ID: 1015047349

View in Genome Browser
Species Human (GRCh38)
Location 6:128791856-128791878
Sequence ATATTTCCTCCTTATCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015047345_1015047349 23 Left 1015047345 6:128791810-128791832 CCATATTCCATGTGAATGATCAT No data
Right 1015047349 6:128791856-128791878 ATATTTCCTCCTTATCCATGAGG No data
1015047346_1015047349 16 Left 1015047346 6:128791817-128791839 CCATGTGAATGATCATGTCATCT No data
Right 1015047349 6:128791856-128791878 ATATTTCCTCCTTATCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015047349 Original CRISPR ATATTTCCTCCTTATCCATG AGG Intergenic
No off target data available for this crispr