ID: 1015061905

View in Genome Browser
Species Human (GRCh38)
Location 6:128976373-128976395
Sequence GCTCAGGGGAGAACTCTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 171}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015061900_1015061905 7 Left 1015061900 6:128976343-128976365 CCCAGTGGCAGTTGAGTATTTAG 0: 1
1: 1
2: 0
3: 5
4: 113
Right 1015061905 6:128976373-128976395 GCTCAGGGGAGAACTCTAGCTGG 0: 1
1: 0
2: 3
3: 10
4: 171
1015061899_1015061905 21 Left 1015061899 6:128976329-128976351 CCATGCTCAAGTGTCCCAGTGGC 0: 1
1: 0
2: 0
3: 7
4: 185
Right 1015061905 6:128976373-128976395 GCTCAGGGGAGAACTCTAGCTGG 0: 1
1: 0
2: 3
3: 10
4: 171
1015061901_1015061905 6 Left 1015061901 6:128976344-128976366 CCAGTGGCAGTTGAGTATTTAGA 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1015061905 6:128976373-128976395 GCTCAGGGGAGAACTCTAGCTGG 0: 1
1: 0
2: 3
3: 10
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015061905 Original CRISPR GCTCAGGGGAGAACTCTAGC TGG Intronic
900716302 1:4147240-4147262 GATCAAGGGAGAACTCTTGGGGG - Intergenic
902446911 1:16472955-16472977 GCTAAGGGGAGTTCTCTAGACGG - Intergenic
903450621 1:23451611-23451633 GCTCAGGGGAGCACACTAGCAGG - Intronic
903926331 1:26833430-26833452 GGTCAGGGGAGACCTCTAGGAGG + Intronic
904710038 1:32423411-32423433 GCTCAGCTGGGAACTCTTGCAGG + Intergenic
905453237 1:38070537-38070559 GCTCAGGGGAAAAATAAAGCAGG + Intergenic
910196482 1:84645747-84645769 GCTAAAGGAAGAAATCTAGCTGG - Exonic
911332551 1:96542021-96542043 GCTCACAGGTGAATTCTAGCCGG + Intergenic
912575316 1:110665610-110665632 GCTCAGGGGAGAGATCTAGCTGG + Intergenic
912746416 1:112249091-112249113 GTTCAAGGCAGAACTCTGGCTGG + Intergenic
916623426 1:166526804-166526826 GCTAAGGGGAAAAGTCAAGCTGG + Intergenic
919633165 1:199978625-199978647 GCCCACGGGAGAACACTGGCCGG + Intergenic
920673334 1:208021502-208021524 GCCTAGGGGAGAACAGTAGCTGG - Intergenic
1062850633 10:739806-739828 GCACATGGGAGAAGTCTAACGGG + Intergenic
1063286540 10:4694719-4694741 GCTCTCAGGAGAACTCTTGCAGG - Intergenic
1063620979 10:7648950-7648972 GCTCCTGGGAGAATTGTAGCTGG - Intronic
1064007431 10:11709624-11709646 GGTCAGGAGAGAACTCTGGCTGG - Intergenic
1064233731 10:13554037-13554059 GCTAAGGGGAAAAGTCAAGCTGG + Intergenic
1065003415 10:21357774-21357796 TCTCAGGGGTGAGGTCTAGCAGG - Intergenic
1065244085 10:23740116-23740138 GCTCAGGGGAGAGGTCAGGCTGG + Intronic
1065609935 10:27462903-27462925 GCTCAGGGGACCACTCTTGGAGG + Intergenic
1066054298 10:31666149-31666171 GCTAAAGGGAGAACTCAAGCTGG - Intergenic
1066194413 10:33084764-33084786 GCCCAGTGGAGAAATCCAGCTGG - Intergenic
1070984243 10:80674289-80674311 GCGCAGGAGAGAACTTTGGCAGG + Intergenic
1071831793 10:89379540-89379562 TCAGATGGGAGAACTCTAGCAGG - Intronic
1072005244 10:91239363-91239385 GGTCATGGAAGAACTCTACCAGG - Intronic
