ID: 1015022177

View in Genome Browser
Species Human (GRCh38)
Location 6:128489859-128489881
Sequence CTGAAAATGCAGATGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015022177_1015022181 8 Left 1015022177 6:128489859-128489881 CCATTCTGCATCTGCATTTTCAG 0: 1
1: 0
2: 4
3: 41
4: 427
Right 1015022181 6:128489890-128489912 CCACACTTACTCACCCTCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015022177 Original CRISPR CTGAAAATGCAGATGCAGAA TGG (reversed) Intronic
901762706 1:11480873-11480895 CTGAAAATGGAGATTCTGTAAGG - Intronic
904180633 1:28664287-28664309 CTGAGAATGTGGATGCAGAAGGG + Intergenic
904899799 1:33847935-33847957 CTGGAAATCAAGATGAAGAATGG - Intronic
905439759 1:37987668-37987690 CTGAAATTGCAGATTACGAAAGG - Exonic
905470791 1:38190230-38190252 CTGACTATGCAGATGCAGGAAGG - Intergenic
905592804 1:39179308-39179330 CAGAAACAGAAGATGCAGAAGGG - Intronic
905887082 1:41497165-41497187 GTGGAAATGCAGGTGCAGAGGGG + Intergenic
906837836 1:49103110-49103132 CTGAAAATGCTGAGGGAGATTGG - Intronic
907161498 1:52373523-52373545 CACAAAATGCAGAGGCAGAATGG + Intronic
907317385 1:53581156-53581178 CTGATAATGCCGATGAAGAAGGG + Intronic
909320125 1:74274925-74274947 CTAAAAATGAAAAAGCAGAATGG + Intronic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911473329 1:98345453-98345475 CTGGAAATGTGTATGCAGAAGGG + Intergenic
911499741 1:98670418-98670440 CTGGAAATGCAGCTGCAGAAAGG + Intronic
915198595 1:154209386-154209408 ATGAAAATGAACATGTAGAAAGG - Intronic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917497058 1:175550136-175550158 CAGAAAAAGCACCTGCAGAAGGG + Intronic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
920414192 1:205787476-205787498 CTGAGATGGCAGATACAGAAAGG - Intergenic
923355741 1:233153579-233153601 GTGAAAATGCTAATGCATAAGGG + Intronic
924298537 1:242613323-242613345 CTAAAACTCCAGATGCACAAGGG - Intergenic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
1063252229 10:4286232-4286254 AGGAAGAGGCAGATGCAGAAAGG - Intergenic
1063639117 10:7813558-7813580 CTGAAAGAGCAGATGCAAGATGG + Intergenic
1063751403 10:8952592-8952614 CTAAAAATGCTGATGCAGAAGGG + Intergenic
1063863406 10:10337663-10337685 CTGAAAATAAAGATATAGAAAGG - Intergenic
1065598861 10:27347998-27348020 TTGCACTTGCAGATGCAGAACGG + Intergenic
1065791187 10:29262424-29262446 GTGAAAAGGCAGATGGAGAAAGG - Intergenic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1068254206 10:54487322-54487344 TTGAAAATGGAGACTCAGAAGGG + Intronic
1069187679 10:65446217-65446239 TTAAAAATGCAGATCCAGAAAGG - Intergenic
1070270553 10:74950406-74950428 CTGTTACTGCAGATGCAGACGGG + Intronic
1070284803 10:75075116-75075138 CTGAAGATGCAGCTTCAGCAGGG + Intergenic
1071414573 10:85429013-85429035 TAGAAAGTGCAGTTGCAGAATGG - Intergenic
1073758043 10:106602149-106602171 GTAAAAATGCAGATGCAAATGGG + Intronic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1076146741 10:128127777-128127799 CTGCAAATGCAGAAGCAGTGAGG + Intergenic
1076246010 10:128948529-128948551 TTGAAAATGTAGACACAGAATGG + Intergenic
1076265605 10:129107624-129107646 ATGAAGATGCAGATGGGGAAGGG + Intergenic
1076612982 10:131737936-131737958 GTGCAAGTGCAGAGGCAGAAAGG + Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1077052479 11:573601-573623 CTGAAAATGCCCCTGCAGGAAGG - Intergenic
1077506631 11:2932578-2932600 CCCAAGCTGCAGATGCAGAAAGG + Intergenic
1077700487 11:4436968-4436990 CTTTAAATGCAGATGGTGAAGGG + Intergenic
1078264853 11:9747353-9747375 CTGATAATGAAGATGAAGAAAGG - Intronic
1079566843 11:21892810-21892832 CTGAATGTGCAGTTGCAAAATGG - Intergenic
1079776794 11:24541515-24541537 CTGAAAATGAAGATGGTAAAAGG - Intronic
1079907465 11:26266748-26266770 TTCTAAATGCAGATGCAGAGTGG + Intergenic
1080787333 11:35487477-35487499 CTGGAAGTGCAGCAGCAGAAGGG - Intronic
1081996959 11:47371911-47371933 CAGAAAATGCAAAAGCAGAAAGG - Intronic
1082710072 11:56544149-56544171 CTCAAAATGCACAGTCAGAATGG + Intergenic
1083298355 11:61727330-61727352 CTGCAAATTCAAATGCCGAATGG - Intronic
