ID: 1015023341

View in Genome Browser
Species Human (GRCh38)
Location 6:128503550-128503572
Sequence ATGCATGTTCATTCTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015023341 Original CRISPR ATGCATGTTCATTCTGTGCC AGG (reversed) Intronic
902264328 1:15250939-15250961 ATGAGTGTTCAGTGTGTGCCAGG + Intronic
902669523 1:17963165-17963187 CTGAATGTCCACTCTGTGCCAGG - Intergenic
904092966 1:27957907-27957929 ATGCATGGCCACTCTGTGCCAGG - Intronic
904542389 1:31241760-31241782 CTGCATCTTCATTTTGTGCTGGG - Intergenic
905138217 1:35817912-35817934 TTGAATGTTTATTTTGTGCCAGG + Intronic
906749254 1:48244068-48244090 ATGCATTTTATTTCTCTGCCTGG - Intronic
906862749 1:49379383-49379405 ATGGATTCCCATTCTGTGCCAGG - Intronic
907308787 1:53527859-53527881 CTGCAGGCTCATTCTGGGCCTGG + Intronic
907395208 1:54184974-54184996 GTGCCTGTCCACTCTGTGCCAGG + Intronic
907678015 1:56536693-56536715 ATTCAGGTTCAGCCTGTGCCTGG - Intronic
907827471 1:58032720-58032742 AGGCATGTGCATTGTGGGCCAGG - Intronic
907836350 1:58112600-58112622 ATCCATGTGCTTTATGTGCCAGG - Intronic
907837251 1:58121774-58121796 ATGCATGTACATTCCATGCTTGG - Intronic
908093731 1:60715018-60715040 ATGAATGTTTAGTCTGTGTCTGG + Intergenic
909116999 1:71549923-71549945 ATGCATGTCTAATCTGTGCCAGG + Intronic
909583545 1:77264157-77264179 ATGCATGTCTACTCTGAGCCAGG - Intergenic
910017634 1:82547079-82547101 ATGAATGTTCATTAGTTGCCTGG - Intergenic
910262675 1:85307227-85307249 ATGGATTTTCTTTCTCTGCCTGG + Intergenic
910759731 1:90722559-90722581 TTGAATGTTCATTCTATGCCAGG + Intergenic
911355580 1:96814956-96814978 ATTCATGTTTATTCTCTGCCAGG + Intronic
911648533 1:100360936-100360958 TTCCAAGTTCTTTCTGTGCCAGG + Intronic
911795595 1:102071753-102071775 ATGGATGTTAACTCTGTGTCAGG - Intergenic
912164918 1:107031508-107031530 ATGCATATGTATTATGTGCCAGG - Intergenic
912535703 1:110368321-110368343 CTGAATGTTCACTCTATGCCTGG + Intronic
912597247 1:110891634-110891656 TTGCAGGTTTATTCTGTGGCAGG - Intronic
915000258 1:152582916-152582938 AAGCATGTTGACTCTGGGCCAGG - Intronic
916116826 1:161492078-161492100 ATGCCCTTTCTTTCTGTGCCTGG + Intergenic
916222480 1:162458891-162458913 ATTCATGTTCATTTTTTGTCTGG - Intergenic
917683111 1:177387818-177387840 ATGCAGTGTCTTTCTGTGCCTGG + Intergenic
923102278 1:230826192-230826214 CTCCAGGTGCATTCTGTGCCTGG - Intergenic
924784746 1:247184546-247184568 GTTCTTGTTCATTCTCTGCCTGG + Intergenic
924867822 1:248004909-248004931 ATGCAGAATCTTTCTGTGCCTGG - Intronic
1063558712 10:7106112-7106134 TTGCTTGTTAATTCTCTGCCTGG - Intergenic
1063877698 10:10497374-10497396 CTGCATGTCAATTATGTGCCAGG + Intergenic
1064278531 10:13929958-13929980 TTGCATGTTTATTATGTACCTGG - Intronic
1066486957 10:35855323-35855345 GTGCATGTTTACTATGTGCCAGG - Intergenic
1067014876 10:42750978-42751000 ATGCAAATTTATTCTGTACCAGG - Intergenic
1067669327 10:48305413-48305435 TTGCATGCCCATTCAGTGCCAGG - Intergenic
1067906825 10:50300269-50300291 AGGTATGTTCATTCTATGCTTGG - Intergenic
1069324878 10:67221094-67221116 ATGAATGTTTTTTCTGTTCCAGG - Intronic
1069442153 10:68438736-68438758 ATTAATATTCATTCTGGGCCGGG + Intronic
1069483629 10:68806474-68806496 AGACATCTTCATTCTGGGCCTGG + Intergenic
1070330083 10:75410108-75410130 TTGATTGTTCATTTTGTGCCAGG + Intergenic
1070532542 10:77349790-77349812 ATAAATGTTGATTCTGGGCCTGG - Intronic
1071173098 10:82891270-82891292 ATACATATTCTTTCTGTGCATGG + Intronic
1073250564 10:102118368-102118390 AGGCATGTTCCTTTTGTGTCTGG - Intronic
1073316132 10:102582188-102582210 AAGCATGTTAATTCTGACCCTGG + Intronic
1073673556 10:105619341-105619363 CTGACTGCTCATTCTGTGCCAGG - Intergenic
1074784455 10:116826826-116826848 TTGGATGTTTAATCTGTGCCAGG + Intergenic
1075679318 10:124321251-124321273 ATGCATGTGCATTGTGTGATGGG - Intergenic
1078976941 11:16488181-16488203 CTGGATGTTTACTCTGTGCCAGG + Intronic
1079477228 11:20843909-20843931 ATGCATGTTGATTCTGGGTAGGG + Intronic
1079479771 11:20866913-20866935 TTGAATGTCCACTCTGTGCCAGG - Intronic
1081305189 11:41503131-41503153 ATGAACTTTCACTCTGTGCCAGG - Intergenic
1081490004 11:43559914-43559936 CTACGTGTTCATTTTGTGCCAGG - Intronic
1085029961 11:73265026-73265048 GTGCATGTACACTCTGTGGCGGG + Intronic
1085591270 11:77763606-77763628 TTGAATGTTCATTATGTACCAGG - Intronic
1087760021 11:102095601-102095623 AAGAATGTTTATTGTGTGCCAGG + Intergenic
1088232753 11:107689665-107689687 ATGAGTGTTTATTATGTGCCAGG - Intergenic
1089082630 11:115789689-115789711 ATGAAGGCTCATTCTCTGCCTGG + Intergenic
1089662254 11:119993306-119993328 ATCCAGGGTCATTCTGGGCCTGG - Intergenic
1090502322 11:127273435-127273457 ATGAATGTTGATTCTGAGTCAGG - Intergenic
1090685316 11:129111089-129111111 AAGTATGTTCCTTCTGTGTCTGG + Intronic
1090709010 11:129369320-129369342 AAGCATTTTCATTCTGTCCTTGG - Intergenic
1092057437 12:5519787-5519809 ATGCACGTTCCTTCTGTACCAGG - Intronic
1092296908 12:7208033-7208055 GTTCTTGTTCATTCTCTGCCTGG - Exonic
1093237740 12:16631801-16631823 ATTCTTGCTCATTCTGTGCAAGG - Intergenic
1094787120 12:33861068-33861090 ATGTTTGTTGATTTTGTGCCTGG + Intergenic
1094866376 12:34536420-34536442 CAGCATGTTCATTCTGTGAATGG - Intergenic
1096980380 12:55725233-55725255 ATGAATGTTCATAGTGAGCCTGG + Intergenic
1097730588 12:63123777-63123799 CTGCATTTTCTTTTTGTGCCAGG + Intergenic
1098856024 12:75654201-75654223 ATTGAGGATCATTCTGTGCCAGG - Intergenic
1098861256 12:75712954-75712976 ATCCATGTTTATTATGAGCCAGG - Intergenic
1098978365 12:76928642-76928664 ATGCATATTCATTCTGGACATGG + Intergenic
