ID: 1015047001

View in Genome Browser
Species Human (GRCh38)
Location 6:128787955-128787977
Sequence CAGTGGGTCTGACTGTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015046994_1015047001 5 Left 1015046994 6:128787927-128787949 CCTCCAGCCAACTCCAGCAGACC 0: 7
1: 750
2: 2672
3: 2821
4: 1546
Right 1015047001 6:128787955-128787977 CAGTGGGTCTGACTGTTAGAAGG No data
1015046992_1015047001 30 Left 1015046992 6:128787902-128787924 CCAGACAAACAGGGTCTGGAATG No data
Right 1015047001 6:128787955-128787977 CAGTGGGTCTGACTGTTAGAAGG No data
1015046999_1015047001 -8 Left 1015046999 6:128787940-128787962 CCAGCAGACCTGCAGCAGTGGGT No data
Right 1015047001 6:128787955-128787977 CAGTGGGTCTGACTGTTAGAAGG No data
1015046996_1015047001 -2 Left 1015046996 6:128787934-128787956 CCAACTCCAGCAGACCTGCAGCA 0: 3
1: 9
2: 17
3: 35
4: 224
Right 1015047001 6:128787955-128787977 CAGTGGGTCTGACTGTTAGAAGG No data
1015046995_1015047001 2 Left 1015046995 6:128787930-128787952 CCAGCCAACTCCAGCAGACCTGC 0: 5
1: 766
2: 2769
3: 1868
4: 1144
Right 1015047001 6:128787955-128787977 CAGTGGGTCTGACTGTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015047001 Original CRISPR CAGTGGGTCTGACTGTTAGA AGG Intergenic
No off target data available for this crispr