGAAATGTGAAGG + Intergenic
1077546312 11:3171711-3171733 GGATGGAGGCAGAGATTGGAGGG - Intergenic
1078273529 11:9820284-9820306 CTTTGGAAGCAGAAAATGAAGGG + Intronic
1078398617 11:11003314-11003336 ATATGAAAGCAGAGATTGGATGG + Intergenic
1079194773 11:18315855-18315877 AGTGGGAGGCAGACATGGGAAGG - Intronic
1079932008 11:26575433-26575455 ATTTTGAAGTAGAAATTGGATGG + Intronic
1080860528 11:36146688-36146710 AGACGGAAGCAGAGATTGCAGGG - Intronic
1081156259 11:39695691-39695713 AGTTGCCAGCAGAACATGGAAGG - Intergenic
1081461930 11:43280060-43280082 AGATGGTGGCAGACATTGGAGGG - Intergenic
1081520138 11:43873537-43873559 AGGTGGAAGCAGAGCTTGGAGGG - Intergenic
1081527144 11:43934971-43934993 AGATGGAAGCAGAGAGGGGAGGG - Intronic
1082987953 11:59184118-59184140 ATTTGGGAGCAGAGAATGGATGG + Intronic
1083592576 11:63904206-63904228 AGTGGGAAGAAGAAATTGTTGGG - Intronic
1083799273 11:65037035-65037057 AGTGGGAAGAAGGAATGGGAGGG + Intronic
1084666630 11:70579855-70579877 GGATGGAAGCAGAAGTTGGAGGG + Intronic
1084696511 11:70758770-70758792 AGATGGAGGCAGAAGTTGGAGGG - Intronic
1084801604 11:71547783-71547805 AGCTTGGAGCAGAACTTGGAGGG - Intronic
1085017181 11:73182380-73182402 AATGGGAACCAAAAATTGGAAGG - Intergenic
1085127081 11:74009035-74009057 AGGTGGCAGCAGGGATTGGATGG + Exonic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1085832624 11:79917676-79917698 GGTGGAAAGCAGAAATTGGATGG - Intergenic
1086514591 11:87597053-87597075 TAATGGAAGCAGAAATTGGAGGG + Intergenic
1086900193 11:92358783-92358805 ACTTGGAAGCAAAAAATTGATGG - Intronic
1088388570 11:109288465-109288487 AGCAGGCAGAAGAAATTGGAAGG + Intergenic
1088432013 11:109768880-109768902 AGTTGGAGGCAGAGGTGGGAGGG - Intergenic
1088838648 11:113603410-113603432 AGTCAGAAGCAGAGATTGGAGGG + Intergenic
1089302587 11:117507595-117507617 AGGTGGAAGATGACATTGGAAGG - Intronic
1089785000 11:120901388-120901410 AGCTGGAAACAGAAATTAGAGGG - Intronic
1090403639 11:126464658-126464680 AGGTGGAGGCAGAGATTGGAGGG + Intronic
1090674458 11:128977039-128977061 AGATGGAGGCAAAGATTGGAGGG + Intronic
1090912979 11:131137695-131137717 AGATGGAAGCAGAGATTGCAGGG + Intergenic
1091099706 11:132859921-132859943 AATTGAAAGCAGAAAATGAAAGG - Intronic
1092089247 12:5790533-5790555 AGCAGGAAGCAGAGATTTGAAGG - Intronic
1092775876 12:11944816-11944838 TGTTTGAATAAGAAATTGGAGGG + Intergenic
1093195980 12:16129999-16130021 AGATGGAGGCAGAGACTGGAGGG + Intergenic
1093345434 12:18034861-18034883 AATTGGAAGGACAATTTGGAAGG + Intergenic
1093854073 12:24077282-24077304 TGTTGGAAGCAGATCTTGGAAGG - Intergenic
1094378476 12:29817188-29817210 ATCTGAAAGAAGAAATTGGAAGG + Intergenic
1095046568 12:37513886-37513908 AGTTTGAAACAGCAACTGGAAGG - Intergenic
1095326482 12:40900385-40900407 AGGTGGTAGCAAAAATAGGAAGG + Intronic
1095851407 12:46811394-46811416 AGTTGGCAGGAGAAATGCGATGG + Intronic
1096694568 12:53340395-53340417 AGTTGGAGGCAGCAATTTGCAGG - Intronic
1096745018 12:53721176-53721198 ATTTGGAAGAAGAGAATGGATGG - Intronic
1097823103 12:64147371-64147393 AGTGGGCAGCAGGAATTGGGAGG - Exonic
1099610490 12:84862183-84862205 AGAAAGAAGCAGAAATTGGAAGG - Intronic
1099750025 12:86761748-86761770 AGATGGAAGCAGAGGTTGGAGGG - Intronic
1100825834 12:98473361-98473383 TGATGGAGGCAGAGATTGGAGGG + Intergenic
1101641161 12:106586586-106586608 AGATGGGAGCGGAAAGTGGATGG - Intronic
1102381501 12:112470556-112470578 AGGTGGAGGGAGAAATTGAAGGG + Intronic
