ID: 1015071745

View in Genome Browser
Species Human (GRCh38)
Location 6:129102772-129102794
Sequence AACTTTCTGATGCTACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 4, 3: 11, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015071745 Original CRISPR AACTTTCTGATGCTACTGCC AGG Intronic
901443766 1:9294619-9294641 CAGTTTCTGATGCTACAGACTGG - Intronic
905264835 1:36744465-36744487 AACTTTCTGCTGCTTCTGCCGGG - Intergenic
905821152 1:40992426-40992448 AACTTTCTGTTTCTGGTGCCTGG + Intronic
905920196 1:41714182-41714204 AACCCTCTGATGTTACTGGCTGG + Intronic
908374381 1:63519752-63519774 ATCATTTTGATGCTACTGCCAGG - Intronic
911168761 1:94748068-94748090 AACTTTCTGGTGAAACTTCCTGG - Intergenic
913433411 1:118820988-118821010 TTCTTTCTGATGCTATAGCCAGG + Intergenic
914752409 1:150544180-150544202 AACTTCCTTATGCTACTGCCAGG + Intergenic
915515861 1:156412348-156412370 AACTAGCAGATGATACTGCCTGG + Intronic
915986772 1:160473993-160474015 AACTTTATGTTGTAACTGCCAGG - Intergenic
920929483 1:210373520-210373542 AACTGACTGATGCTACTTTCAGG + Intronic
921036945 1:211388866-211388888 AATTTCCTCATGCTACTCCCTGG - Intergenic
921453612 1:215340318-215340340 AACTTTCTGTTGCTTCTGCCAGG + Intergenic
922487695 1:225988388-225988410 ACCTTTCTGTTGCTTCTGACAGG - Exonic
922913719 1:229238964-229238986 GAGTTTCTGATGCTTCTCCCAGG + Intergenic
923271185 1:232356535-232356557 AACCTTCTAATTCTAATGCCAGG - Intergenic
1062964283 10:1595364-1595386 TACTGTCTGATGCCACTGCCGGG - Intronic
1067010149 10:42703643-42703665 ATCTGCCTTATGCTACTGCCAGG + Intergenic
1067051272 10:43022770-43022792 CTCTTGCTGCTGCTACTGCCAGG - Intergenic
1067313611 10:45139993-45140015 ATCTGCCTTATGCTACTGCCAGG - Intergenic
1070741410 10:78905753-78905775 TACTTGCTGATGCTCCTGTCGGG - Intergenic
1071480868 10:86063870-86063892 AACTGTCTGTAGCTACTGTCAGG + Intronic
1072500410 10:96011070-96011092 AACATTCTGTTCCTACTACCTGG + Intronic
1074991626 10:118713259-118713281 AAGTGTCTGTTACTACTGCCTGG - Intronic
1075356440 10:121781314-121781336 ACCTTTCTGATGCAGCAGCCTGG + Intronic
1075948217 10:126455709-126455731 ACCTTGATGATGCTACTTCCTGG + Intronic
1076468215 10:130700410-130700432 AAGTATCTGATGCTACAACCTGG - Intergenic
1080774810 11:35375701-35375723 GACCTGCTGATGCCACTGCCCGG - Intronic
1081957454 11:47105879-47105901 AGCCTTCTGATTCTACTTCCAGG - Intronic
1083118598 11:60489756-60489778 AACTTTCTCTTCCTGCTGCCTGG + Intergenic
1083702531 11:64489275-64489297 ATCTTTCTGATTCTAGAGCCAGG + Intergenic
1083829486 11:65222337-65222359 GACTTCCTGATGCTACAGACAGG + Intergenic
1084322848 11:68383338-68383360 AACTTTCCAATGAGACTGCCAGG - Intronic