1084632694 11:70364725-70364747 CTGAAAATGAAGGTGCTGAGTGG + Intronic
1086353942 11:85972593-85972615 CTGCAAATCAAGATGCAGAGTGG + Intronic
1087448025 11:98279912-98279934 AGGAAAATGAAGATGAAGAATGG - Intergenic
1087670128 11:101096587-101096609 CTGTATATGCAGGTGAAGAAAGG + Intronic
1088325660 11:108598399-108598421 CTGGAAATGCAGAGGCACCAAGG + Intergenic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1090378699 11:126309886-126309908 CAGAAAAGGCAGAAGAAGAAGGG - Intronic
1090420107 11:126568852-126568874 ATGAAAGTGGAGATGCAGAGAGG + Intronic
1090723984 11:129505287-129505309 CTGAAGCTGCAAATGCAGAAAGG + Intergenic
1090828999 11:130408030-130408052 CTGAAGATCCATCTGCAGAAAGG + Intronic
1090885710 11:130874432-130874454 CTGAAACTGCAGCAGCAGGAAGG + Intergenic
1091006785 11:131960870-131960892 CTGAAGATTCAGGTGCAGGAGGG + Intronic
1092104949 12:5914689-5914711 CTGAAATTGGAAATGGAGAATGG - Intronic
1093602056 12:21039333-21039355 CTTAAAAGGGAGATGGAGAAAGG - Intronic
1095174136 12:39071264-39071286 CTGAAAAGACAGATCCAGGATGG - Intergenic
1095303473 12:40614095-40614117 CAAACAATCCAGATGCAGAAGGG - Intergenic
1095327260 12:40910642-40910664 CTGAAAATGCAAATTCAGGCTGG - Intronic
1095513201 12:42976085-42976107 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1095898317 12:47302764-47302786 GAGAAACAGCAGATGCAGAAAGG + Intergenic
1096394021 12:51252015-51252037 CAGAAAGTGCAGATGAAGAAAGG + Intronic
1096900422 12:54873202-54873224 CTGAAAAGGCAGTGGCTGAATGG + Intergenic
1098108773 12:67099416-67099438 GTGAAACTTCAGAGGCAGAAAGG + Intergenic
1098409124 12:70160760-70160782 CTGGATATTCATATGCAGAAGGG + Intergenic
1098817380 12:75184509-75184531 CTGAAAAGGGAGATGTAGTAAGG - Intronic
1099463807 12:82957492-82957514 CTGCAAAGGCAGAAGAAGAAAGG + Intronic
1100357706 12:93847130-93847152 CTGAAAGTGCAGATGTAGAATGG + Intronic
1101454481 12:104816023-104816045 GAGAAAATTTAGATGCAGAAAGG + Intronic
1101974156 12:109340798-109340820 TTGAACATGCATATGCAAAAAGG - Intergenic
1102656660 12:114487690-114487712 CTGAAGAAGAAGATGTAGAATGG + Intergenic
1104413744 12:128580803-128580825 GTGAAAATGCAGATGCCTATGGG - Intronic
1104619559 12:130301198-130301220 CTGCAAAGGGAGATGCAGAAAGG - Intergenic
1104999883 12:132683361-132683383 CTGAAGATGAAGAAGCAGCAAGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107160458 13:37220229-37220251 CTGAAAATGCATATCATGAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108163885 13:47671361-47671383 AGGATAATGCAGAGGCAGAAAGG + Intergenic
1108176105 13:47794485-47794507 CTGGAAATGTACATGCAGCAGGG - Intergenic
1108441281 13:50455620-50455642 GTGAGAATGCATATTCAGAAGGG + Intronic
1109636340 13:65122796-65122818 GTGAAAATACAACTGCAGAATGG - Intergenic
1110948085 13:81449753-81449775 GTGAAAATTCAGATGTAAAAAGG + Intergenic
1112986939 13:105462245-105462267 CTGAAATTGCAGAAGCAAAGTGG - Intergenic
1113399660 13:109979248-109979270 CTCAAAATGCTGAAGCAGGAGGG - Intergenic
1114059009 14:19001989-19002011 CTGCAAAGGCAGTGGCAGAAAGG - Intergenic
1114103534 14:19399765-19399787 CTGCAAAGGCAGTGGCAGAAAGG + Intergenic
1114604881 14:23988617-23988639 GTGGACAAGCAGATGCAGAAGGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115229310 14:31141857-31141879 GTGAAAATGAAGATGATGAAAGG - Exonic
1115749403 14:36473882-36473904 CTGAAAATGCAGAACAAAAATGG + Intronic
1116104204 14:40478045-40478067 ATGAAAATACGGATACAGAAAGG - Intergenic
1117884585 14:60346933-60346955 GTGAAAATGGATAGGCAGAAAGG + Intergenic
1118690376 14:68333089-68333111 CAGTATATGCAGAGGCAGAAAGG - Intronic
1119090595 14:71777574-71777596 CTGAAAATGCCTATGAAGCAAGG + Intergenic
1120401914 14:84043042-84043064 CTGAAAATGCAGATGGCAAGTGG - Intergenic
1120511579 14:85421887-85421909 CTGATAATGAAGAAGTAGAATGG - Intergenic
1120634305 14:86931998-86932020 CTAAAAATGAAGATGCAGGCCGG - Intergenic
1121581431 14:95035060-95035082 CAGAAAAGGCAGCTGCAGCAGGG + Intergenic
1122305140 14:100760562-100760584 CTGACTATCCACATGCAGAAAGG + Intergenic