1074848908 10:117422779-117422801 TCTCAGGGAAGAACTCTAATTGG - Intergenic
1075787706 10:125061320-125061342 GTTCAGGGGAAAGCTCTCGCTGG + Intronic
1076305879 10:129465767-129465789 GTTCAGAGGAGAACTTCAGCAGG - Intergenic
1078546353 11:12249757-12249779 ACTCAGCGGAGAAGTGTAGCCGG + Intronic
1081476928 11:43442607-43442629 GCTTAGAGGAGAACTCAAGAGGG + Intronic
1081604793 11:44520462-44520484 GCTCAGGGCGGAAATCCAGCAGG - Intergenic
1081675686 11:44967704-44967726 GCTCTGGGGAGATTTCTGGCTGG - Intergenic
1087162605 11:94964082-94964104 GCTCAGAGCAGAACTCTGGTTGG + Intronic
1090083817 11:123633480-123633502 GCACAGGGGAGAAATCCAGTTGG + Exonic
1092996941 12:13959521-13959543 GCTTAGTGCAGGACTCTAGCTGG - Intronic
1093028695 12:14268254-14268276 GCTAAGGGGAAAAGTCAAGCTGG + Intergenic
1098632585 12:72741704-72741726 GCCCAGTTGAGAACTCTCGCTGG - Intergenic
1101553443 12:105784825-105784847 GCTCAGGAAAGAACTCCAGTAGG + Intergenic
1101639562 12:106578115-106578137 GCCCATGGAAGAACCCTAGCTGG - Intronic
1102001147 12:109558756-109558778 GCTCAGGGGAGGCCTCTCGGTGG - Intronic
1104846757 12:131850879-131850901 GCTCAGGGGAGGGCTGCAGCAGG - Intronic
1105502329 13:20983410-20983432 GCTCAGGGAAGACCTCCATCCGG + Exonic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1107922227 13:45221026-45221048 GCTCAGGAGAGAGGTCTAGAGGG - Intronic
1112740861 13:102471863-102471885 GCTCAGAGGAGAACTTCAGGGGG + Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1115984161 14:39086340-39086362 GCTTAGGGGAAAAAGCTAGCAGG + Intronic
1116603315 14:46956793-46956815 TCTCAGGGGAGGGCTCTAGTGGG + Intronic
1117191588 14:53297756-53297778 GTTCAGAGGACAAGTCTAGCTGG + Intergenic
1120000581 14:79298732-79298754 GAACAGGGGAGAATTCTAGAAGG + Intronic
1121639633 14:95476384-95476406 GCTCAGTGGGTAACTTTAGCAGG - Intergenic
1123626533 15:22230522-22230544 GATCAGGGGAGAACTCCCTCCGG + Intergenic
1129122722 15:73411491-73411513 GATCAGGGGACATCTGTAGCAGG - Intergenic
1130452455 15:84070055-84070077 GCTAAGGGGAAAAGTCAAGCTGG + Intergenic
1132277972 15:100586062-100586084 GCTCAAGGGAAAATTCAAGCTGG + Intronic
1137474892 16:48799139-48799161 GATGAGGGGAGAACACTTGCTGG + Intergenic
1139490547 16:67283749-67283771 GCTCAGAGGAGAGGTCTAGCTGG + Intronic
1141386992 16:83630885-83630907 GCTAAAGGGAAAAGTCTAGCTGG - Intronic
1141977450 16:87526895-87526917 GATCAGGGGAGAACTCCCTCTGG - Intergenic
1142623071 17:1177292-1177314 GCTTAGTGGAGAGCTGTAGCAGG - Intronic
1146223753 17:31048699-31048721 GCTCAGCTGGGAACTCTTGCTGG + Intergenic
1147232626 17:39030306-39030328 GCTCAGCTGGGAACTCTTGCTGG - Intergenic
1149633876 17:58150478-58150500 GTTCAAGGGAGAAGTCTAGCTGG + Intergenic
1150784388 17:68150983-68151005 GCTCAGCTGGGAACTCTTGCTGG + Intergenic
1151469673 17:74310100-74310122 GCCCAGGCGAGACCTCCAGCAGG - Exonic
