ID: 1015040836

View in Genome Browser
Species Human (GRCh38)
Location 6:128716842-128716864
Sequence AAAGCTTCGTTTTTCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015040834_1015040836 17 Left 1015040834 6:128716802-128716824 CCACTTACGAGGTGGATGACTTG No data
Right 1015040836 6:128716842-128716864 AAAGCTTCGTTTTTCCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015040836 Original CRISPR AAAGCTTCGTTTTTCCATAT TGG Intergenic
No off target data available for this crispr