1122450581 14:101803352-101803374 CTGGATATTCATATGCAGAATGG + Intronic
1124406850 15:29400801-29400823 CTTCTAATGCAGATGCAGAGAGG - Intronic
1124858365 15:33412711-33412733 CTGAAAATGCAGCAGTGGAATGG - Intronic
1125456510 15:39865530-39865552 CAGAAAATGGAGACCCAGAAGGG + Intronic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1126423281 15:48498592-48498614 TTCAGAATGCAGATGGAGAATGG + Intronic
1126773775 15:52082377-52082399 CTGGATATGCAGCGGCAGAAAGG - Intergenic
1127462103 15:59208742-59208764 CAGAAACTTCAGATGCAGATTGG - Exonic
1127994267 15:64143672-64143694 CTGAGAATGAAGATGGGGAAGGG - Intronic
1128005931 15:64240855-64240877 CTGATAAAGCAGATACACAAAGG + Intronic
1128019369 15:64376883-64376905 CTGAAAATAAATATGCAGGAGGG - Exonic
1128776705 15:70325975-70325997 GTGAAAATAGAGATCCAGAAGGG - Intergenic
1128966479 15:72063183-72063205 CTGGACATCCATATGCAGAAGGG + Intronic
1129419666 15:75414087-75414109 TTGAAAATTCAGCTGCAAAAAGG + Intronic
1129594292 15:76948410-76948432 CTGCAAATGAAGATCCAGAATGG + Exonic
1129733978 15:77949476-77949498 CCCAAAAAGCACATGCAGAAAGG - Intergenic
1129841604 15:78746516-78746538 CCCAAAAAGCACATGCAGAAAGG + Intergenic
1130756793 15:86772659-86772681 CTGAAAATGAAGACACAGAATGG + Intronic
1131023228 15:89117586-89117608 CTGAGAAGGCACAGGCAGAATGG - Intronic
1132645653 16:998181-998203 CTGAAAATGCTGTGGGAGAAGGG + Intergenic
1132761364 16:1510054-1510076 CGGAGAGTGCAGATGCAGGAAGG + Exonic
1133134330 16:3699176-3699198 CTGAGACTGCAGCTGCAGAGTGG - Intronic
1133552081 16:6866435-6866457 CTTAACATGAAGATGCAGATGGG - Intronic
1133737083 16:8624062-8624084 CTGAAGAAACAGATGCAGAGAGG + Intronic
1134269166 16:12718665-12718687 CTGAAAATGCACATTCAGCTGGG + Intronic
1135819298 16:25666765-25666787 TTGAAAATACAGAGTCAGAAGGG + Intergenic
1137445678 16:48530603-48530625 CTGCACAGGCAGATGCAGCAAGG - Intergenic
1137984085 16:53093072-53093094 ATTAAAGTGCAGATGCAGCAGGG - Intronic
1138454494 16:57113574-57113596 CCCAAAGTGCAGATGCAGAGTGG + Intronic
1138601832 16:58060244-58060266 CTGAAAATGCAGGTGGAGCCAGG - Intergenic
1138644011 16:58409648-58409670 TTGAAAAAGCAGATACAGAAAGG - Intergenic
1139282820 16:65784804-65784826 CTGTAAAGGCAGAAGCAGAGTGG + Intergenic
1139390106 16:66601905-66601927 CCCAAACTGCAGCTGCAGAATGG - Intergenic
1140054548 16:71514562-71514584 CCTTGAATGCAGATGCAGAAAGG - Intronic
1140210076 16:72962680-72962702 GTGAAAATGCAGATTCTGATGGG - Intronic
1142880213 17:2878083-2878105 CTGGAAATGCAGATGCGTAAAGG + Intronic
1144001754 17:11061655-11061677 CTAAAAAAGCAGCTGCAGATGGG - Intergenic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1144530005 17:16028415-16028437 CTGAAATTGCAAAAGCAAAAAGG - Exonic
1146002388 17:29139185-29139207 CCGCAACTGCAGTTGCAGAAGGG + Intronic
1146626464 17:34438983-34439005 TTGAAACTTCAGATGCAGCAAGG - Intergenic
1150456618 17:65311496-65311518 CTGAAACTGCAGCTGCTGATGGG - Intergenic
1150941249 17:69696934-69696956 CTCAATATCCAGAGGCAGAAAGG - Intergenic
1150974866 17:70074127-70074149 GAGAAAATGGAGTTGCAGAAAGG + Intronic
1152151655 17:78604913-78604935 CTGAGAATGTATATTCAGAATGG - Intergenic
1155700292 18:28734803-28734825 ATGAAAATGAAAATTCAGAAAGG + Intergenic
1156588936 18:38464173-38464195 CTGAAAGTGATGATGCTGAATGG - Intergenic
1158077363 18:53546150-53546172 CTGAAGATGCAGTTGAAGACAGG + Intergenic
1158562052 18:58522701-58522723 CTGAAAAATCCCATGCAGAAGGG + Intronic
1158832573 18:61296430-61296452 CTGAAAATGCAAATGCATGTAGG - Intergenic
1158887039 18:61838430-61838452 CTGGAAGTGCAGATCCAAAATGG - Intronic
1159027055 18:63192798-63192820 TTGAAAATGCAGAAGTAGACAGG - Intronic
1159050749 18:63419125-63419147 TTTAAAATGCAGATACAGCAGGG + Intronic
1160605375 18:80045934-80045956 CTGACAACGCAGATGAAAAAGGG + Exonic
1162456131 19:10786135-10786157 CTGTAGATGCAGATGCAGCCGGG + Intronic
1163752147 19:19084252-19084274 CTGACTATGCAGATGTAGAGGGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
1202646226 1_KI270706v1_random:144549-144571 CTGAGATGGGAGATGCAGAAGGG - Intergenic