1152771942 17:82175405-82175427 GCTAAAGGGAGAAGTCAAGCTGG + Intronic
1155994132 18:32312162-32312184 GGTCAGGAGAGAAGTCTGGCTGG + Intronic
1157334173 18:46725354-46725376 GCTGTGGGAAGAAGTCTAGCTGG - Intronic
1160449039 18:78949422-78949444 GCTCCGGGGAGGACTCTTCCGGG - Intergenic
1161294474 19:3512777-3512799 CCTCAGAGGAGGACTCTAGATGG - Intronic
1161666724 19:5581638-5581660 GGTCAGAGGAGACCTCTTGCAGG + Intergenic
1162003909 19:7765139-7765161 GCTCAGGTGGGAACACTGGCAGG + Intronic
1163935512 19:20439020-20439042 GATCAGAGCAGAACCCTAGCAGG - Intergenic
1164785542 19:30927590-30927612 GCTCAGGAGAGAAGGCTGGCTGG - Intergenic
1167626868 19:50596269-50596291 GCTTAGGGGAAAACTGTGGCTGG - Intergenic
1202637119 1_KI270706v1_random:52210-52232 GCTCATGGGAAACCTCTACCAGG - Intergenic
1202653058 1_KI270707v1_random:24087-24109 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
925740290 2:6999616-6999638 GCTCAGGGCAGAAATAGAGCTGG - Intronic
930525354 2:52522378-52522400 GCAGAGGGGAGAGCCCTAGCAGG + Intergenic
930800607 2:55438810-55438832 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
930924195 2:56796640-56796662 GGTCTGTGGGGAACTCTAGCAGG + Intergenic
934167333 2:89306253-89306275 GCTAAAGGGAAAATTCTAGCTGG + Intergenic
934199942 2:89876191-89876213 GCTAAAGGGAAAATTCTAGCTGG - Intergenic
936078575 2:109417321-109417343 GCTCTGGGGAGTTCTCTAGAAGG + Intronic
944845030 2:203659582-203659604 TGTCAGCGGAGATCTCTAGCAGG + Intergenic
945431111 2:209766832-209766854 GAGCAGAGGAGAACTCTGGCTGG - Intergenic
945483108 2:210365121-210365143 GCTAAGGGGAAAATTCAAGCTGG + Intergenic
947287355 2:228531451-228531473 GCTAAAGGGAGAATTCAAGCTGG + Intergenic
947765150 2:232633316-232633338 GCTCCGGGGAAAACCGTAGCGGG - Exonic
949028863 2:241779004-241779026 GCTAAAGGGAGGAGTCTAGCTGG - Intronic
949030279 2:241792793-241792815 GCTAAAGGGAGGAGTCTAGCTGG + Intronic
949060801 2:241956083-241956105 GCTAAAGGGAAAATTCTAGCTGG - Intergenic
1169278278 20:4247928-4247950 TCTCACGGGAGAACTTGAGCAGG + Exonic
1170004232 20:11647480-11647502 GCTCAGAGGAAACCTTTAGCAGG - Intergenic
1173718604 20:45233270-45233292 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
1174137118 20:48387257-48387279 GGTCAGGGGAGGCCTCTGGCAGG - Intergenic
1174147212 20:48460220-48460242 GCACAGGGCAGAACCCTGGCTGG + Intergenic
1175064417 20:56272898-56272920 GCTCAGGGGAGACCTGCAGTGGG - Intergenic
1175172901 20:57092600-57092622 GCTCAGGGCAGGGCTCTTGCAGG - Intergenic
1176128854 20:63487872-63487894 GCGCAGGGGACCACTCTTGCAGG + Intergenic
1176599095 21:8775564-8775586 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
1177814497 21:25961062-25961084 GCTAAAGGGAAAAGTCTAGCTGG + Intronic
1180419335 22:12799337-12799359 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
1181279310 22:21707463-21707485 GCTCAGGTGAGAAGTCTACCAGG - Intronic