1099345967 12:81500110-81500132 GTGCGTGTTCACTATGTGCCGGG - Intronic
1099398063 12:82166457-82166479 AGGTATGTTCCTTCAGTGCCTGG + Intergenic
1099663972 12:85602167-85602189 ATGCATTTTCAACCTGTCCCTGG - Intergenic
1099696175 12:86022418-86022440 GTCCATGTTCTGTCTGTGCCTGG + Intronic
1100891499 12:99131196-99131218 TTGGGTGTTCATTGTGTGCCAGG - Intronic
1101090090 12:101276481-101276503 ATTCATGTCCATTCCTTGCCTGG + Intergenic
1103059816 12:117849376-117849398 TTGCATGGTTATTCTATGCCAGG - Intronic
1104062398 12:125279529-125279551 ATGCATGCTGTTTCTGTCCCGGG - Intronic
1105311946 13:19219966-19219988 ATTCAAGTTCATTCTTGGCCAGG + Intergenic
1105363356 13:19741834-19741856 ATTCAAGTTCATTCTTGGCCAGG + Intronic
1106603002 13:31203127-31203149 ATGGTTTTTCATTCTGAGCCAGG + Intronic
1106810765 13:33356675-33356697 ATGCATGCTCATTATATGCCAGG - Intergenic
1107721693 13:43255271-43255293 ATGTATGTTCCTTCTATACCTGG - Intronic
1108730783 13:53233390-53233412 ATGAGTATTCACTCTGTGCCAGG - Intergenic
1108780707 13:53827879-53827901 TTGAATGTTTACTCTGTGCCAGG - Intergenic
1110488607 13:76075590-76075612 AGATATGTTCCTTCTGTGCCTGG - Intergenic
1113854459 13:113436028-113436050 ACCTATGTTCACTCTGTGCCTGG - Intronic
1114391144 14:22309936-22309958 ATGCATTTTCATTTTGTACTGGG - Intergenic
1118127538 14:62924709-62924731 ATGCATTGTCTTTCTGTGCCTGG - Intronic
1118170741 14:63386255-63386277 CTGCATGTTCACTATATGCCAGG + Intronic
1119292050 14:73503050-73503072 ATGAATGTTAATTTTGTGCTTGG + Intronic
1119444660 14:74653188-74653210 ATACATGCTTACTCTGTGCCAGG - Intergenic
1123101788 14:105807899-105807921 ATGCACCTTCATTTTGAGCCAGG - Intergenic
1202842097 14_GL000009v2_random:131336-131358 ATGCAAAGTCTTTCTGTGCCTGG - Intergenic
1202911486 14_GL000194v1_random:121569-121591 ATGCAAAGTCTTTCTGTGCCTGG - Intergenic
1124638334 15:31379208-31379230 ATGACTGTTCAGTATGTGCCTGG - Intronic
1125748696 15:42014379-42014401 ATGGGCGTTCATTCTGTGCATGG - Intronic
1127300487 15:57648227-57648249 AAGCAGGTTCATTCTATGACAGG + Intronic
1128975229 15:72147437-72147459 ATGCAGTTTCATACAGTGCCTGG + Intergenic
1130145679 15:81272121-81272143 ATGCATCTTATTTCTGTGTCTGG - Intronic
1130760510 15:86814427-86814449 ATGTAGGTTCAGTCTCTGCCTGG - Intronic
1130862286 15:87901616-87901638 TTGCATGTTTATACTGTGCTAGG + Intronic
1130987297 15:88852927-88852949 ATGCATCAGCATTCTGTGCATGG + Intronic
1131040897 15:89265851-89265873 TAGGATGTTCATTCTGTGCCAGG + Intronic
1131805919 15:96122401-96122423 ATACATGTTTATTCTCTTCCAGG - Intergenic
1131986991 15:98052498-98052520 ATGAATGCTCATTATGTGTCTGG + Intergenic
1132406631 15:101545425-101545447 ATGCCTGTCCACTCTGAGCCTGG + Intergenic
1132467803 16:85585-85607 ATACAGCTTCATCCTGTGCCAGG - Exonic
1133505933 16:6412259-6412281 ATACATGTTCACTCTGTTCTTGG - Intronic