925022938 2:586289-586311 CTGAAAAGGAGGATGCAGCATGG - Intergenic
926604170 2:14879965-14879987 TTGAAAATACAGAGGCATAAAGG + Intergenic
926789545 2:16556464-16556486 GTGACAATGCAGATGTGGAAGGG + Intronic
927360970 2:22232990-22233012 ATGAAAAAGCAGAAACAGAAAGG + Intergenic
927408268 2:22796836-22796858 CTGCAGAGGCAGATACAGAAGGG + Intergenic
927515600 2:23670068-23670090 CTGAGAACCCAGATGCAGGAAGG - Intronic
928050840 2:27993572-27993594 CTTAAAATGAAGTTGCATAAAGG + Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
931590946 2:63882620-63882642 CTGAACAGTCAGATCCAGAAAGG - Exonic
931964009 2:67513472-67513494 TTGAATCTGCAGATGCAGTACGG - Intergenic
932220697 2:69996827-69996849 CTGAGAATGCTGATGGATAAGGG + Intergenic
932423428 2:71614357-71614379 GTGAAACTACAGATGCAGCAAGG - Intronic
932848731 2:75162132-75162154 TTGAAAATCCATTTGCAGAATGG + Intronic
935634524 2:105239840-105239862 CAGAAAATTGAGATGAAGAAGGG + Intergenic
935922361 2:108030416-108030438 TTTAAAATGGAGATGCAGAGTGG + Intergenic
936416413 2:112318263-112318285 CTCAAAATCCAGAAGCAAAAAGG + Intronic
936559566 2:113525143-113525165 CTGAGAAAGCAGATGCCCAAGGG + Intergenic
936823360 2:116551699-116551721 CTGAAATTGCAGAAGTGGAATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
939334393 2:140806965-140806987 CTCAAACTGCATATGCAGAAGGG + Intronic
939519761 2:143215177-143215199 CTGAAAATGGAGATTCAGGATGG + Intronic
939552819 2:143636697-143636719 TTGAAAGTGCAGAGGAAGAAAGG - Intronic
940023136 2:149177239-149177261 CTGGAAATGCATTTGAAGAATGG - Intronic
940737416 2:157469056-157469078 CTGAAGAAGGAGAAGCAGAATGG - Intronic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941932239 2:170953736-170953758 CTGAAGAACCAGATGTAGAAAGG + Intronic
942245425 2:174003686-174003708 CTGAAAGTGCAGAGGTAGATCGG + Intergenic
942818483 2:180081331-180081353 AGGAAAATACAGATGCAGGAGGG - Intergenic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943089680 2:183358887-183358909 ATGGAAATGCAGTTTCAGAAGGG - Intergenic
943156835 2:184190478-184190500 CTGATAATGCAGATGAATAATGG + Intergenic
943347277 2:186754436-186754458 CTGAAGAACCAGATGCTGAAAGG + Intronic
943492802 2:188577483-188577505 ATGAAAGTGAAGTTGCAGAATGG - Intronic
944455302 2:199887489-199887511 CTGAGAAAGCAGGTGTAGAATGG + Intergenic
944604335 2:201337342-201337364 CTGAATAACCATATGCAGAAGGG - Intronic
944875094 2:203955728-203955750 TTTAAAATGCAGTTGCTGAAAGG + Exonic
946858862 2:223980759-223980781 TACAGAATGCAGATGCAGAAGGG + Intronic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
947486951 2:230559262-230559284 GAGAAACAGCAGATGCAGAAAGG + Intergenic
948153076 2:235759767-235759789 TCGAAAATGCATATGAAGAAAGG - Intronic
948275890 2:236708391-236708413 CTGACATTTCAGATGAAGAAGGG - Intergenic
948796809 2:240407938-240407960 CTGAATATTCAGATTCAGACAGG + Intergenic
1169666223 20:8039339-8039361 ATGAAACTGTAGATGCAGAGAGG - Intergenic
1170448881 20:16460670-16460692 ATCAAAATGAAGATGAAGAATGG + Intronic
1170470472 20:16663528-16663550 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1170507236 20:17039849-17039871 CTGAAAGTCCTGATGTAGAAAGG - Intergenic
1170852989 20:20020893-20020915 TTGAAGATGCAGATGCAGGAGGG + Intronic
1172926547 20:38542172-38542194 CAGAAAATGTAAAAGCAGAAAGG + Intronic
1173151357 20:40569069-40569091 CTGCAGATGGAGATGTAGAAAGG - Intergenic
1173265703 20:41478089-41478111 CTCAAAATGCTGATATAGAAGGG + Intronic
1174554719 20:51385912-51385934 CTCAAATTGCACATGCAGACAGG - Intergenic
1174708666 20:52682838-52682860 CTGAAAAAGCAGTTGCAGGTGGG + Intergenic
1175149136 20:56919334-56919356 GAGAAAAGGCAGATGCAGAAAGG - Intergenic
1175639993 20:60620934-60620956 GTAAGAATGCAGAAGCAGAAAGG - Intergenic
1176669124 21:9715645-9715667 GGGAAATGGCAGATGCAGAAAGG + Intergenic
1177252201 21:18608025-18608047 CTGAAAGTTTAGATGCAAAAAGG - Intergenic
1177682385 21:24389333-24389355 CTGAAATGGAAGATGGAGAAAGG - Intergenic
1178334264 21:31730675-31730697 TTTAAAATGCAGTTACAGAATGG - Intronic
