ID: 1015029246

View in Genome Browser
Species Human (GRCh38)
Location 6:128574521-128574543
Sequence AAGGTTCAGGTATATACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015029246_1015029256 27 Left 1015029246 6:128574521-128574543 CCTTTTGTATATACCTGAACCTT No data
Right 1015029256 6:128574571-128574593 GCCAGGGGATTCCCCAGTGAAGG No data
1015029246_1015029254 12 Left 1015029246 6:128574521-128574543 CCTTTTGTATATACCTGAACCTT No data
Right 1015029254 6:128574556-128574578 ATTATGGTTTCCTTTGCCAGGGG No data
1015029246_1015029250 -4 Left 1015029246 6:128574521-128574543 CCTTTTGTATATACCTGAACCTT No data
Right 1015029250 6:128574540-128574562 CCTTGTCCTGGCTATTATTATGG No data
1015029246_1015029258 28 Left 1015029246 6:128574521-128574543 CCTTTTGTATATACCTGAACCTT No data
Right 1015029258 6:128574572-128574594 CCAGGGGATTCCCCAGTGAAGGG No data
1015029246_1015029253 11 Left 1015029246 6:128574521-128574543 CCTTTTGTATATACCTGAACCTT No data
Right 1015029253 6:128574555-128574577 TATTATGGTTTCCTTTGCCAGGG No data
1015029246_1015029252 10 Left 1015029246 6:128574521-128574543 CCTTTTGTATATACCTGAACCTT No data
Right 1015029252 6:128574554-128574576 TTATTATGGTTTCCTTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015029246 Original CRISPR AAGGTTCAGGTATATACAAA AGG (reversed) Intergenic
No off target data available for this crispr