1085336209 11:75698383-75698405 AACTTGCTGGTTCTTCTGCCTGG + Intergenic
1088321493 11:108558597-108558619 AACTTTCTGTTGCTCCTGTCTGG + Intronic
1088735847 11:112727171-112727193 AAAGTTCTGATCCTAATGCCTGG - Intergenic
1089568728 11:119388038-119388060 CACTTTCTCATGCTACTCCAGGG - Intergenic
1090750400 11:129741860-129741882 AACTTTCTGATGTTGTTGGCAGG - Intergenic
1093137358 12:15468247-15468269 AACTTTATGATGTTACTTGCTGG - Intronic
1093522126 12:20063301-20063323 GACATTCTGAGGCTGCTGCCAGG + Intergenic
1093929106 12:24937289-24937311 CACTTGCTGATGCCTCTGCCTGG - Intronic
1094307843 12:29040641-29040663 AAGTAACTGATGCTACTACCTGG + Intergenic
1094782753 12:33811715-33811737 AACTTTCTGGTTCGGCTGCCTGG + Intergenic
1097536211 12:60873285-60873307 AAGTTTCTGCTCCCACTGCCTGG - Intergenic
1099129012 12:78803368-78803390 AACTTTGTGATGCTGCTGCCAGG + Intergenic
1100016084 12:90012394-90012416 CACTTGCTGTTGCTTCTGCCTGG + Intergenic
1101342197 12:103852664-103852686 AAAATTCTGTTCCTACTGCCTGG + Intergenic
1105555645 13:21445968-21445990 AACTTCCTGTTCCTTCTGCCTGG - Intronic
1111646045 13:91033160-91033182 CACTTTCTGATCCTGATGCCAGG + Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1113589495 13:111488537-111488559 CACCTGCTGATGCTGCTGCCTGG - Intergenic
1114713410 14:24801407-24801429 AAGCTTCTGGTGCTACTGCAGGG + Intergenic
1114816803 14:25968579-25968601 AACTTTTTCATGCTACTGAGAGG + Intergenic
1116378933 14:44240286-44240308 AGTTTTCTCATGCTTCTGCCAGG + Intergenic
1118085589 14:62412363-62412385 AAGTTTCTGACGTTACTGCATGG + Intergenic
1118298771 14:64595368-64595390 AACTTTATGAACCTGCTGCCAGG - Intergenic
1122385913 14:101348002-101348024 AACTTTCATATGCTACTGGTGGG + Intergenic
1124835253 15:33190745-33190767 ACCTTTATGATGCTGCTGCCAGG - Intronic
1125481020 15:40080815-40080837 AGGTTTCTGATGCTACATCCAGG - Intergenic
1127889738 15:63239241-63239263 AATTTCCTGATGCTACTCCAGGG - Intronic
1130632162 15:85580396-85580418 TACTGTCTGATATTACTGCCTGG - Exonic
1130814043 15:87411768-87411790 AGTTTTCTGCTGCTGCTGCCTGG - Intergenic
1131806774 15:96130705-96130727 CACGTTCTGATACTACTGTCTGG - Intergenic
1135017888 16:18939251-18939273 AACTTTCTGGTGCTACCTCCGGG - Intergenic
1135931504 16:26741744-26741766 AATTTTCTGATGCTCAGGCCAGG - Intergenic
1137928569 16:52564881-52564903 AACTTTTTTAAACTACTGCCTGG - Intergenic
1138739514 16:59291490-59291512 AGCTTTCTGTTTCTAGTGCCTGG - Intergenic
1140636808 16:76924570-76924592 GTCATTCTGATGCTACTACCTGG + Intergenic
1141503331 16:84459603-84459625 AACTTTCTGCTCCCTCTGCCTGG + Intronic
1150129375 17:62658807-62658829 CATTTTCTGTTACTACTGCCTGG + Intronic
1152265115 17:79289601-79289623 AACTCTCTGGTCCTACTTCCTGG + Intronic
1159602387 18:70441023-70441045 AGCTTTCTGCTGTTACTGCAAGG + Intergenic
1162228355 19:9243633-9243655 AGCTTTCTGATGCTAGAGGCAGG + Intergenic
1163976893 19:20861254-20861276 AATTTTCTGCTCCTACAGCCTGG + Intronic
1165998984 19:39866345-39866367 AAATTTCTGATAATATTGCCAGG + Intronic
1168611199 19:57801862-57801884 AATTTTCTGCTCCTACTGCCTGG - Intronic
928575731 2:32652818-32652840 AACTTTCTGATGATCCTTCAAGG - Intronic
929416864 2:41751979-41752001 AACTTTCACATGCTACTGTTTGG - Intergenic
931135805 2:59399181-59399203 ATCTTGCTGATGTTACTTCCTGG - Intergenic
936418520 2:112342554-112342576 AACTTTCTGATGCTACTTAGGGG - Intergenic
940098083 2:150001418-150001440 ACCCATCTGATGCTTCTGCCAGG + Intergenic
941180039 2:162248516-162248538 AACTGTTTCATGCTTCTGCCAGG - Intergenic
942172134 2:173298926-173298948 TACATTCTGTTACTACTGCCCGG + Intergenic
943279106 2:185908707-185908729 AACTTTGTGAAGGTACTACCGGG + Intergenic
943762967 2:191629918-191629940 ACCTTTCTGATACTGGTGCCTGG + Intergenic
944129076 2:196326386-196326408 AACTTTCCGCCTCTACTGCCAGG - Intronic
945755031 2:213835216-213835238 AAATGTCTGATTCTAGTGCCAGG + Intronic
946659153 2:221980812-221980834 AAATTTCTGGTGCCTCTGCCTGG - Intergenic
946920744 2:224579720-224579742 AACTAACTGAAGCTACTTCCAGG + Intronic
947619333 2:231578675-231578697 ACCTACCTGATGCCACTGCCAGG + Intergenic
1170762432 20:19262668-19262690 AACTTTCTGCTGCTACTCAATGG + Intronic
1172468029 20:35171735-35171757 AACCTGCTGATCCTACTCCCAGG + Intergenic
1174725905 20:52861865-52861887 AACTTTATAATTCTACTCCCTGG - Intergenic
1175087963 20:56477001-56477023 AGCTTTCTGATAATCCTGCCTGG + Exonic
1177580738 21:23019247-23019269 GATTTTCTGTTGCTACTCCCTGG + Intergenic
1178248336 21:30975671-30975693 AACTTTCTGAAGCTAGTTACAGG + Intergenic
1184210908 22:43035072-43035094 ACCTTGCTTATGCTCCTGCCCGG - Intergenic
953400684 3:42612802-42612824 AACGATATGATTCTACTGCCTGG + Intronic
955076384 3:55617493-55617515 AACATTCTGATCCTGCTGGCCGG - Intronic
955558704 3:60165190-60165212 AAGCTGCTGATGCTACTCCCTGG + Intronic
955734123 3:62018674-62018696 AGCTTTGTAATGCTACTGCTGGG - Intronic
959840236 3:110966727-110966749 AATTTTCTGCTCCTACAGCCTGG - Intergenic
960284347 3:115810511-115810533 AACTTTGAGATGCTAGTACCTGG - Intronic
964306971 3:155351891-155351913 AATTTTCTGATAATACTGCCTGG - Intergenic
965118266 3:164519735-164519757 AAGTTTTTGATTCTACTCCCTGG - Intergenic
965220501 3:165920932-165920954 TACTTTCTGTTCCTTCTGCCTGG - Intergenic
965669943 3:171136856-171136878 AATTTTGTGATCCTACTCCCAGG - Intronic
966557843 3:181283970-181283992 ACATTTCTGAGGCTACTGCGTGG + Intergenic
968471288 4:783517-783539 ACCTTCCTGATGCTGCTGGCTGG - Intergenic
970021602 4:11575391-11575413 AATTTTCTGAAGTTAGTGCCAGG + Intergenic
970124226 4:12791394-12791416 CACTTTCTGATGCAACAGCATGG + Intergenic
970576157 4:17430260-17430282 AAGTATTTGATGCTGCTGCCCGG - Intergenic
972052718 4:34759246-34759268 TAGTTTCTCATGTTACTGCCTGG - Intergenic
980461823 4:133125221-133125243 AAGTTGCTGCTGCTACTGCTGGG - Intergenic
981990928 4:150920135-150920157 ATCTTTCTGCAGATACTGCCAGG + Intronic
982081787 4:151797293-151797315 AACTTTGTGCTGCCACTGCAGGG + Intergenic
982715171 4:158799226-158799248 AACTTTCTGTTGCTGATGCCTGG - Intronic
986453383 5:7889825-7889847 AACATACTCATGGTACTGCCAGG + Intronic
989117284 5:37967404-37967426 AACTTTATGCTGCTACTGGTTGG + Intergenic
989285250 5:39691868-39691890 AGGCTTCTGATGCTACAGCCCGG + Intergenic
994635673 5:102342249-102342271 TCCTTTCTGGTGCTATTGCCTGG + Intergenic
997375039 5:133391716-133391738 AACTTTGTATTGCCACTGCCTGG + Intronic
1000397547 5:160791559-160791581 GACTTTCTGCTGTTACTTCCAGG + Intronic
1005118755 6:22367632-22367654 AACCTTCTGAAGCTCCTCCCTGG + Intergenic
1005768410 6:29038683-29038705 AACTGTCTTATGCTAATGTCTGG - Intergenic
1008413990 6:51217930-51217952 TACTTTCTGTTCCTGCTGCCTGG + Intergenic
1015071745 6:129102772-129102794 AACTTTCTGATGCTACTGCCAGG + Intronic
1017569178 6:155724876-155724898 ACCTTTCTTATGCTGCTGCCTGG - Intergenic
1031321934 7:120341125-120341147 GACTTTCTGAAGCTTCTCCCTGG + Intronic
1032858692 7:135858334-135858356 AAGTTTCTGCTCCCACTGCCTGG - Intergenic
1036994817 8:13643353-13643375 GACTTTCTGCTACTTCTGCCTGG - Intergenic
1039263047 8:35793623-35793645 AACTTTATGATGCTACAGTCTGG - Intronic
1040800886 8:51338534-51338556 AACTTCCTGATGGCACAGCCTGG + Intronic
1044088119 8:87967295-87967317 AAATTTCTCATGCTACTCCATGG + Intergenic
1045706944 8:104935043-104935065 GACTATTTGATGCTCCTGCCTGG - Intronic
1047961198 8:130013215-130013237 ACTTTGCTTATGCTACTGCCAGG + Intronic
1050182251 9:2934097-2934119 AAGTTCCTGCTGCTGCTGCCTGG + Intergenic
1051359099 9:16266041-16266063 AACTTCCTGAAGCAACTGCATGG - Intronic
1053005063 9:34598932-34598954 AGCTTTTTGATTCTTCTGCCTGG - Intergenic
1056749785 9:89339884-89339906 TTCTTTCAGATGCAACTGCCAGG - Exonic
1058213728 9:102205519-102205541 ACCTTTCTGCTGCCACTGCAAGG - Intergenic
1058946735 9:109864187-109864209 AACATGCTAATGCTGCTGCCTGG + Intronic
1060649613 9:125314054-125314076 ATCTCTCTTCTGCTACTGCCTGG - Intronic
1192232825 X:69277832-69277854 AAGTTGCTGCTGCTGCTGCCTGG - Intergenic
1192461826 X:71323608-71323630 CACTATCTGATACTCCTGCCTGG + Intergenic
1197411625 X:126123502-126123524 AGCTTTCTGCTGCCACTACCAGG - Intergenic
1200175617 X:154113875-154113897 AACTTCCTCATGCTTCTGGCAGG - Intergenic