ID: 1015068645

View in Genome Browser
Species Human (GRCh38)
Location 6:129061677-129061699
Sequence CCTCCCATTTAGTTTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015068640_1015068645 27 Left 1015068640 6:129061627-129061649 CCCACACAGTATCTTAAGAATTA 0: 1
1: 0
2: 2
3: 17
4: 266
Right 1015068645 6:129061677-129061699 CCTCCCATTTAGTTTAATGGAGG 0: 1
1: 0
2: 1
3: 8
4: 147
1015068641_1015068645 26 Left 1015068641 6:129061628-129061650 CCACACAGTATCTTAAGAATTAT 0: 1
1: 0
2: 0
3: 27
4: 260
Right 1015068645 6:129061677-129061699 CCTCCCATTTAGTTTAATGGAGG 0: 1
1: 0
2: 1
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015068645 Original CRISPR CCTCCCATTTAGTTTAATGG AGG Intronic
901716785 1:11161504-11161526 CCTCCCAGTTAGGCTACTGGGGG - Intronic
904102095 1:28039987-28040009 CCTCCAATTTAATTTAATTCTGG + Intronic
905927087 1:41758844-41758866 CCTCCCTTTTAGGAGAATGGGGG + Intronic
905979918 1:42215619-42215641 CCTTCCATTTATTTTTATTGGGG - Intronic
906374638 1:45285268-45285290 CCTCCCATTTAGGCTATTTGGGG - Intronic
908134567 1:61117276-61117298 CCTTCCATTAATGTTAATGGAGG + Intronic
909243388 1:73244028-73244050 TTTCCCATTTAGTATAATGCTGG - Intergenic
909398736 1:75200207-75200229 CCTCACATTTGTTTTAATGGGGG + Intergenic
910627703 1:89325839-89325861 CCTCCCAGTTAGGTTACTCGGGG - Intergenic
913264117 1:117027781-117027803 CCTCCAATTCATTTTAATGTGGG - Intronic
921061593 1:211589743-211589765 CATCCCTTTTAGATTAAAGGAGG + Intergenic
922889591 1:229050601-229050623 TGTCCCATTTAGTATAATGTTGG - Intergenic
1064916542 10:20465094-20465116 CCTCCCAGTTAGTCTACTCGGGG + Intergenic
1066575992 10:36825523-36825545 GCTCCATTTTAGTTTAATGCAGG + Intergenic
1069460484 10:68590483-68590505 CCCCCCATTGAGTCTACTGGAGG + Intronic
1070104534 10:73418591-73418613 CATCCAATTTAGTAGAATGGTGG - Intergenic
1071005737 10:80882172-80882194 CCTCCCAGTTAGGTTACTCGGGG - Intergenic
1072078195 10:92000250-92000272 CAACCCATTTGGTTTAAAGGTGG - Intronic
1072364603 10:94696201-94696223 CCTCCCAGTTAGGCTACTGGGGG - Intronic
1073484813 10:103809989-103810011 CCTCCCATTTAAATAAATAGTGG - Intronic
1075974371 10:126682950-126682972 CTTCCCAATGAGTTTAAAGGAGG - Intergenic
1078960506 11:16262136-16262158 CCTCCAATTTAGTTTATAGATGG - Intronic
1079463907 11:20710156-20710178 TCTCCCATTCAGTATAATGTAGG + Intronic
1083494737 11:63041707-63041729 CCTCCCATTTAGGCTACTCGGGG + Intergenic
1087788361 11:102381014-102381036 CCTCCCATTTAGGTTAAGACAGG - Intergenic
1092709026 12:11314924-11314946 CCTCCCAGTTAGTCTACTCGGGG - Intergenic
1094671720 12:32576902-32576924 CATCCCATTTTATTTAATGTGGG + Intronic
1095083353 12:38032138-38032160 CCTCCCAGTTAGGTTACTCGGGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1109807986 13:67469409-67469431 AAATCCATTTAGTTTAATGGGGG + Intergenic
1112835356 13:103507924-103507946 CCTCCCATTTAGGGTACTCGGGG + Intergenic
1114765832 14:25369960-25369982 CCTCCCAGTTAGGCTACTGGGGG + Intergenic
1115908664 14:38230769-38230791 CCTCCCATTTTGTAGAAAGGTGG + Intergenic
1116773058 14:49149409-49149431 CCTCCCAGTTAGGTTACTCGGGG + Intergenic
1117528982 14:56640215-56640237 CCTCCCATTTAGGCTACTCGGGG - Intronic
1118257950 14:64221422-64221444 CCTGGCATTTAGTTTAAAGCTGG + Intronic
1125123797 15:36196081-36196103 CCTCCCAGTTAGGTTGCTGGGGG - Intergenic
1131552761 15:93372229-93372251 CCTACCATGTGATTTAATGGGGG + Intergenic
1132218354 15:100084563-100084585 CCTCCCATTTAGGCTACTCGGGG - Intronic
1133484547 16:6206778-6206800 CCTCCCTTTTACTTTAATGGTGG + Intronic
1136606628 16:31338589-31338611 CCTCCCATTTAGGCTACTCGGGG - Intergenic
1142620193 17:1160729-1160751 GCTCACATTCAGGTTAATGGAGG + Intronic
1149717101 17:58802056-58802078 CCTCCCCTTCAGTTTTATTGAGG + Intronic
1151072687 17:71234100-71234122 TCTCCCATTTAGTTGCATTGAGG - Intergenic
1151076345 17:71277834-71277856 CCTGCCTTTTACTTTAGTGGGGG - Intergenic
1153204852 18:2687820-2687842 CTTTCCATTGAGTTTAATAGTGG + Intronic
1153785134 18:8528019-8528041 CCTCGCATTGAGATTAATCGAGG + Intergenic
1154985900 18:21550745-21550767 GCTCCCATTTAGGATAAAGGAGG + Intronic
1155332803 18:24734866-24734888 CCTCCCATAGTGTTAAATGGAGG + Intergenic
1156308166 18:35898186-35898208 CCTCCCAGTTAGTCTACTCGGGG - Intergenic
1165261889 19:34625839-34625861 CCTCCCATTTAGGCTACTCGGGG - Intronic
1167495883 19:49818563-49818585 CCTCACAGGTATTTTAATGGTGG + Exonic
925899715 2:8500126-8500148 CCTCCCAATTAGTTCATTGTGGG + Intergenic
929916511 2:46141374-46141396 GCTCCCATTTAGTTAAATGAGGG + Intronic
935802706 2:106714669-106714691 CTTCCCATTTAGTGGAAGGGTGG + Intergenic
943946656 2:194073878-194073900 CCTCCCAGTTAGGTTATTCGGGG + Intergenic
943992914 2:194720529-194720551 CTTTCCATTTAATTTAATTGTGG + Intergenic
948047284 2:234953615-234953637 CCACCCATTAATTTTTATGGTGG - Intronic
1169893941 20:10482327-10482349 CATGCCATTTAATTTAATCGTGG + Intronic
1171198243 20:23219253-23219275 TTTCCCATTCAGTTTAATGTTGG + Intergenic
1173388095 20:42607360-42607382 CCTCCCATTTTTTTAAATTGTGG - Intronic
1174962666 20:55175957-55175979 CCTCCCATTTACTACTATGGTGG + Intergenic
1179286668 21:39983651-39983673 CCTCTCACTAAGTTTCATGGTGG - Intergenic
1181429617 22:22871020-22871042 CCTCTCCTTTAGTTTATTGATGG - Intronic
1182391578 22:30001597-30001619 CCCCCCATTTTGTTTTATGGTGG - Intronic
951534353 3:23727886-23727908 CCTCCCTTTTTGTTTAATGTAGG + Intergenic
951861940 3:27263238-27263260 CCTCCCAGTTAGTCTAATCGGGG + Intronic
953285932 3:41609471-41609493 CCTCACATGTACTTTAATGGTGG + Intronic
953305498 3:41824885-41824907 CCTCCCAGTTAGTCTATTCGGGG - Intronic
953485511 3:43290889-43290911 CCTGTCATTTAGTTTAGTGGGGG + Intronic
954066568 3:48111436-48111458 CCTCCAATTCAGTTTAATTCTGG - Intergenic
955211536 3:56945848-56945870 CCTCCCAGTTAGGTTACTCGGGG - Intronic
958255438 3:91320051-91320073 CCTCCCATTTAGGCTACTTGGGG + Intergenic
961956086 3:130805341-130805363 CCTCCCATTTAGGCTACTCGGGG - Intergenic
962424427 3:135257510-135257532 CCTCCCAGTTAGGTTGCTGGGGG + Intronic
963109093 3:141670614-141670636 CCTCCCAGTTAGGCTACTGGGGG - Intergenic
963825201 3:149945637-149945659 CCTCCCAGTTAGGTTACTTGGGG - Intronic
966575730 3:181500505-181500527 CCTCCCATTTCACTTAAGGGAGG - Intergenic
971053898 4:22891573-22891595 CCTCCCAGTTAGGCTACTGGGGG + Intergenic
972726902 4:41752398-41752420 CCTACTATTTATTTTAATAGAGG + Intergenic
972921790 4:43951651-43951673 CCTCCCAGTTAGGCTACTGGGGG - Intergenic
975165719 4:71175897-71175919 CCTCCCAGTTAGGTTACTCGGGG - Intergenic
975335879 4:73174469-73174491 TTTCCCATTTAGTGTAATGTTGG - Intronic
975345880 4:73292524-73292546 CCTCCCAGTTAGTCTACTTGGGG + Intergenic
976263137 4:83164759-83164781 CCTCCCAGTTAGGTTACTTGGGG - Intergenic
976610859 4:87029026-87029048 CCTCCCAGGTAAATTAATGGTGG + Intronic
978004780 4:103602810-103602832 CCTCCCATTTAGGCTACTCGGGG + Intronic
979589774 4:122465264-122465286 CCTCCCAGTTAGGTTACTCGGGG + Intergenic
980421157 4:132563435-132563457 CCTCCCATTCAGTTTTCAGGGGG - Intergenic
980736580 4:136898070-136898092 CTTACCATTTAGTTTAAATGTGG + Intergenic
981109151 4:140915766-140915788 CCTCCCATTTAGGCTACTCGGGG - Intronic
982156608 4:152528967-152528989 TCCCCCATTAAGTATAATGGGGG - Intronic
982328076 4:154149999-154150021 CCTCCCAGTTAGTCTACTCGGGG + Intergenic
984656524 4:182324571-182324593 GCTCCCTTTTAGTTGAATGAAGG + Intronic
989529836 5:42495082-42495104 CCCCCCATTTTCTTTGATGGAGG + Intronic
990860333 5:60319904-60319926 CCTCCCAGTTAGGCTACTGGGGG + Intronic
991344810 5:65652807-65652829 CCTCTCATTCCATTTAATGGTGG + Intronic
992359446 5:76021771-76021793 CATCCCATTAAATTTTATGGAGG + Intergenic
992634115 5:78710456-78710478 CCTCCCATTTAGGCTACTCGGGG - Intronic
992798337 5:80273094-80273116 ACTCCCATTTATTTTACTGTGGG - Intergenic
993630045 5:90275665-90275687 CCACCCATTATGTTAAATGGTGG - Intergenic
994342287 5:98644861-98644883 CTTCCCCTTCATTTTAATGGTGG + Intergenic
996227537 5:121019029-121019051 CCTGCCTTTTACTTTATTGGAGG - Intergenic
996356065 5:122597948-122597970 CCTCCCATTTAGGTTAGTCAGGG + Intergenic
996514943 5:124358949-124358971 CCTCCCATTTAGGCTACTTGGGG - Intergenic
996741589 5:126803935-126803957 CCTCCCATTTTGTTACATAGAGG - Intronic
1000553576 5:162696187-162696209 CCTCCCAGTTAGGTTACTCGGGG + Intergenic
1001830760 5:174787368-174787390 CCTCCCATCTTGTTTAATCCTGG - Intergenic
1006582289 6:35083971-35083993 CTTCTCATTTTGTTTATTGGTGG - Intronic
1008086585 6:47251759-47251781 CCTCCAATTAAGTAAAATGGCGG - Intronic
1010286540 6:74084463-74084485 CCTCCCATTTAGGCTACTCGGGG + Intergenic
1012260287 6:97080731-97080753 CCTCCCATGGAGCTTACTGGGGG + Intronic
1015068645 6:129061677-129061699 CCTCCCATTTAGTTTAATGGAGG + Intronic
1024831304 7:53461741-53461763 TGTCCCATTAAGCTTAATGGTGG + Intergenic
1025874674 7:65469909-65469931 CCTCCCATTTAGGCTACTTGGGG + Intergenic
1028184985 7:87772772-87772794 TCTGCCATTTACTTTTATGGTGG - Intronic
1030952189 7:115804676-115804698 CCTCCCAGGTACTTGAATGGGGG + Intergenic
1033391187 7:140929032-140929054 CCTCCTGTATTGTTTAATGGAGG + Intergenic
1035396113 7:158536071-158536093 CCTTCCATTTAGTTTTGTTGTGG + Intronic
1036745660 8:11407395-11407417 CCTCCCATTTAGGCTACTCGGGG + Intronic
1037552357 8:19986636-19986658 GGTCCCATTTAGTTTAGAGGGGG - Intergenic
1038707411 8:29907631-29907653 CCTCACATTTTCTTTATTGGAGG - Intergenic
1040099052 8:43480765-43480787 CCTCCCAGTTAGGTTACTTGGGG - Intergenic
1041768081 8:61441305-61441327 CCTTCCCTTTAGTGTAAGGGAGG - Intronic
1041905026 8:63023209-63023231 CTTCCCAGTTAGTATAATGCTGG + Intronic
1043355027 8:79401933-79401955 TCTCCCAGTGAATTTAATGGGGG - Intergenic
1044979426 8:97700765-97700787 CCACACAGTTAGTTAAATGGAGG + Intronic
1046704488 8:117435022-117435044 CCTCCCAGTTAGGCTACTGGGGG - Intergenic
1052115413 9:24644172-24644194 CCTCCCAGTTAGTCTACTTGGGG + Intergenic
1052145663 9:25045396-25045418 CCTCCCAGTTAGGTTACTTGAGG + Intergenic
1052192084 9:25672883-25672905 GATCACATTTAGTTTATTGGTGG + Intergenic
1052441158 9:28498079-28498101 CCTCCCAGTTAGGTTACTTGGGG + Intronic
1052788861 9:32855351-32855373 ACTCCCATTTAGTTCTCTGGAGG - Intergenic
1056896484 9:90555435-90555457 ACTCTCCTTTAGTTTGATGGTGG - Intergenic
1187616884 X:21005407-21005429 TCCCTAATTTAGTTTAATGGAGG + Intergenic
1188184680 X:27099235-27099257 CCTCTCATTATTTTTAATGGGGG + Intergenic
1188795433 X:34458331-34458353 CCTCCCAGTTAGGTTACTTGGGG - Intergenic
1191187061 X:57624281-57624303 CCTCCCAGTTAGGCTACTGGGGG - Intergenic
1191730452 X:64329095-64329117 CCTCTCATTTATTTTAAAGATGG - Intronic
1191956731 X:66650247-66650269 CCTCCCAGTTAGGCTAATTGGGG + Intergenic
1192674934 X:73185552-73185574 CCTCCCAGTTAGTCTACTCGGGG - Intergenic
1192696810 X:73425305-73425327 TTTCCCATTTAGTATAATGTTGG - Intergenic
1193156130 X:78176167-78176189 CCTCCCATTTAGGCTACTTGGGG - Intergenic
1195267779 X:103199927-103199949 CCTCCCATTTAGTTTTCTGAGGG + Intergenic
1195531249 X:105960292-105960314 CCTCCCAGTTAGTCTACTCGGGG - Intergenic
1196396754 X:115271966-115271988 CCTCCCATTTATTTGAAGGTAGG + Intergenic
1196489915 X:116253412-116253434 CCTCCCAGTTAGTCTACTCGGGG - Intergenic
1198474453 X:136982545-136982567 CCTCCCAGTTAGGCTACTGGGGG + Intergenic
1198858569 X:141044999-141045021 CCTCCCAGTTAGTCTACTCGGGG - Intergenic
1198904128 X:141542389-141542411 CCTCCCAGTTAGTCTACTCGGGG + Intergenic
1199888764 X:152052303-152052325 TTTCCCATTTAGTGTAATGTTGG + Intergenic
1200871321 Y:8101857-8101879 CCTCCCAGTTAGTCTACTTGGGG + Intergenic
1202020754 Y:20462683-20462705 CCTCCCAGTTAGGTTACTTGGGG + Intergenic
1202170829 Y:22041628-22041650 CCTCCCAGTTAGGTTACTTGGGG - Intergenic
1202220534 Y:22544745-22544767 CCTCCCAGTTAGGTTACTTGGGG + Intergenic
1202322579 Y:23650918-23650940 CCTCCCAGTTAGGTTACTTGGGG - Intergenic
1202548194 Y:26019138-26019160 CCTCCCAGTTAGGTTACTTGGGG + Intergenic