ID: 1015045131

View in Genome Browser
Species Human (GRCh38)
Location 6:128767870-128767892
Sequence CACAGGGATGGAGCTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2918
Summary {0: 32, 1: 253, 2: 494, 3: 817, 4: 1322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015045131_1015045138 16 Left 1015045131 6:128767870-128767892 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1015045138 6:128767909-128767931 CTCCCCTTCTGGCTGGTAGCTGG No data
1015045131_1015045136 5 Left 1015045131 6:128767870-128767892 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1015045136 6:128767898-128767920 GCAGAGTATAGCTCCCCTTCTGG No data
1015045131_1015045137 9 Left 1015045131 6:128767870-128767892 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1015045137 6:128767902-128767924 AGTATAGCTCCCCTTCTGGCTGG No data
1015045131_1015045142 27 Left 1015045131 6:128767870-128767892 CCTTGGGCAGCTCCATCCCTGTG 0: 32
1: 253
2: 494
3: 817
4: 1322
Right 1015045142 6:128767920-128767942 GCTGGTAGCTGGTGTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015045131 Original CRISPR CACAGGGATGGAGCTGCCCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr