ID: 1015029250

View in Genome Browser
Species Human (GRCh38)
Location 6:128574540-128574562
Sequence CCTTGTCCTGGCTATTATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015029246_1015029250 -4 Left 1015029246 6:128574521-128574543 CCTTTTGTATATACCTGAACCTT No data
Right 1015029250 6:128574540-128574562 CCTTGTCCTGGCTATTATTATGG No data
1015029245_1015029250 -3 Left 1015029245 6:128574520-128574542 CCCTTTTGTATATACCTGAACCT No data
Right 1015029250 6:128574540-128574562 CCTTGTCCTGGCTATTATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015029250 Original CRISPR CCTTGTCCTGGCTATTATTA TGG Intergenic
No off target data available for this crispr