1103041771 12:117701753-117701775 AGACAGAAGCAGAGATTGGAAGG + Intronic
1103583965 12:121937271-121937293 AGATGGCGGCAGAGATTGGAGGG - Intronic
1105433829 13:20360600-20360622 AGTTGGATGAGGAAATGGGAAGG - Intergenic
1106575628 13:30971887-30971909 AGTTGGAGGAAGAGATGGGAAGG - Intronic
1106969625 13:35122734-35122756 AGTAGGAACCAGGAATTGTAGGG + Intronic
1107035498 13:35898111-35898133 TCTTGGAAGCAGTAATGGGAGGG - Intronic
1107600204 13:42005145-42005167 TGTTGGATGTAGAAATCGGATGG + Intergenic
1111958858 13:94787214-94787236 AGTTTGCAGCTGAAATTGGGTGG + Intergenic
1111967796 13:94878464-94878486 GGATGGAAGCAGAGATTGGAGGG + Intergenic
1112261050 13:97878877-97878899 AGTTTGAAGCAGCTTTTGGATGG - Intergenic
1112443374 13:99441884-99441906 AGACGGAGGCAGAGATTGGAGGG + Intergenic
1113129319 13:107017677-107017699 AGATGGAAGCAGCACTGGGAAGG - Intergenic
1113261354 13:108567214-108567236 TGATGGAAGTAGAAATAGGAAGG + Intergenic
1114179514 14:20353836-20353858 TGTGGGAGGCAGAACTTGGATGG + Intronic
1114683805 14:24508495-24508517 AGTTGGGGGCAGGAAATGGAGGG + Exonic
1115068426 14:29294033-29294055 AGTAGGCAGAAGAATTTGGAAGG - Intergenic
1116727798 14:48584199-48584221 AGTGGGAAGTAGAAACAGGATGG + Intergenic
1117833795 14:59780914-59780936 AGATGGAATCAGAATTTGGGGGG - Intronic
1121317088 14:92968697-92968719 AGGTGGGAGCAGGAATTGGGTGG + Intronic
1121675728 14:95751170-95751192 GGTTGGAAGCAGATACTGAAGGG - Intergenic
1122823151 14:104357084-104357106 AGATGGAAGCAGAGACTGGAAGG + Intergenic
1123483440 15:20658494-20658516 AGTAGGAACCAGGAATTGTAGGG - Intergenic
1124212001 15:27771093-27771115 AGAAGGAAGCAAAAAATGGAGGG - Intronic
1124395546 15:29298044-29298066 AGTTTGAAACAGAAAATGTATGG + Intronic
1127136689 15:55931316-55931338 AGTGGGTAGCAGGAATAGGAGGG + Intronic
1128167474 15:65478822-65478844 TGTTGGAAGCAGAAGGTGGGAGG - Intronic
1128445713 15:67758190-67758212 AGTTCTGATCAGAAATTGGAGGG + Intronic
1129833002 15:78682750-78682772 TGTTGGAAGCATAGATTGGAGGG + Intronic
1130578894 15:85117336-85117358 AGTAGGAAGCTGAACCTGGAAGG + Intronic
1132101370 15:99025772-99025794 TGTTGGCAGCAGAACTTGCAGGG + Intergenic
1133050516 16:3114840-3114862 AGAAGGAAGCAGAGACTGGAGGG - Intronic
1133966409 16:10535202-10535224 AGTTTGAAGCAGAACAGGGAGGG + Intronic
1134005618 16:10817377-10817399 AGCTGGAAGCAGAACTGGGTGGG + Intronic
1134157775 16:11857779-11857801 AATCTGAAGCAGAAATTAGAAGG - Intergenic
1134790559 16:16985727-16985749 AGTTTGAGGCAGAAATAGGCAGG + Intergenic
1137720406 16:50624539-50624561 AATTGGAAACAGGAAGTGGAGGG - Intronic
1137839257 16:51624891-51624913 ACTTGGAAGCAGGAAATTGATGG + Intergenic
1139825278 16:69752271-69752293 AGTTGGAAGCAGAGTTTGTTGGG - Exonic
1140641204 16:76975612-76975634 ATTTGGAATCAGAATTTGGAAGG - Intergenic
1141057300 16:80830506-80830528 AGATGGAGGCAGAGATTGGAGGG - Intergenic
1141685724 16:85568784-85568806 AGATGGGAGCAGAAATCAGAGGG + Intergenic
1144067375 17:11636767-11636789 AGGAGGAAGCAGAACTTGGTAGG + Exonic
1146174399 17:30655877-30655899 AGACGGAAGCAGAGGTTGGAAGG + Intergenic
1146347855 17:32071915-32071937 AGACGGAAGCAGAGGTTGGAAGG + Intergenic
1147743321 17:42680802-42680824 AGCTGGAAGCAGAGGTAGGAGGG - Intronic
1148250810 17:46078355-46078377 AGTGGAAAGCAGTAATTGGAAGG - Intronic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150787679 17:68176055-68176077 AGTGGGAAGCAGAGAGTGGGAGG + Intergenic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1152051597 17:77983182-77983204 AATGGGAAGCAGAAATTCTAGGG - Intergenic