1182754829 22:32670661-32670683 TCTCAGGGAAGAGCTCTAACTGG + Intronic
951298066 3:20963668-20963690 GCTAAAGGGAGAAGTCAAGCTGG + Intergenic
952269313 3:31816759-31816781 GCTCAGAGGAGACCCGTAGCGGG + Intronic
954257306 3:49415768-49415790 GCTCACGGGAGAAGTCTGGTTGG - Exonic
956296746 3:67723081-67723103 GCTGAAGGGAAAACTCAAGCTGG - Intergenic
957383226 3:79461466-79461488 CCTTAGGGGAGACCTCTAGAAGG - Intronic
961506217 3:127372080-127372102 GGTCAGGGGAGAAGCCTACCTGG - Intergenic
965114084 3:164465508-164465530 GCTAAAGGGAGAAGTCAAGCTGG + Intergenic
965715125 3:171594711-171594733 GCTCAGGGTACTACTGTAGCAGG + Intergenic
967275403 3:187769269-187769291 GTTCTGGAGAGAAATCTAGCTGG + Intergenic
967699218 3:192571853-192571875 GCTCTGGGAAGACCTCTAGGAGG - Intronic
968593341 4:1470619-1470641 GCTCAGGGGAGAGAACAAGCAGG + Intergenic
969474307 4:7412651-7412673 GCTGATGGGAGAACTCTGGAGGG - Intronic
973362451 4:49177936-49177958 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
973398649 4:49618925-49618947 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
973965570 4:56158881-56158903 GCTCAGGGGAGAAAGCGTGCAGG - Intergenic
974710550 4:65588470-65588492 GCTCAGGGGAACAGTCTGGCTGG + Intronic
975221151 4:71814233-71814255 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
975846839 4:78534106-78534128 GCTCTGGGAAGAAATCTAGCTGG + Intronic
975913716 4:79298172-79298194 GCTCAGGGGAGACCTGCAGGGGG - Intronic
976675416 4:87697464-87697486 GCTCAGTGGAGAACTGCAGCAGG + Intergenic
982141652 4:152326622-152326644 GTTAATGGGAGAACTCTAGGTGG + Intronic
984325254 4:178242448-178242470 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
986163675 5:5253547-5253569 GCTAAAGGGAGAAGTCAAGCTGG - Intronic
988769963 5:34422468-34422490 GCTAAAGGGAGAATTCAAGCTGG + Intergenic
988910850 5:35840822-35840844 GCTGAAGGGAGAAGTCAAGCTGG - Intergenic
988910914 5:35842250-35842272 GCTAAAGGGAGAAGTCAAGCTGG - Intergenic
989412328 5:41134492-41134514 GCTCAGGGGAGAGAAATAGCTGG - Intergenic
990598434 5:57333648-57333670 GGTCAGGGGAGGCCTCTAGGAGG + Intergenic
997052863 5:130403128-130403150 GCTCAGGGGATAATGCTGGCCGG - Intergenic
998366261 5:141634391-141634413 GGTGAGGGGAGAAGTATAGCAGG - Intronic
1004017565 6:11746206-11746228 ACTCAGAGGAGAAATCCAGCTGG + Intronic
1007707483 6:43799634-43799656 GCTCAGGGGTCCCCTCTAGCTGG + Intergenic
1008675046 6:53810277-53810299 GCTCAGGAAAAATCTCTAGCAGG + Intronic
1013847465 6:114471407-114471429 GCTCAGTGGAGATGTCTGGCTGG - Intergenic
1014634564 6:123829276-123829298 GCTCAAGGGAGAACTCTGGGTGG - Intronic
1015061905 6:128976373-128976395 GCTCAGGGGAGAACTCTAGCTGG + Intronic
1017427866 6:154341218-154341240 GCTAAGAGGAAAACTCAAGCTGG - Intronic
1018183623 6:161245579-161245601 GCTCAGGGGAGCAGTTTAGGGGG + Intronic
1018374587 6:163199102-163199124 GCTCAAGGGAAAAGTCAAGCTGG - Intronic