1135971103 16:27072600-27072622 ATGCATATTGTTTATGTGCCTGG + Intergenic
1139682107 16:68573127-68573149 ATGTATGTTCACCCTGTACCTGG + Intronic
1140636453 16:76920552-76920574 ATGCAGGTGCATTGTCTGCCTGG + Intergenic
1141556411 16:84839489-84839511 AGGCAGGGTCAGTCTGTGCCGGG - Intronic
1143583098 17:7837744-7837766 TTCTGTGTTCATTCTGTGCCAGG - Intergenic
1144094618 17:11888838-11888860 ATGCCTCTTCTTTCTCTGCCAGG - Intronic
1144253818 17:13445750-13445772 ATGTATGGTCTTTCTGTCCCTGG + Intergenic
1146094516 17:29916227-29916249 ATACATGTTTATTTGGTGCCAGG + Intronic
1146131905 17:30284558-30284580 ATGCATATTCATTCTGGACATGG + Intronic
1146142701 17:30381342-30381364 AGGGATGTAAATTCTGTGCCTGG + Intronic
1149018957 17:51941205-51941227 ATTCATCTTAATTCTGTGCTAGG - Intronic
1154049210 18:10937439-10937461 GTCCATGTTCATCCTGTGGCTGG + Intronic
1156731759 18:40202619-40202641 ATGTATGTGCATTCTGTGAAGGG + Intergenic
1158319435 18:56247151-56247173 ATACATGTTTATTATTTGCCAGG + Intergenic
1158615247 18:58981073-58981095 ATGCATGCTGCTTTTGTGCCTGG + Intronic
1160921932 19:1524980-1525002 ATGCATGGTGACTCTGTGTCTGG + Exonic
926702482 2:15813014-15813036 ATTCATATTTATTCAGTGCCAGG - Intergenic
928684473 2:33733781-33733803 ATGCATTTTCATTATGGGCCGGG + Intergenic
929590065 2:43139556-43139578 ATGCATGTCCACCCTGTTCCTGG - Intergenic
929756643 2:44771447-44771469 ATTCCTGTTCATACTGTGCAGGG - Intronic
930458953 2:51644768-51644790 ATGTATATTCTTTCTGTGCTTGG + Intergenic
931234773 2:60403958-60403980 AGTCCTGTTCATTCTGTTCCTGG + Intergenic
933236604 2:79871207-79871229 TTGAATGTTCATTCTGTGCCAGG + Intronic
933323092 2:80801801-80801823 CTGCTTGTTCAATCTGTTCCAGG + Intergenic
935731580 2:106068453-106068475 ATGAATGTTGCTGCTGTGCCAGG - Intronic
937612857 2:123883412-123883434 ATTGATATTCCTTCTGTGCCTGG + Intergenic
937967109 2:127521326-127521348 CTGCAGTTTCATTCTGTCCCAGG - Intronic
938094285 2:128451550-128451572 AGGCAGGTGCGTTCTGTGCCTGG + Intergenic
939892502 2:147754200-147754222 ATGCATGTTCATTCTGAGACGGG + Intergenic
942432429 2:175926669-175926691 TTGCATTCTTATTCTGTGCCAGG - Exonic
943896959 2:193376107-193376129 ATTCATTTTCATTCAGTGCAAGG + Intergenic
943963568 2:194300018-194300040 ATGTATGTTCCTTCTATACCTGG + Intergenic
944396657 2:199275396-199275418 CTGAATGTTTATTCTGTGCCAGG + Intronic
945324685 2:208468873-208468895 TTGAGTGGTCATTCTGTGCCAGG - Intronic
945521160 2:210829134-210829156 AGGCATGCTGCTTCTGTGCCTGG + Intergenic
947009847 2:225553354-225553376 AACCTTGTTTATTCTGTGCCAGG - Intronic
947062714 2:226184740-226184762 ATGCCTGTTTGATCTGTGCCTGG + Intergenic
947222393 2:227805938-227805960 ATGCTTTTTCATACAGTGCCTGG + Intergenic
947432900 2:230046292-230046314 ACACATGTTCTTCCTGTGCCCGG + Exonic
