ID: 1015025340

View in Genome Browser
Species Human (GRCh38)
Location 6:128525618-128525640
Sequence GTGAATTGGATTGAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015025335_1015025340 -9 Left 1015025335 6:128525604-128525626 CCAATCATAAAAGTGTGAATTGG No data
Right 1015025340 6:128525618-128525640 GTGAATTGGATTGAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015025340 Original CRISPR GTGAATTGGATTGAGGTGGA GGG Intergenic
No off target data available for this crispr