ID: 1015027990

View in Genome Browser
Species Human (GRCh38)
Location 6:128560315-128560337
Sequence TCTACGGAACAGTAGTAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015027990_1015027993 22 Left 1015027990 6:128560315-128560337 CCGGTTTACTACTGTTCCGTAGA No data
Right 1015027993 6:128560360-128560382 AAATCTTTAACACCTTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015027990 Original CRISPR TCTACGGAACAGTAGTAAAC CGG (reversed) Intergenic