1180477493 22:15724605-15724627 CTGCAAAGGCAGTGGCAGAAAGG - Intergenic
1180917588 22:19499687-19499709 CTCAGAATGCAGATGCTGCAGGG + Intronic
1181685153 22:24523081-24523103 CTGCAAATAGAGATGCAGAAAGG + Intronic
1183040455 22:35173950-35173972 GTGGAAATGCAGAGACAGAAAGG - Intergenic
1183287278 22:36975125-36975147 CTGAAACTGCCTTTGCAGAATGG + Intergenic
1183329999 22:37214255-37214277 CAGAAACAGCAGGTGCAGAAAGG + Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184362197 22:44025197-44025219 GTGGAAAGGCAGATGGAGAAAGG + Intronic
1184837142 22:47030787-47030809 CTGCAAATGTACATGCCGAAAGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185089685 22:48758877-48758899 ATGAGAATGCAGATGTAGACAGG - Intronic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
950368840 3:12509884-12509906 TAGAAAATTCAGATGCCGAAGGG + Intronic
951850321 3:27132469-27132491 CTGAAAATTCAGCTGCAGAGAGG + Intronic
952207115 3:31191278-31191300 TTGAAAATTCAAATGCAGTAAGG - Intergenic
954841342 3:53514533-53514555 GAGAAAGAGCAGATGCAGAAAGG - Intronic
954951476 3:54478255-54478277 CTGAAACTGCAGATACAAAGAGG - Intronic
955281882 3:57601555-57601577 TGGAACCTGCAGATGCAGAATGG + Intergenic
955634473 3:61011650-61011672 CTGAAAATGTATCTGCAGTAAGG + Intronic
955823333 3:62919739-62919761 CTGAAAATTGAGGTTCAGAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
957542004 3:81583627-81583649 CTGAAAATGCCAATCCAGAAAGG + Intronic
958470666 3:94513762-94513784 ATGAAAATGAGTATGCAGAACGG - Intergenic
958714321 3:97761801-97761823 CAGAAATTGCAGATGAAAAAAGG + Intergenic
959255612 3:104008349-104008371 GTGAAGATGCAGATGTTGAAAGG - Intergenic
959602357 3:108201907-108201929 CTTAAAAGGCAAATGCTGAAAGG - Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960267069 3:115632290-115632312 CTGAAAATGTAGATACAGTTTGG + Intronic
960589223 3:119349475-119349497 CGGAGAATGCAAAGGCAGAAGGG + Intronic
960827408 3:121804730-121804752 ATAAACATGCAGATGCAAAAAGG - Intronic
961223673 3:125219833-125219855 AACAAAATGTAGATGCAGAAAGG + Intergenic
961347427 3:126273287-126273309 CTCAAAGAGCAGCTGCAGAAAGG + Intergenic
961356051 3:126340719-126340741 CTGAAAAAGCAGGTGGAGATGGG - Intergenic
962852573 3:139318975-139318997 CTGGATATGCAGCTGCTGAACGG - Intronic
963284393 3:143418992-143419014 ATGAAAATGAAGCTGCAGCAAGG - Intronic
963286346 3:143438048-143438070 AGCATAATGCAGATGCAGAAAGG + Intronic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966014168 3:175121019-175121041 CTTAAAAGGTAGATGCAAAAAGG - Intronic
966423032 3:179752679-179752701 GTTAAAATGCAGATGCAGATTGG + Intronic
966949343 3:184802241-184802263 CTGAAAGTGCAGGTGCAGTGTGG + Intergenic
967813394 3:193779528-193779550 TGGTCAATGCAGATGCAGAACGG + Intergenic
968467653 4:760577-760599 CTAAAAATGCAGTGGAAGAATGG - Intronic
970438631 4:16060166-16060188 CTGAAAATTCAGAAGTACAAAGG - Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971189741 4:24416086-24416108 CTTAAAATGCAGATGGATACAGG + Intergenic
971234970 4:24832971-24832993 CAGAAGTTGCAGATGTAGAATGG - Intronic
971592025 4:28480575-28480597 CTCAAAATGCAGATAAAAAAAGG + Intergenic
972477523 4:39465140-39465162 CTGCAAAGGCAATTGCAGAATGG + Exonic
972883737 4:43458604-43458626 CTGACAGAGCAGAGGCAGAAAGG - Intergenic
973388540 4:49532364-49532386 CTGAGATGGGAGATGCAGAAGGG + Intergenic
973611347 4:52638395-52638417 CTTAAAATCCAGGTGCAGCAGGG - Intronic
973778144 4:54262542-54262564 CTGAAAAAGAAAAGGCAGAAAGG - Intronic
975268219 4:72396521-72396543 AAGACACTGCAGATGCAGAAGGG + Intronic
975381886 4:73710125-73710147 CTGAGAAAGGAGATGTAGAAAGG + Intergenic
975503030 4:75108581-75108603 CTGAAAAAGCAAAAGAAGAAAGG + Intergenic
975804756 4:78100242-78100264 GGGAAAGTGCAGATGCAGAGGGG - Intronic
975947362 4:79723878-79723900 CCGAGAGTGCAGATGCAAAAAGG - Intergenic
976618440 4:87102069-87102091 CTGAAAAAGCAGTTGTACAAAGG + Intronic
977510485 4:97956014-97956036 ATAAAAATGCAAATGCAAAAAGG + Intronic
979425317 4:120557242-120557264 CTGAAAATTCAGATGTGCAATGG - Intergenic