947605492 2:231483146-231483168 CTGCATTTTCATTTTGCGCCAGG + Intronic
947960578 2:234233106-234233128 ATGCATGTACACTCTGGTCCTGG - Intergenic
947967554 2:234294245-234294267 GTGCATGGTCCTCCTGTGCCAGG + Intergenic
1168861165 20:1046907-1046929 ATGCTTGTTCAATCCGTGACAGG - Intergenic
1169704330 20:8485550-8485572 ATAAAAGTTCATTATGTGCCAGG + Intronic
1170272133 20:14538989-14539011 CTGAATGCTCATTATGTGCCAGG - Intronic
1170918664 20:20654492-20654514 ATGCAGTATCTTTCTGTGCCTGG + Intronic
1172831158 20:37836180-37836202 ATCAATGTTCCTTCTTTGCCTGG - Intronic
1175212783 20:57371917-57371939 ATGCAGTTTCTTTCTGTGTCTGG - Intronic
1175631652 20:60543989-60544011 ATGCAAAATCTTTCTGTGCCAGG + Intergenic
1176131297 20:63497904-63497926 ATGCCTGTCCAGCCTGTGCCAGG - Intronic
1176630845 21:9136238-9136260 ATGCAAAGTCTTTCTGTGCCTGG - Intergenic
1177299451 21:19223114-19223136 GTGCATTTTTTTTCTGTGCCAGG - Intergenic
1179296139 21:40064687-40064709 ATGCATGTGAATTCTCTGCATGG - Intronic
1179842551 21:44086902-44086924 AGCCATGCTCATCCTGTGCCAGG + Exonic
1180375740 22:12091368-12091390 ATGCAAAGTCTTTCTGTGCCTGG + Intergenic
1182313673 22:29427500-29427522 ATGGATGCCCATTCTGTGCTGGG + Intergenic
1182739082 22:32553844-32553866 AAGCATTTGCATTCTGAGCCTGG - Intronic
1183480195 22:38059648-38059670 TTGCATGTCCACTATGTGCCAGG - Intronic
949363937 3:3260463-3260485 ATGCATTTTCATTTTGTGCTGGG + Intergenic
949364225 3:3263177-3263199 ATGCATTTTCATTTTGTGCTGGG + Intergenic
949493975 3:4614415-4614437 TTGAATGTTTACTCTGTGCCAGG + Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950534349 3:13570679-13570701 CTGCCAGTTCATGCTGTGCCCGG + Exonic
950744651 3:15077520-15077542 ATGCATTTTCATTTTGTACCAGG + Intronic
950859440 3:16134718-16134740 AGCCAAGCTCATTCTGTGCCAGG - Intergenic
950918289 3:16667397-16667419 TTGCATGCTGACTCTGTGCCAGG + Intronic
951272415 3:20643150-20643172 ATTCATGTTAATTCTGTGACAGG - Intergenic
951435063 3:22652844-22652866 AGGCATGTTCCTTCTATCCCCGG + Intergenic
951623030 3:24626871-24626893 ATGCAAGTTCAGTCTTTGCCAGG + Intergenic
951914650 3:27787400-27787422 AAGCCAGTTTATTCTGTGCCTGG - Intergenic
952657036 3:35799235-35799257 GTGCCTGTTAACTCTGTGCCTGG - Intergenic
953374330 3:42416167-42416189 ATGCAGGTTCTTCCTGTGTCTGG + Intergenic
954217970 3:49134899-49134921 GTGCCTGTGCATTCTGTGTCAGG + Intergenic
956028016 3:65004628-65004650 ATACATGTTCAACCAGTGCCTGG + Intergenic
956231958 3:67027393-67027415 ATCTAGGTTCTTTCTGTGCCAGG + Intergenic
957203029 3:77162396-77162418 CTTCATGTTCATTCTTTGTCTGG - Intronic
957367684 3:79247858-79247880 ATGCTTATTTATTCTGTGTCTGG - Intronic
959161252 3:102727156-102727178 ATGAATATTTATTATGTGCCAGG - Intergenic
960032315 3:113066975-113066997 AGGTATGTTCATTCAATGCCTGG - Intergenic
