ID: 1015027993

View in Genome Browser
Species Human (GRCh38)
Location 6:128560360-128560382
Sequence AAATCTTTAACACCTTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015027990_1015027993 22 Left 1015027990 6:128560315-128560337 CCGGTTTACTACTGTTCCGTAGA No data
Right 1015027993 6:128560360-128560382 AAATCTTTAACACCTTTCAGTGG No data
1015027989_1015027993 28 Left 1015027989 6:128560309-128560331 CCTAGTCCGGTTTACTACTGTTC No data
Right 1015027993 6:128560360-128560382 AAATCTTTAACACCTTTCAGTGG No data
1015027991_1015027993 6 Left 1015027991 6:128560331-128560353 CCGTAGAACCTTGCATCTTTCTT No data
Right 1015027993 6:128560360-128560382 AAATCTTTAACACCTTTCAGTGG No data
1015027992_1015027993 -2 Left 1015027992 6:128560339-128560361 CCTTGCATCTTTCTTCTTTAAAA No data
Right 1015027993 6:128560360-128560382 AAATCTTTAACACCTTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015027993 Original CRISPR AAATCTTTAACACCTTTCAG TGG Intergenic