1155039706 18:22054727-22054749 GTTTGCAAGCAGAATTTGGAGGG - Intergenic
1155570621 18:27188599-27188621 AGTTGGAGGCATAAATAAGAAGG - Intergenic
1155710748 18:28875661-28875683 ATTTGCAAGCAGAAGTTGGCTGG + Intergenic
1156184489 18:34645971-34645993 AGTTAGAAGGATAAATAGGAGGG - Intronic
1156535899 18:37864231-37864253 AATTTGTAGCAGAAAGTGGAAGG + Intergenic
1157108350 18:44796024-44796046 GATTAGAAGCACAAATTGGAAGG - Intronic
1157213032 18:45760128-45760150 AGTTGGAGGCAGGAAGTGGTGGG - Intergenic
1157267338 18:46237779-46237801 TGTTGGAAGATGAAGTTGGAAGG + Intronic
1159230616 18:65603905-65603927 AGGTAGAAGCAGTAATAGGAAGG - Intergenic
1159700272 18:71617661-71617683 AGTTAGAAGAAGAAAATGGGAGG + Intergenic
1160196455 18:76759359-76759381 AGATGGAAGCAGAAAGTTCACGG - Intergenic
1163068355 19:14816423-14816445 AGCAGGCAGAAGAAATTGGAAGG + Intronic
1165605196 19:37096665-37096687 AGTAGGAACCAGAAAGTAGATGG - Intronic
1165893604 19:39128903-39128925 AGTTGGAAGCAGAATTTCCATGG - Intronic
1166345390 19:42162237-42162259 AGTTGGAAGCAGATATGCCAGGG - Intronic
1166975409 19:46602429-46602451 AGGTGGAAGGAGAAAATGAATGG + Intronic
1168171025 19:54589036-54589058 AGATGGAGGCAGAAACTGGTGGG - Intronic
925337459 2:3108644-3108666 AGTTGGAAGCAGATGATTGAGGG - Intergenic
926502072 2:13668089-13668111 AAATGGAGGCAGAAATTGGAGGG + Intergenic
927859555 2:26551996-26552018 TGATGGTAGCTGAAATTGGATGG + Intronic
928058530 2:28084462-28084484 GTTTGAAAGCAGAACTTGGATGG + Intronic
928879432 2:36081319-36081341 ATTTGGAGGGAGAAAATGGAGGG - Intergenic
929627135 2:43420991-43421013 ATCTAGAAGCAGAGATTGGAAGG - Intronic
929849281 2:45568682-45568704 ATTTTCAAGCAGAAATTAGAAGG + Intronic
930480855 2:51946720-51946742 AGCAGGAAGAAGAAAGTGGAAGG - Intergenic
930520007 2:52453867-52453889 AGTTAGAAGAAGAATTTGAAAGG - Intergenic
930687918 2:54329286-54329308 AGGTTGAAGCAGAAATTAGGGGG + Intergenic
932110025 2:68990309-68990331 AGACGGAGGCAGAGATTGGAGGG - Intergenic
935517016 2:104052431-104052453 AATTGGGAGCAGGTATTGGAAGG + Intergenic
936002472 2:108847375-108847397 AGTTGGCAGCAGAGACTGTATGG + Intronic
936675178 2:114706515-114706537 AGATGAAGGCAGAAATTGCAGGG - Intronic
936821524 2:116527835-116527857 AGGTGAAGGCAGAGATTGGAGGG - Intergenic
937398148 2:121556948-121556970 ATTTGGTAGCAGAACTAGGATGG - Intronic
937639823 2:124199185-124199207 AGCTGGAAGGAGAAAATGAAAGG + Intronic
937942951 2:127302414-127302436 AGTTGGAGGCAGGGATGGGAAGG - Exonic
938558306 2:132446742-132446764 AGATGGGAGCAGAAATGGAATGG + Intronic
938949156 2:136241355-136241377 ACATGGAAGCAGCAATTAGAGGG - Intergenic
939833092 2:147096019-147096041 AGGTGGAAGGAGAAACTGCAGGG - Intergenic
940688996 2:156891172-156891194 AGAAGGAAGCAGAAATGAGATGG + Intergenic
941295408 2:163733386-163733408 TGCTGAGAGCAGAAATTGGATGG - Intronic
942129279 2:172862418-172862440 AGTTGGGACCAGAGAATGGAAGG - Intronic
942372567 2:175300860-175300882 AGCTGGAAGGAGAGATTGGCTGG + Intergenic
942494562 2:176526237-176526259 ATTGGGAAGAAGAAATTGCAAGG - Intergenic
943541877 2:189225747-189225769 AGTTGAACACAGAATTTGGAGGG + Intergenic
944692471 2:202170321-202170343 AGTGAGAAACAGAGATTGGAAGG - Intronic
944957678 2:204831204-204831226 AGTAGGAAGCAGAACTTCAAAGG + Intronic
945441503 2:209885437-209885459 AGATAAAAGAAGAAATTGGAAGG + Intronic
946734767 2:222743297-222743319 AGGTGGAGGGAGAAAGTGGAAGG - Intergenic