960034468 3:113088501-113088523 ATCCATTTTCTTTCTATGCCTGG - Intergenic
960118570 3:113923431-113923453 AGGTATGTTCCTTCAGTGCCTGG + Intronic
960788704 3:121402059-121402081 GTGCATTTTCATTTTGTGCTAGG + Intronic
961183726 3:124896599-124896621 ATGCATGTCATTACTGTGCCTGG - Intronic
962356209 3:134696274-134696296 TTGCTTGTGCATTCTCTGCCTGG + Intronic
966024835 3:175265016-175265038 ATGAATGTTTAGTATGTGCCAGG - Intronic
967241306 3:187442241-187442263 TTGAATGTTCACTATGTGCCAGG - Intergenic
968814888 4:2817229-2817251 GTGCGTGTTGATTCTGTGCTGGG + Intronic
969100155 4:4762678-4762700 ATGCATGTTCATAGGCTGCCCGG + Intergenic
970073066 4:12184396-12184418 ATACATGTTCAGTCCGTTCCAGG + Intergenic
970145827 4:13034869-13034891 ATGCATGTACATTCACTGCCTGG + Intergenic
970252744 4:14133806-14133828 ATGCATGTGTATTTTATGCCTGG - Intergenic
970564767 4:17321060-17321082 CTGAATATACATTCTGTGCCGGG + Intergenic
971252420 4:24984533-24984555 CTGCATTTTCATTTTGTCCCAGG + Intergenic
971729832 4:30362783-30362805 ATTCATGTTCTTTCTATTCCAGG - Intergenic
971772643 4:30917034-30917056 ATGCAAATTCATTCTCTGTCAGG + Intronic
972520020 4:39844919-39844941 AGAAATGTTCATTCTGGGCCAGG + Intronic
972629137 4:40828508-40828530 CTGCATACTTATTCTGTGCCAGG + Intronic
972718143 4:41669284-41669306 ATGAATGCTTATTCTGGGCCAGG - Intronic
972848315 4:43017160-43017182 TGGCATGTTCATTCTGGGCGTGG + Intronic
973920656 4:55681657-55681679 GTGCCTGTTCACTCTGTACCAGG + Intergenic
977373516 4:96170602-96170624 CTGCATTTTCATTTTGTGCTGGG + Intergenic
978860171 4:113439561-113439583 ATGCATTTTAATTGAGTGCCTGG - Intergenic
981803461 4:148684887-148684909 ATGAATATTTATTTTGTGCCAGG + Intergenic
981841831 4:149121981-149122003 TTGAATGTTTATTATGTGCCAGG + Intergenic
981987854 4:150879345-150879367 ATGTATGTTCCTTCTATGCCTGG - Intronic
982438921 4:155411497-155411519 ATGCATATTTATTCTGTATCTGG - Intergenic
983041667 4:162935511-162935533 ATGCTTGCTCATTCAGTGACTGG - Intergenic
983163205 4:164443066-164443088 CTGAATGTTCATTATGTGCTAGG - Intergenic
983394835 4:167180650-167180672 TTGGTGGTTCATTCTGTGCCTGG + Intronic
1202757338 4_GL000008v2_random:76809-76831 ATGCAAAGTCTTTCTGTGCCTGG + Intergenic
989289997 5:39752895-39752917 ATGCATTTTCCTTCTGTTTCTGG - Intergenic
989405649 5:41057852-41057874 AAGAACGTTCATTCTGGGCCTGG - Intronic
990926361 5:61029556-61029578 ATGCATGTGCTTTCAGAGCCAGG - Intronic
992779252 5:80113408-80113430 ATTCATGTTTCTTCTGTGACGGG + Intronic
995358543 5:111267419-111267441 AAGAATTTTCATTCTGGGCCGGG + Intronic
996347981 5:122508201-122508223 TTGAATGCTCACTCTGTGCCAGG + Intergenic
997917845 5:137946706-137946728 ATGTATGTTTACTCTGTGCTAGG - Intronic
998666468 5:144303959-144303981 ATAGATGTATATTCTGTGCCAGG - Intronic