979549815 4:121978013-121978035 CTGAAAGTGCAAAGGCAGAGGGG + Intergenic
979908543 4:126330581-126330603 ATGGAAATCCTGATGCAGAATGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981912538 4:149998290-149998312 CTGAGTATGCAGCTTCAGAACGG - Intergenic
982085872 4:151835710-151835732 CTGAAAATGCAGATGCCAGGAGG + Intergenic
982624108 4:157743622-157743644 AACAAAAGGCAGATGCAGAAAGG - Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983794198 4:171839746-171839768 ATGAAAATTCACAAGCAGAAAGG + Intronic
984017909 4:174447593-174447615 GAGAAACAGCAGATGCAGAAAGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985405657 4:189635873-189635895 GGGAAATGGCAGATGCAGAAAGG - Intergenic
985764967 5:1772554-1772576 CTGAAAAAGGAAATGAAGAAGGG + Intergenic
985907647 5:2853343-2853365 AGGACAAAGCAGATGCAGAATGG - Intergenic
986208393 5:5647572-5647594 CTAAGTATGCAGTTGCAGAAAGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987147232 5:15004138-15004160 CTGAGAAAGCACCTGCAGAAAGG + Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988739002 5:34051081-34051103 CTGAAAAGGGACATACAGAAAGG + Intronic
988961459 5:36375487-36375509 CTGTAAATTGAGAGGCAGAAAGG - Intergenic
990802440 5:59620045-59620067 CTGAAAAGGCAGAAGCAGGTGGG + Intronic
991641987 5:68763929-68763951 ATCAAAATGCACATGCAGAGAGG + Intergenic
993025104 5:82636545-82636567 ATAAAAATGGAGATGCAGAGAGG + Intergenic
993201152 5:84816842-84816864 GGGAAAATGAAGATGCATAATGG + Intergenic
993524885 5:88953145-88953167 CTGAAAGTGGAGATTCAGCAAGG + Intergenic
993998794 5:94753751-94753773 ATGAACATGCATATGCAGAAGGG + Intronic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
995448961 5:112279360-112279382 CAGAAAATACAGACTCAGAATGG + Intronic
995808988 5:116084382-116084404 CTGCAGATGCAGATACAGGAGGG + Intergenic
995914522 5:117228500-117228522 GTAAAAATGCAGATGCAGGCTGG + Intergenic
996167244 5:120239616-120239638 CTGAAAATACTTATGTAGAAAGG + Intergenic
997130605 5:131272403-131272425 CTGAAAATGAAGAGGAAAAAAGG - Intronic
998472791 5:142396326-142396348 CTGAAATAGGAGAGGCAGAAGGG + Intergenic
999128208 5:149262457-149262479 ATGAAAATACAGATGCTGATTGG - Intergenic
999855781 5:155592189-155592211 CTGAAAATGGAGATTAATAATGG - Intergenic
1000029627 5:157390621-157390643 CTAAAAGTGCAGAGGCAGGACGG + Exonic
1000491227 5:161915937-161915959 TTGACAATGCAAATGTAGAAAGG + Intergenic
1000766939 5:165303525-165303547 CTGAGGATGCAGAGGCAGATAGG - Intergenic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001219394 5:169886455-169886477 CTGAGGAGGAAGATGCAGAAAGG - Intronic
1002462185 5:179379656-179379678 CTTACAATGCAGATGCATAGTGG + Intergenic
1002986967 6:2199608-2199630 CTGAAAATGGAGAGGAGGAAGGG - Intronic
1003110910 6:3251490-3251512 CTGCAATTGCAGATGAAGCACGG - Intronic
1003511343 6:6783564-6783586 CTGGAAATGCAGAGGCAGATAGG - Intergenic
1003735296 6:8871708-8871730 CTGAAAATACAGGAGCAGGAAGG + Intergenic
1004743306 6:18484937-18484959 GTGAAATTCCAGATGCAAAAAGG - Intergenic
1004765058 6:18716624-18716646 CTCAGAATGAAGATCCAGAAAGG - Intergenic
1004887009 6:20060817-20060839 CAGAAAATGCAGAAGCCTAAGGG + Intergenic
1005485073 6:26291944-26291966 CTAAAAATCCTGATGGAGAATGG + Intergenic
1005490715 6:26344631-26344653 AAGAAAATGCAGAAGCCGAATGG + Intergenic
1007075071 6:39061021-39061043 AAGAACAGGCAGATGCAGAAGGG + Intronic
1007750762 6:44069770-44069792 CTGAAATTTTAGAGGCAGAAGGG + Intergenic
1008070808 6:47097095-47097117 CTTAGAGAGCAGATGCAGAATGG - Intergenic
1008380302 6:50833608-50833630 GTGATAATGTATATGCAGAAAGG + Intronic
1008487936 6:52055497-52055519 CTGAAAACTCAGAAGCACAAAGG - Intronic
1008684924 6:53914790-53914812 CCCCAAATGCAGATTCAGAAAGG - Intronic
1008937792 6:57011391-57011413 ATGAAAATGTAGATGCAAGAAGG + Intronic
1008942752 6:57064856-57064878 ATGAAGATGCAGGTGCTGAAGGG - Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1010308336 6:74351099-74351121 ATGACAATGAAGCTGCAGAATGG - Intergenic