947002430 2:225472331-225472353 AGTAAGAAGCAGGAATTTGAAGG + Intronic
947021529 2:225682769-225682791 AATTTGAATCAGAAATAGGATGG + Intergenic
947099410 2:226603742-226603764 ATTTGGAAGTAGCAATTGGGAGG + Intergenic
948382107 2:237557994-237558016 AGATGGAAGCAGAGACTGGAGGG - Intergenic
948458800 2:238119380-238119402 AGTTGGATGCAGGAGGTGGATGG + Intronic
1168890493 20:1292810-1292832 AGGTGGCAGCAGAAAATGGGAGG - Intronic
1169202766 20:3721316-3721338 AGTAGACAGCAGAAATTAGAGGG + Intergenic
1169632795 20:7651810-7651832 TATTGGAACCAGAAATTGGGAGG + Intergenic
1170917377 20:20640466-20640488 TGATGGAAGCAGGAATAGGAGGG - Intronic
1170919958 20:20668699-20668721 AGTTGCCAGGAGAAATTGGTGGG + Intronic
1171404393 20:24900190-24900212 AGTTGGAAGCAGAGGTTAGTGGG - Intergenic
1171465587 20:25325575-25325597 AGATGGAGGCAGAGATTTGAGGG + Intronic
1171541129 20:25957516-25957538 AGTTTGAAACAGCAACTGGAAGG - Intergenic
1171799938 20:29602824-29602846 AGTTTGAAACAGCAACTGGAAGG + Intergenic
1171844147 20:30253861-30253883 AGTTTGAAACAGCAACTGGAAGG - Intergenic
1172859761 20:38039020-38039042 AATTGGAACCAAAAATTGTAGGG + Intronic
1173042002 20:39473277-39473299 AGTTGAAACCAGAAACTAGATGG - Intergenic
1174723152 20:52835000-52835022 AGTTGAAAGCATAATTTGGCTGG - Intergenic
1175016582 20:55797625-55797647 AATTGGGAGTAGAGATTGGAAGG - Intergenic
1175125247 20:56746655-56746677 AGTTGGTGGCAAAACTTGGATGG + Intergenic
1175201051 20:57277888-57277910 TGTTGGAAGCAGAGATGGGTGGG - Intergenic
1175655534 20:60766517-60766539 TGTGGGATGCAGAAATTGGCTGG + Intergenic
1175662004 20:60821426-60821448 AGATGAAATCAGAAATTGGAAGG - Intergenic
1177345460 21:19862661-19862683 AGGAGGAAGCAGAAACTCGATGG + Intergenic
1178235677 21:30838385-30838407 AGGTTGAAGCAGAAAGTGTAGGG - Intergenic
1179123012 21:38566324-38566346 TGGGGGAAGCAGGAATTGGAGGG - Intronic
1179140896 21:38724027-38724049 GTTTGTAAGCAGAATTTGGAGGG + Intergenic
1179263793 21:39784106-39784128 TCTGGGAAGCAGAAATTGAAAGG + Intronic
1181909662 22:26228575-26228597 AGGAGGAAGCAGAACTGGGAAGG - Intronic
1182987842 22:34737839-34737861 ACTAGGAACCATAAATTGGATGG + Intergenic
1184152161 22:42645595-42645617 TGTTGGGAGCAGACACTGGAAGG - Intronic
1184261342 22:43318659-43318681 AGTAGGGAGAAGAAATTGGCAGG - Intronic
951005150 3:17607371-17607393 AGTTGGAAGTAAAAGCTGGAGGG - Intronic
951097012 3:18644327-18644349 AGTTGGGAGCAGGAGTTGGCAGG - Intergenic
951528998 3:23681446-23681468 AGCTGGCAGAAGAAAGTGGAAGG + Intergenic
951768141 3:26223706-26223728 AGTTGCAGCCAGATATTGGAGGG - Intergenic
951808107 3:26669213-26669235 AGGTGAAAGCAAAAATTCGATGG + Intronic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
953927176 3:46988391-46988413 AGGTGGGAGCAGAAACTGGGAGG + Intronic
954860774 3:53688777-53688799 ATTTTAAAGCAGAAATTCGAAGG - Intronic
955380121 3:58431697-58431719 AGTGGGAAGCAGACCCTGGAGGG - Intronic
956140863 3:66145687-66145709 AGATGGAAATAGAAATTAGAAGG + Intronic
956702479 3:71970654-71970676 AGATGGAGGCAGAGATTGCAGGG + Intergenic
957288230 3:78244309-78244331 TGTTGAAACCACAAATTGGAAGG - Intergenic
957789610 3:84922155-84922177 AGGTGAAAGAAGAAATTGAAAGG + Intergenic
958068946 3:88584277-88584299 AGTTTGAAGGAGAAATGGTAAGG - Intergenic
959291781 3:104484583-104484605 ATTTGGAAGGAGTAAGTGGATGG + Intergenic
960591800 3:119373788-119373810 TGTTGGAAGTATAAATTGGTTGG + Intronic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