999712554 5:154331581-154331603 TTTAATGTTCACTCTGTGCCAGG - Intronic
1001279438 5:170376063-170376085 GTGCTTATTTATTCTGTGCCAGG - Exonic
1003256500 6:4479622-4479644 ATGCATTTTCATTTTGTGGATGG + Intergenic
1003440186 6:6133515-6133537 ATACATGCTTATTCTGTACCAGG + Intergenic
1005438248 6:25837702-25837724 ATGCAGGTTTATTCTGGACCAGG + Intronic
1006816107 6:36851137-36851159 TTACAGGCTCATTCTGTGCCAGG + Intergenic
1007168229 6:39843568-39843590 CTGCATTTTCATTTTGTGCTGGG - Intronic
1007278366 6:40692056-40692078 AGGAATGCTCACTCTGTGCCAGG + Intergenic
1007731101 6:43947365-43947387 ATGCATCTTCTTTGTATGCCGGG - Intergenic
1007904895 6:45449684-45449706 CTGCATGCCCACTCTGTGCCAGG - Intronic
1010363424 6:75021710-75021732 ATACATGCTTATTGTGTGCCAGG - Intergenic
1011424964 6:87217541-87217563 ATGCATATTAATTCTGTGGTAGG - Intronic
1015023341 6:128503550-128503572 ATGCATGTTCATTCTGTGCCAGG - Intronic
1015825020 6:137302133-137302155 TTGAATGTTCACTATGTGCCAGG + Intergenic
1016127090 6:140417169-140417191 ATATATTTTCTTTCTGTGCCTGG + Intergenic
1016729441 6:147412773-147412795 CAGTATTTTCATTCTGTGCCTGG - Intergenic
1017129719 6:151097842-151097864 ATGAGTGTTTATTATGTGCCTGG - Intronic
1017174844 6:151493567-151493589 CTGCATTTTCATTCTGTACCGGG - Intergenic
1018459222 6:163981533-163981555 TTGCATTCTCATTCTGTGCTGGG - Intergenic
1020020530 7:4864376-4864398 CTGCATGTACATTCACTGCCTGG + Intronic
1021923832 7:25515340-25515362 ATAAATGTTTACTCTGTGCCAGG - Intergenic
1023140215 7:37094495-37094517 GTGAATGTTCATTTTGTGCTTGG - Intronic
1024049998 7:45612870-45612892 TTGTCTGTTCATTCTGTGCTGGG - Intronic
1024237381 7:47408579-47408601 ATGCAGTTTCATCCTCTGCCAGG + Intronic
1024849887 7:53699920-53699942 TTGAATGCCCATTCTGTGCCGGG - Intergenic
1027018591 7:74794807-74794829 ATGGATGTTCATTTTTTTCCTGG - Intergenic
1027593775 7:80146836-80146858 ATGAATGTTTACTCTGTGCAAGG - Intronic
1027926793 7:84475288-84475310 TTGTTTGTTCATTCTGTGTCAGG + Intronic
1030025068 7:105315474-105315496 ATTAGTGTTCACTCTGTGCCAGG - Intronic
1032456476 7:132076815-132076837 AGGTATGCTTATTCTGTGCCTGG - Intergenic
1032902564 7:136326370-136326392 ATGCATTTTCATGCTGTGCTGGG - Intergenic
1033946244 7:146722526-146722548 AGGAATTTTCATTCTGTGGCTGG + Intronic
1035818233 8:2563126-2563148 AGGCCTGGTCTTTCTGTGCCTGG + Intergenic
1036756422 8:11474260-11474282 ATATTTGTTCATGCTGTGCCTGG - Intronic
1037805493 8:22056112-22056134 ATGCCTGTAAATTCTGTGCTGGG + Intronic
1038797450 8:30722433-30722455 ATGCATGTTCAGGCTGGGCACGG + Intronic
1039415428 8:37389853-37389875 ATGCATCTTTATTATGTGCCAGG - Intergenic
1041096645 8:54356834-54356856 ATGTATGTACATTCTTTCCCAGG + Intergenic
1043795290 8:84529828-84529850 ATGCATATTTATTATTTGCCTGG - Intronic
1044150174 8:88766733-88766755 AAGCATTTTTATTCTGTGTCAGG - Intergenic