1011057116 6:83217311-83217333 ATGAAAATGTGGATGCAGAGAGG + Intronic
1011190005 6:84718594-84718616 CTTAAAATACAGAACCAGAAAGG - Intronic
1011616813 6:89204855-89204877 AAGAAAATACAGATGCAGAATGG - Intronic
1011893580 6:92196734-92196756 CTGAAAGTGCAGATTGAAAAGGG + Intergenic
1012257662 6:97052252-97052274 ATGCACATGCAGATGCAGACTGG + Intronic
1014213511 6:118731081-118731103 CTGACAAGCCAGATGCAGGATGG + Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015737978 6:136421734-136421756 CTGAAATTGCAGAGGCAGGGCGG + Exonic
1016314693 6:142772529-142772551 CCCAAACTGCAGATGCAGGAAGG - Exonic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017702898 6:157093087-157093109 CTGAGAATGAAGATTCAGAATGG + Intronic
1018393780 6:163361355-163361377 GGGAAGTTGCAGATGCAGAAGGG - Intergenic
1018449330 6:163892487-163892509 CTTACAATGCAGTTGGAGAAAGG - Intergenic
1018606432 6:165602436-165602458 CTGAAATTGCACATGTGGAAGGG - Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020811114 7:12851188-12851210 CTAAATTTGCACATGCAGAAAGG + Intergenic
1021152964 7:17174720-17174742 TGGAAAATGAAGATGCAGAAAGG - Intergenic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1021808869 7:24383240-24383262 CTGTAAATGCCCATCCAGAAGGG + Intergenic
1021984409 7:26085067-26085089 CTACATATGCGGATGCAGAAAGG + Intergenic
1022857750 7:34332227-34332249 CTGAAGTTGCAGGTGCAGGAAGG - Intergenic
1024601382 7:50984663-50984685 GTGGAAATGGAGATGCAGAGGGG + Intergenic
1027342478 7:77223897-77223919 CTGAAAATACAGCAGCAGTAGGG + Intronic
1027823346 7:83077892-83077914 CTAAAAATGCAGACGCTTAATGG + Intronic
1028871765 7:95778205-95778227 GTGAAAATGGAGATGGAAAAAGG + Intronic
1031300796 7:120059310-120059332 ATGCAGATGCCGATGCAGAAAGG - Intergenic
1031528499 7:122850024-122850046 ATCAAACTGCAGATGCAGCAGGG - Intronic
1032416832 7:131742067-131742089 CTGAAAATCCAGATAAAGATGGG + Intergenic
1032451780 7:132037486-132037508 TAGAAAATGGAGATGGAGAATGG - Intergenic
1033058003 7:138077901-138077923 CTGAAAATGCAGATTAAGACAGG + Intronic
1033071194 7:138203978-138204000 CAGAACATGCAGACTCAGAAGGG + Intergenic
1033424436 7:141231157-141231179 CTGGAAATGCAGAGGCAAACAGG - Intronic
1033998115 7:147377926-147377948 TTAAAAATTCAGATTCAGAAAGG - Intronic
1034100601 7:148446630-148446652 AAGAAAATGCATATGCAGTAAGG - Intergenic
1034716082 7:153243503-153243525 TGGAAAATTAAGATGCAGAAAGG - Intergenic
1034749008 7:153551228-153551250 TTGAAAATGCAGAAGGAGCAGGG - Intergenic
1035022446 7:155807548-155807570 CTGACTAGGCAGATGCAGACGGG + Intronic
1035819049 8:2571928-2571950 CTGAGTCCGCAGATGCAGAAGGG - Intergenic
1035871149 8:3137346-3137368 CCGAAAATGTATATGCAGCACGG + Intronic
1036011102 8:4725643-4725665 CTGAGAATGCAGATTCTGAAAGG - Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037287289 8:17314928-17314950 CTGATAAAGTACATGCAGAACGG + Intronic
1037586789 8:20282339-20282361 CTGATCTGGCAGATGCAGAATGG + Intronic
1038592282 8:28850651-28850673 ATGAAAAAACAGATGCAGAGAGG + Intronic
1039052465 8:33507467-33507489 CAGAAACTGTAGATTCAGAAAGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040287369 8:46107286-46107308 GTGAAAATGGAGATGCAGCGTGG - Intergenic
1040334214 8:46407914-46407936 GTGAAAACAGAGATGCAGAATGG + Intergenic
1040336590 8:46419171-46419193 GTGAAAGTGGAGATGCAGAGTGG + Intergenic
1041834295 8:62194656-62194678 CTGAAAATGCAGCCTGAGAAGGG + Intergenic
1041834348 8:62195175-62195197 TTGAAAATGCAGTGACAGAATGG - Intergenic
1041978542 8:63828285-63828307 CAGAAAAGGGAGATGAAGAAGGG + Intergenic
1042400379 8:68338464-68338486 CTGAAGATGCAGAAGGAGTAAGG - Intronic
1043055036 8:75426876-75426898 CTGAAAATGGAGTTACATAATGG - Intronic
1043743338 8:83842261-83842283 CTGAAAATGTAGCAGCAAAAAGG + Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045756886 8:105554228-105554250 CTCAAAATGCAGATGAAACATGG + Intronic
1046998219 8:120547793-120547815 ATGAAGAGGCAGAGGCAGAATGG - Intronic
1047097937 8:121643650-121643672 CAGAAAATGAAGATCCAGAGAGG - Intergenic
1048016032 8:130498690-130498712 CTGAAAAAGCATAGCCAGAAAGG + Intergenic