960747224 3:120903481-120903503 AGCTGGAAGGAGAATTTGGATGG - Intergenic
962887995 3:139645674-139645696 AGATGTAAGCAGAAATTGTTGGG - Intronic
963156931 3:142109262-142109284 ACTTGGCAGCAGAAAATGAAAGG + Intronic
964624625 3:158747476-158747498 AGTTGGAAACAGAAAATGACTGG - Intronic
965002896 3:162980578-162980600 AGACAGAGGCAGAAATTGGAGGG - Intergenic
965034361 3:163417989-163418011 AGTTGCAATCAGAAAATGGAGGG + Intergenic
965687097 3:171315730-171315752 AGATGGGAGCAGAGATGGGAGGG - Intronic
965891250 3:173516515-173516537 AGGTGGAAGGAAAAGTTGGAAGG - Intronic
966458076 3:180141002-180141024 AGTTGAAAGGAGAAGATGGAGGG - Intergenic
966760499 3:183413790-183413812 ATTTGTAAGGAGTAATTGGAAGG - Intronic
967426369 3:189332185-189332207 AGTTGGAAGTAGGAAGTGGTGGG - Intergenic
968718741 4:2182401-2182423 GGATGGAAGCAGAGACTGGAGGG + Intronic
969334542 4:6499920-6499942 ACTTGGAAGAAGAAAGGGGAAGG - Intronic
969870992 4:10104781-10104803 AGTAGGTAGCAGAGATTAGATGG - Intronic
971184407 4:24359723-24359745 CTTTGGAAACAAAAATTGGAAGG + Intergenic
971206554 4:24575638-24575660 TGTAGGAAGCAGAAATTGCTGGG - Intronic
971443898 4:26721415-26721437 ATTTGGAAGATAAAATTGGAAGG - Intronic
971511561 4:27432977-27432999 AGTTGGAAGCTGAACTGGGCTGG + Intergenic
971580413 4:28331566-28331588 AGATGGAGGCAGAGGTTGGAGGG + Intergenic
973647190 4:52961517-52961539 AGTTGGAAGGAGAAATGTCAGGG + Intronic
973696367 4:53494701-53494723 GGTTAGATGCAGAAATTGGAGGG - Intronic
973785454 4:54328563-54328585 AGTGGGAAGAAGAGCTTGGAGGG + Intergenic
974012285 4:56617888-56617910 AGAAGGACGCAGAATTTGGACGG - Intergenic
974925422 4:68292148-68292170 AATTGGTACCAGAAATAGGATGG - Intergenic
975916060 4:79326335-79326357 TGTTGGAAGCAGGTACTGGAAGG - Intergenic
976291464 4:83422527-83422549 AGATGGAGGCTGAGATTGGAGGG + Intronic
976324892 4:83759959-83759981 ATTTGGAAGGAGGAAGTGGAGGG + Intergenic
976385627 4:84454361-84454383 ACTTGGAAGCAGGAGTTGAAAGG + Intergenic
977152476 4:93530109-93530131 AATTGGAAGTAGAAAGTGAAAGG - Intronic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
978662423 4:111143610-111143632 AGTGGGAATCAGGGATTGGAAGG + Intergenic
979192688 4:117882243-117882265 AGTTGTAAGCAACAATTGTATGG - Intergenic
980438048 4:132805853-132805875 AGTTGGAAACAAAAATTACAAGG - Intergenic
980866648 4:138560978-138561000 AGTTGGAAGCAGAGTTTGTTGGG + Intergenic
981258356 4:142690419-142690441 AATTGGAAGCAGAAATTAAAAGG - Intronic
981635961 4:146879339-146879361 AGTTGGAAATAGAAATTGGATGG - Intronic
982458908 4:155643521-155643543 AGTTGGAAGCTGGAATAGGTTGG + Intergenic
983509156 4:168588868-168588890 ACTTGAAAGAAGAAATTGGCTGG - Intronic
983523587 4:168736781-168736803 AATTGGAAGCACAAACTTGAGGG - Intronic
984079748 4:175232734-175232756 AGTATGAAGCAGGAAATGGAGGG + Intergenic
984589565 4:181601903-181601925 AGCTGGAGGCAGAAATTGGAAGG - Intergenic
984897089 4:184550515-184550537 AGTTTGAAACAGCAACTGGAAGG + Intergenic
985050663 4:185987886-185987908 ATTTGGAAGCAGAAATCTAAGGG + Intergenic
987314088 5:16708149-16708171 AGTTGGGAGTAGAAGTTGGATGG - Intronic
987382526 5:17298926-17298948 AAGTGGAAAGAGAAATTGGAAGG + Intergenic
988231833 5:28489545-28489567 ATTTGGAAGAATAAATTAGAGGG - Intergenic
988535758 5:32066378-32066400 AGGTGGAAGCAGGACTTGGTTGG - Intronic
989103714 5:37841722-37841744 AGTTAGATTCAGAAATTAGAGGG + Intergenic
989496342 5:42114440-42114462 AATTGGAAGGACAATTTGGAAGG + Intergenic