1045804381 8:106140112-106140134 AAGAATGTTCATTCTGGGCCGGG - Intergenic
1046143769 8:110129804-110129826 TTGCATGTTCACTGTGTTCCAGG + Intergenic
1046760228 8:118012738-118012760 TTGAATGTCCATTATGTGCCAGG - Intronic
1046833786 8:118777086-118777108 ATGTATGCTTATTCTGTGCTAGG + Intergenic
1047753532 8:127900618-127900640 ATGCTTGTTCATTCATTCCCTGG + Intergenic
1047780327 8:128105808-128105830 AAGCATTTTCATTCTGCACCAGG + Intergenic
1048687384 8:136919373-136919395 ATCCATATTCAGTCTGTGGCTGG + Intergenic
1048944127 8:139428730-139428752 ATGGAAGTTAAATCTGTGCCTGG - Intergenic
1049608374 8:143540595-143540617 AAGCCTGTTCAGTCTGCGCCTGG + Intronic
1051051067 9:12931711-12931733 AAGCCTGTTCCTTCTGTGTCAGG - Intergenic
1051462884 9:17343188-17343210 ATAAATGTTCTTTCTTTGCCAGG - Intronic
1054748772 9:68883044-68883066 ATACATGGTCACTCTTTGCCAGG + Intronic
1056505547 9:87254854-87254876 GTGAATGTTTACTCTGTGCCAGG + Intergenic
1060274744 9:122173931-122173953 TTGAATGTTTATTATGTGCCAGG - Intronic
1060448291 9:123712546-123712568 TGGCATGTTTACTCTGTGCCAGG - Intronic
1060901605 9:127262785-127262807 CTGCATGTCCACTATGTGCCAGG + Intronic
1203753675 Un_GL000218v1:103940-103962 ATGCAAAGTCTTTCTGTGCCTGG - Intergenic
1203538128 Un_KI270743v1:61670-61692 ATGCAAAGTCTTTCTGTGCCTGG + Intergenic
1185751697 X:2615510-2615532 TTGCATTTTCATTTTGTGCAGGG + Intergenic
1186877503 X:13830851-13830873 CTGCATTTTCATTTTGTACCTGG + Intronic
1189006970 X:37006578-37006600 CTGGATGCTTATTCTGTGCCAGG + Intergenic
1189261354 X:39681012-39681034 ATTCAGGTTGATTTTGTGCCTGG - Intergenic
1189342939 X:40218444-40218466 CTGCATTTTCATTCTGCACCAGG - Intergenic
1191061155 X:56297969-56297991 ACCCATGCTCATTCTCTGCCAGG - Intergenic
1191212112 X:57896424-57896446 AAGTATGTTCCTTCTATGCCTGG - Intergenic
1192547074 X:72023105-72023127 CTGAATGTTCATTCTCTGCCAGG + Intergenic
1193137098 X:77984283-77984305 TTGAATGTCCATTATGTGCCCGG - Intronic
1193293099 X:79801358-79801380 AAGTATGTTCATTCTATTCCAGG + Intergenic
1196292486 X:113959876-113959898 TTGAATGTTCATTATATGCCTGG - Intergenic
1196765577 X:119238837-119238859 GTGCCTGTTAATTCTGTGCAAGG + Intronic
1196812948 X:119643089-119643111 AAGCATGTCCAATCTTTGCCAGG + Intronic
1197865125 X:131009420-131009442 ATTCATGCCCACTCTGTGCCAGG + Intergenic
1198590322 X:138173210-138173232 ATGAATGTTTACTATGTGCCAGG - Intergenic
1198741837 X:139850971-139850993 ATGCTTTTTCATTCTGTACCTGG - Intronic
1199050351 X:143229725-143229747 CAGCATTTGCATTCTGTGCCTGG + Intergenic
1199860283 X:151795220-151795242 ATGCATGAAGATTCTGTGTCTGG - Intergenic
1200334562 X:155335809-155335831 ATGAATGTCAACTCTGTGCCAGG + Intergenic
1200361368 X:155610914-155610936 ATGAATGTCAACTCTGTGCCAGG - Intronic