1048694466 8:137009846-137009868 GAGAAAATGAAGCTGCAGAAAGG - Intergenic
1049893299 9:91080-91102 CTGAGAAAGCAGATGCCCAAGGG - Intergenic
1050595951 9:7204909-7204931 TTGAAAATCCAGAGGCAGATTGG + Intergenic
1050718722 9:8560896-8560918 GTGTAAATAAAGATGCAGAAAGG + Intronic
1051246012 9:15111873-15111895 ATGTAAATGAAGATGCAGATGGG + Intergenic
1051851014 9:21508076-21508098 CTAGGAATGCAGAAGCAGAAAGG - Intergenic
1051859206 9:21605471-21605493 CAGAAAATTCAGCTGCTGAAGGG - Intergenic
1051930857 9:22383677-22383699 CAGAGAATGAAGATGAAGAAAGG + Intergenic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1052216368 9:25971691-25971713 CTGAGAAAACAGAGGCAGAAGGG - Intergenic
1053734512 9:41091138-41091160 CTGAGAAAGCAGATGCCCAAGGG - Intergenic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054528545 9:66157006-66157028 CTGAGATGGGAGATGCAGAAGGG - Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054693870 9:68340281-68340303 CTGAGAAAGCAGATGCCCAAGGG + Intronic
1055016955 9:71629056-71629078 TTGAAGATGGAGATGCAGGAAGG - Intergenic
1055577435 9:77674325-77674347 ATGAAAATGCTGATGCTGAAAGG - Intergenic
1055834152 9:80419221-80419243 CTGCAACTGCAGTGGCAGAAGGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057776127 9:98011337-98011359 ATGAAGATGAAGATGTAGAAGGG + Exonic
1058239074 9:102533564-102533586 CTGATAAAGCATGTGCAGAAGGG - Intergenic
1058787574 9:108405363-108405385 CTGTCAATGCAGAGACAGAATGG + Intergenic
1059624952 9:116053472-116053494 CTGAGAATGAGGATGGAGAAAGG - Intergenic
1060006834 9:120007949-120007971 CTGAAAATGGATCTGGAGAAAGG - Intergenic
1060517440 9:124274806-124274828 CTACAAATGGACATGCAGAATGG - Intronic
1203656742 Un_KI270753v1:5291-5313 GGGAAATGGCAGATGCAGAAAGG - Intergenic
1186199903 X:7147205-7147227 CTTAAAATGCAGATTCTGATTGG + Intronic
1186495896 X:10013067-10013089 GTGGAAATGCAGCTTCAGAACGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187485757 X:19701576-19701598 CTGAAGATGCAGATGGTGAGTGG - Intronic
1187598652 X:20802289-20802311 CTGAAACTGGAAATGCAGACAGG + Intergenic
1189713826 X:43844266-43844288 CAGGAAATCCAGATGCATAAGGG - Intronic
1190187141 X:48245142-48245164 CTGAAAATGCAGAAAAAAAATGG + Intronic
1190200803 X:48358898-48358920 CTGAAAATGCAGAAAAAAAATGG + Intergenic
1190656034 X:52612922-52612944 CTGAAAATGCAGAAAAAAAATGG + Intergenic
1190900967 X:54672739-54672761 CTGAAGTTGTAGATGCAGATGGG + Intergenic
1191148878 X:57198854-57198876 GTGAAAATCCAGATTAAGAAAGG - Intergenic
1191263070 X:58350035-58350057 TTAAAAGTGCAGTTGCAGAAGGG - Intergenic
1191612228 X:63129687-63129709 CTGCAAATGAAGATTCATAAAGG - Intergenic
1191624069 X:63249239-63249261 CTGCAAATGAAGATTCATAAAGG + Intergenic
1191694405 X:63975055-63975077 TTGACAATGAAGATGCAAAAGGG + Intergenic
1192860873 X:75069137-75069159 CTGAAATTGGAGATGAAGAAAGG + Intronic
1193915059 X:87353866-87353888 TCAAAAATGCAGATGCAGATGGG + Intergenic
1194045283 X:88994004-88994026 CTAAAAATCCAGATGTAAAAGGG + Intergenic
1194379386 X:93175347-93175369 CAGAAAATCCAGCTGCAGAGAGG + Intergenic
1194674603 X:96779630-96779652 CTGAAAATGAAGATGGCTAAAGG - Intronic
1194831184 X:98623905-98623927 CTGAAACTGCAAATGCTGTAGGG - Intergenic
1195016363 X:100785588-100785610 CTGCATATGCAGAAGCAGACAGG - Intergenic
1196050094 X:111295859-111295881 ATGAAAATGGAGAAGAAGAAAGG + Exonic
1196631634 X:117947437-117947459 ATGAAACTGCAGATGTAAAAGGG + Intronic
1196723049 X:118872685-118872707 CTGAAAACCCAGCTACAGAATGG - Intergenic
1198197789 X:134382177-134382199 ATGAAAATGTTCATGCAGAATGG - Intronic
1198909501 X:141597450-141597472 CTGAAAATGCACATTCGGCATGG + Intronic
1198964900 X:142217122-142217144 TTGAAAATGAAGATTCATAAAGG - Intergenic
1199488460 X:148373213-148373235 TAGAAAATCCAGATGAAGAATGG - Intergenic
1199566980 X:149225648-149225670 CTCCAAATGCAGATGCCTAAAGG + Intergenic
1200204758 X:154307883-154307905 CTGGAAATGCAGAACCAAAAGGG + Intronic
1200880148 Y:8204036-8204058 CTGAAAAAGAAGGTGAAGAAAGG - Intergenic