989543899 5:42649982-42650004 AGTTGGAAGAAAAAATTAGTAGG + Intronic
989745144 5:44820258-44820280 AGTTGAAAGCAGAAGTTCAAGGG - Intronic
990056154 5:51581231-51581253 AGATGGAAGAGGAAAGTGGAGGG + Intergenic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
990828247 5:59926353-59926375 AGTTGCAAGCAGTAATAAGAGGG + Intronic
991916741 5:71613030-71613052 AGATGGAGGCAGACATGGGAGGG - Intronic
992246866 5:74834895-74834917 AGCTGGAAGCAGAAAGAAGATGG - Intronic
992856934 5:80871534-80871556 GCTTGGAAGCAGATATTGGGAGG - Intronic
993836011 5:92821361-92821383 GTTTGGAAGCAGCAATAGGAAGG + Intergenic
993941452 5:94063302-94063324 TGTTGGTAGCAGCAATTGGATGG - Intronic
994055398 5:95408539-95408561 ATTTGGAGGCAGAGTTTGGAGGG + Intronic
995064710 5:107846584-107846606 TGGTGGAAGCAGCAATTGGAAGG + Intergenic
995176942 5:109189012-109189034 AGGTGGAAGTAGAAATGGGAGGG - Exonic
995404484 5:111779267-111779289 GGTTGGAAGCAGGAACTAGATGG + Intronic
999795785 5:154988664-154988686 AGTGGGAAACAGAAAGAGGATGG - Intergenic
1000862511 5:166473356-166473378 AGAAAGAAGTAGAAATTGGAGGG + Intergenic
1001537428 5:172508126-172508148 AGATGGGGGCAGAGATTGGAGGG + Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003402088 6:5799092-5799114 ACTTGGAAGCAGTGACTGGATGG - Intergenic
1004280095 6:14273258-14273280 AGTCGGAAGCAGAAATGAAAAGG + Intergenic
1004829955 6:19465911-19465933 ATTTGGAAGAATAATTTGGAGGG + Intergenic
1005715648 6:28544565-28544587 AGTTGGAGGGGGAAGTTGGAGGG + Intergenic
1006048439 6:31319696-31319718 ACTCGGAAGTTGAAATTGGAAGG - Intronic
1006238006 6:32652694-32652716 AAGTGGAAGCATAAAGTGGAGGG + Intergenic
1006339164 6:33437004-33437026 AGATGGAGGCAGAAATTAGACGG - Intronic
1008121886 6:47627827-47627849 AGATGGAAACAGAATCTGGAAGG + Intergenic
1008150803 6:47949230-47949252 AGTTGGAAGCATCCATGGGAAGG + Intronic
1008795040 6:55292789-55292811 AGTTTGAAGCAGAAATGGCTTGG - Intergenic
1009900679 6:69804496-69804518 AGTTGGAAAGAGAAATTTTAAGG - Intergenic
1011194632 6:84768449-84768471 AGCTAGAAGCAGAAATGGGACGG + Intergenic
1013673196 6:112428186-112428208 AGATGGAAGAAGAAAATGTATGG + Intergenic
1013788285 6:113807421-113807443 ATATGGAAGCAGAGATTAGAGGG + Intergenic
1014457239 6:121650066-121650088 AATTGAAAGCAGAAAGTAGATGG + Intergenic
1014937962 6:127405946-127405968 ATATGGAATCAGAAAATGGAAGG + Intergenic
1015015424 6:128407043-128407065 AGTTGGAAGCAGAAATTGGAGGG - Intronic
1015346640 6:132168059-132168081 AGTTGGCAGCAGAAACTAGTGGG + Intergenic
1015431813 6:133140473-133140495 AGTTTTAAGGAGAAATTGCAAGG + Intergenic
1017044674 6:150336186-150336208 AGTTAGGAGCAGCAATTGGTTGG - Intergenic
1017434969 6:154407121-154407143 CTCTGGAAGCAGAAATGGGAAGG + Intronic
1018079085 6:160243448-160243470 ATTTGGAAAGACAAATTGGAGGG - Intronic
1018365935 6:163119920-163119942 ATGTGGAAGCAGAAAATGAATGG - Intronic
1018657927 6:166057750-166057772 AAGTGGAAGGAGAAATTGAAAGG - Intergenic
1020689567 7:11337906-11337928 AGATGAAAGCAGAAATTGGAAGG - Intergenic
1020945348 7:14599134-14599156 AGCTGGATTTAGAAATTGGAGGG + Intronic
1022632998 7:32103207-32103229 ATTTGGAAGCAGAAAAGGGAGGG + Intronic
1022812762 7:33885761-33885783 AGCTGGAGGAAGAAATAGGAGGG + Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1023750305 7:43365680-43365702 AGTTGGAAGTAAACATAGGAAGG + Intronic
1023950758 7:44842635-44842657 AATTTGAAGTAGAAAATGGAAGG - Intronic
1024117649 7:46208870-46208892 AGTGGGAAGCAGCACTTGAAGGG + Intergenic
1024575861 7:50763775-50763797 AGTTGGCAGCAGAGATGGAAGGG - Intronic
1024870630 7:53959128-53959150 CATTGGAAGGACAAATTGGAAGG - Intergenic
1025292567 7:57743752-57743774 AGTTTGAAACAGCAACTGGAAGG - Intergenic
1027607180 7:80314966-80314988 AGTGGAAAGGAGAAATTGAAGGG - Intergenic
1027744913 7:82061253-82061275 AGAGGGAAGAACAAATTGGATGG - Intronic
1028716190 7:93972556-93972578 AGATGTAAGCAGAAATGGGGCGG - Intronic
1028832178 7:95340313-95340335 AAGTGGGTGCAGAAATTGGATGG + Intergenic
1028925510 7:96353459-96353481 AGTTGGAAACATGAATTTGAGGG - Intergenic
1031079830 7:117247566-117247588 AGATGGAGGCAGAGATTGGAGGG - Intergenic
1031405427 7:121379960-121379982 AATAGGAAGCAGATTTTGGAGGG - Intronic
1032462687 7:132123709-132123731 AGTTTGAAACAGAAGTGGGATGG + Exonic
1032464830 7:132137673-132137695 ACTTGGAGGCAGGAATGGGAGGG + Intronic
1032553857 7:132811515-132811537 AAGTGGAGGCAGAAATTGAAAGG - Intronic
1033234575 7:139628084-139628106 AGAAGGAAGCAGAGATTAGAGGG + Intronic
1033992527 7:147305935-147305957 AGATGGAGGCAGAGACTGGAGGG - Intronic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1038042526 8:23736827-23736849 AGATCAAGGCAGAAATTGGAGGG - Intergenic
1038638940 8:29308564-29308586 CATTGGAAGGACAAATTGGAAGG + Intergenic
1039007035 8:33050894-33050916 AGTTGTAAACAGGAATTGGTTGG - Intergenic
1039144466 8:34430811-34430833 AGTTGGGTACATAAATTGGAAGG + Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041617637 8:59926722-59926744 AGTTGGAAGCAGCAATGGATTGG - Intergenic
1041921732 8:63189355-63189377 AGGTGGAAAGAGAAAATGGATGG + Intronic
1042175480 8:66033870-66033892 AGGTGGAAAGAGAATTTGGATGG + Intronic
1042852790 8:73233561-73233583 ATTGGGAAGCAGGAATGGGAAGG - Intergenic
1043015332 8:74933021-74933043 AGTTGAAAGGAGAAATTACAAGG - Intergenic
1043614025 8:82103372-82103394 AGTGGGCAGAAGAAAGTGGAAGG + Intergenic
1043855801 8:85263311-85263333 AGTGGGAAGAAGACAATGGAAGG + Intronic
1043961157 8:86420119-86420141 CGTTGGAGGCAGGAATTAGAGGG + Intronic
1044473575 8:92600578-92600600 AGATGGAGGCAGAGGTTGGAGGG + Intergenic
1044538889 8:93388222-93388244 AAGTGGAAGAAGAAAATGGAGGG + Intergenic
1045464463 8:102456961-102456983 ACTTGGAAGAATAACTTGGAAGG + Intergenic
1045889345 8:107135880-107135902 ATTTGGAAGCACAAAATGGTAGG - Intergenic
1045959290 8:107948355-107948377 AGGTTGAAAGAGAAATTGGAAGG + Intronic
1046730075 8:117715213-117715235 AGTTGGTACCAGAATTTGGGGGG - Intergenic
1047311556 8:123696718-123696740 GGTTGGAAGGAGAAAAGGGAGGG - Intronic
1047700925 8:127448580-127448602 GGATGGAAGCAGAATTTGTAGGG + Intergenic
1047754611 8:127908906-127908928 GGTTCAAAGCTGAAATTGGATGG - Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1049137833 8:140921036-140921058 AGCTTGAAGCAAAATTTGGAAGG + Intronic
1049843888 8:144790548-144790570 AGTTGGATGCAGTATTGGGAAGG - Intronic
1050814788 9:9796680-9796702 AGTAGAAAGCTGAATTTGGAAGG + Intronic
1051187123 9:14471946-14471968 AGATGGAGGCAGAGAATGGAGGG - Intergenic
1052136296 9:24915147-24915169 AGTTTGAAGCGGTAACTGGAAGG - Intergenic
1054163950 9:61701971-61701993 AGTTTGAAACAGCAACTGGAAGG + Intergenic
1055087433 9:72328347-72328369 AAATGGAGGCAGAGATTGGAGGG + Intergenic
1055194558 9:73572804-73572826 AGTGGGAAGGAGAGAGTGGAGGG + Intergenic
1055331386 9:75187613-75187635 AGACGGAGGCAGAGATTGGAGGG + Intergenic
1055803012 9:80061077-80061099 AGATGGCTCCAGAAATTGGAAGG + Intergenic
1055842399 9:80520415-80520437 CAATGAAAGCAGAAATTGGAGGG + Intergenic
