ID: 1015047349 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:128791856-128791878 |
Sequence | ATATTTCCTCCTTATCCATG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1015047345_1015047349 | 23 | Left | 1015047345 | 6:128791810-128791832 | CCATATTCCATGTGAATGATCAT | No data | ||
Right | 1015047349 | 6:128791856-128791878 | ATATTTCCTCCTTATCCATGAGG | No data | ||||
1015047346_1015047349 | 16 | Left | 1015047346 | 6:128791817-128791839 | CCATGTGAATGATCATGTCATCT | No data | ||
Right | 1015047349 | 6:128791856-128791878 | ATATTTCCTCCTTATCCATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1015047349 | Original CRISPR | ATATTTCCTCCTTATCCATG AGG | Intergenic | ||
No off target data available for this crispr |