1018411564 6:163554122-163554144 TCAGAGGGGAGAACCCTAGCTGG + Intronic
1018813506 6:167314579-167314601 GCTAAAGGGAAAAGTCTAGCTGG + Intronic
1020366422 7:7385348-7385370 GCTCATGGGAGAACACTAAGAGG + Intronic
1023809559 7:43901584-43901606 GCTCTTGGGAGAAGTCCAGCAGG - Intronic
1024822049 7:53343311-53343333 GCTAAGGGGAAAAGTCAAGCTGG + Intergenic
1024881885 7:54096214-54096236 GCCCAGGGGAGGACTCTCTCAGG - Intergenic
1026303620 7:69120860-69120882 GCTAAGGGGAAAAGTCAAGCTGG - Intergenic
1028728874 7:94121962-94121984 GCTCACGGGAGGACTGTAGGTGG - Intergenic
1034249591 7:149677449-149677471 GAACAGGGGAAGACTCTAGCTGG - Intergenic
1034343906 7:150374182-150374204 GCTCAGGGAAGAACTGAGGCAGG - Intronic
1034441681 7:151088854-151088876 GGTCAGGGGAGGGCTCTAGGAGG - Intronic
1036497325 8:9281104-9281126 GCTCAGGGGAGACCAGTAGGGGG + Intergenic
1038273109 8:26093087-26093109 GCTCAAGGGAAAAGTCAAGCTGG - Intergenic
1038400265 8:27279311-27279333 GCTAAAGGGAAAAGTCTAGCTGG - Intergenic
1039340842 8:36648135-36648157 GCTCTGTGAAGAACTGTAGCTGG - Intergenic
1040060906 8:43102145-43102167 GCTTAGGGGAAAAGTCTAGTGGG - Intronic
1040809369 8:51434331-51434353 GGTCAGGGGATACCTCTAGAAGG - Intronic
1042336996 8:67639863-67639885 GCTCAGAGGAGACCTATAGTGGG + Intronic
1042651884 8:71052122-71052144 GCTCAGGGAAGAAAGCTTGCGGG + Intergenic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1048512573 8:135076058-135076080 GCTCATGTGAGAGCTTTAGCAGG - Intergenic
1048715512 8:137264467-137264489 GCTCAGGGAAGAAATCTAGATGG + Intergenic
1049290912 8:141801410-141801432 GGACAGGGGAGAGCTCTATCAGG - Intergenic
1055058269 9:72043416-72043438 GCCCAGGGGAGAGATCTGGCTGG - Intergenic
1056721415 9:89075451-89075473 GCTGAGGTGAAAACTCTTGCAGG + Intronic
1056821166 9:89843064-89843086 TCTCAGGGGAGAACAATAGGGGG - Intergenic
1057354307 9:94321770-94321792 GGTCAGGGGAGACCTGTACCTGG - Intronic
1057653457 9:96935865-96935887 GGTCAGGGGAGACCTGTACCTGG + Intronic
1058384305 9:104415588-104415610 GCTAAGGGGAAAAGTCAAGCTGG + Intergenic
1059171139 9:112126280-112126302 GCTCAGTGGAGAAGTCTGGGAGG + Intronic
1062386537 9:136313942-136313964 GCTCAGGGGAGAGCTCTGGCAGG + Intergenic
1185715179 X:2335800-2335822 GCTCAAGGGAAAAGTCAAGCTGG - Intronic
1186019900 X:5242704-5242726 GCTAAAGGGAAAAGTCTAGCTGG - Intergenic
1188751355 X:33909201-33909223 GCTAAAGGGAGAAGTCAAGCTGG - Intergenic
1194201739 X:90959734-90959756 GCTCAGCTGAGAACCCTTGCTGG - Intergenic
1196773271 X:119316876-119316898 GCTAAAGGGAGAAGTCAAGCTGG + Intergenic
1196931503 X:120686062-120686084 ATTCAGAGGAGAACTCTGGCTGG - Intergenic
1197704899 X:129627873-129627895 TCACCGGGGAGAAATCTAGCTGG - Intergenic
1200159175 X:153996166-153996188 GCTAAAGGGAAAACTCAAGCTGG + Intergenic
1200547578 Y:4535181-4535203 GCTCAGCTGAGAACCCTTGCTGG - Intergenic