1056017769 9:82408850-82408872 AGAAGGGAGAAGAAATTGGAAGG - Intergenic
1056231717 9:84552563-84552585 AGTTGGAGCCATAAATTGGTGGG - Intergenic
1057898343 9:98927619-98927641 AATTGGAAACAAAAATTGCAGGG - Intergenic
1058055846 9:100448081-100448103 AGTTGGAGGCTGAAGTGGGAGGG + Intronic
1058485471 9:105439585-105439607 ATTTGGCAGGAGAAATAGGAAGG - Intergenic
1058502939 9:105640071-105640093 AGATAGAAACAGAAATTTGAGGG - Exonic
1058524001 9:105839134-105839156 ACATGGGAGCAGAGATTGGAGGG + Intergenic
1058720971 9:107763407-107763429 ACTTGGGAGCAGGAGTTGGAGGG - Intergenic
1059412469 9:114141195-114141217 AGTTGTAAACAGAACTGGGATGG - Intergenic
1060032961 9:120231587-120231609 ATTATGAAGCAGACATTGGAAGG + Intergenic
1060039143 9:120284657-120284679 AGTTTGGAGGAGAAATTGGAAGG + Intergenic
1060303047 9:122387176-122387198 ATGTCCAAGCAGAAATTGGAAGG + Intronic
1060474690 9:123977884-123977906 AGATGGAAGCAGAAATTGGAGGG - Intergenic
1060476672 9:123992239-123992261 AGATGGAAGCAGAAATTGGAGGG + Intergenic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062182162 9:135196496-135196518 AATGGGAAGGAGAAATGGGAAGG - Intergenic
1185497725 X:568212-568234 AATTGGAACCACAGATTGGAGGG - Intergenic
1186023486 X:5283305-5283327 AGATGGAGGCAGATATTGGAGGG - Intergenic
1186607546 X:11107809-11107831 AGTCAGAAGCAGACACTGGAAGG - Intergenic
1186612069 X:11147455-11147477 ACTTGGAAGCAGAATTGTGAGGG + Intronic
1186942784 X:14529224-14529246 AATTTGAAGCAGAAAAGGGAAGG - Intergenic
1187301760 X:18057809-18057831 TGCTGGAAGCAGAAAGGGGATGG - Intergenic
1187413286 X:19069828-19069850 AGTTGTAAGAACAAATTGGAGGG - Intronic
1187811416 X:23181514-23181536 AGTTTGAAGCTGAAGTTGAATGG - Intergenic
1188082175 X:25857023-25857045 AATTGAAAGTAGGAATTGGATGG - Intergenic
1188299839 X:28495227-28495249 AGTTGGAAACAGAATATGCATGG - Intergenic
1189003651 X:36972324-36972346 AGTAGGAAGCAGTGAATGGAAGG - Intergenic
1189045986 X:37591577-37591599 AGTAGGAAGCAGTGAATGGAAGG + Intronic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1189512692 X:41679262-41679284 AGATGGCAGCAGAGATTGAATGG - Intronic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190259688 X:48790089-48790111 AGAAGGATGAAGAAATTGGAGGG + Intronic
1190738426 X:53271115-53271137 AGGTGAAATCAGACATTGGAGGG - Intronic
1192370879 X:70512011-70512033 GGTTGGAAGCAGACTATGGAGGG - Intergenic
1193666172 X:84320555-84320577 AATTGGAAACAGAAACTTGATGG + Exonic
1193969999 X:88039302-88039324 TGTTGGCAGCAGCAATAGGAAGG - Intergenic
1194230312 X:91314516-91314538 AGCAGGCAGAAGAAATTGGAAGG - Intergenic
1194824989 X:98550762-98550784 ACTTGGAATCTGATATTGGAGGG + Intergenic
1195463655 X:105155814-105155836 AGTTGGGAGAGGAAATGGGAGGG + Intronic
1196608978 X:117689084-117689106 AGTTGTAACCAGAAAAAGGAAGG - Intergenic
1197037300 X:121889938-121889960 GGTTGGAAGAAGGAATAGGATGG + Intergenic
1197710589 X:129664237-129664259 AGATGGAGGCAGAGATTGGAGGG - Intergenic
1197868809 X:131046370-131046392 AGTGGGACCCAGAGATTGGAAGG - Intergenic
1198587186 X:138135486-138135508 AGTGTGAAGAATAAATTGGAGGG - Intergenic
1199326919 X:146510191-146510213 AGGTGGGAGCAGAAATAGGTGGG - Intergenic
1199515096 X:148667425-148667447 AGTTGTAAACAGCAACTGGATGG - Intronic
1200375697 X:155777449-155777471 ACTTGGTAGAAGAAATTGAAGGG + Exonic
1200408982 Y:2843145-2843167 ACTTGGAAGCAGAAACTGACAGG - Intronic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic