ID: 1015073815

View in Genome Browser
Species Human (GRCh38)
Location 6:129130545-129130567
Sequence ATGCTGATAGTGGTGAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015073812_1015073815 12 Left 1015073812 6:129130510-129130532 CCTTATCAAACTGGGAGATACTG 0: 1
1: 0
2: 1
3: 9
4: 135
Right 1015073815 6:129130545-129130567 ATGCTGATAGTGGTGAGACATGG No data
1015073809_1015073815 30 Left 1015073809 6:129130492-129130514 CCTGTGTCTTTATTTGCACCTTA 0: 1
1: 0
2: 1
3: 12
4: 206
Right 1015073815 6:129130545-129130567 ATGCTGATAGTGGTGAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015073815 Original CRISPR ATGCTGATAGTGGTGAGACA TGG Intronic
No off target data available for this crispr