ID: 1015074805

View in Genome Browser
Species Human (GRCh38)
Location 6:129143000-129143022
Sequence CTGTTGGCACGGATAAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015074805 Original CRISPR CTGTTGGCACGGATAAAGGA AGG (reversed) Intronic
900811001 1:4801300-4801322 CTGTTGGGATGGGTCAAGGAAGG + Intergenic
903651494 1:24925250-24925272 CGGTTGGCAGGGAGGAAGGAGGG - Intronic
905045793 1:34999794-34999816 CTGTTGGTAGGGATAAAAGTTGG + Intronic
911165630 1:94722180-94722202 CTGTAGGCAGAGACAAAGGAAGG + Intergenic
911488474 1:98532077-98532099 GTGCTGTCACAGATAAAGGATGG - Intergenic
911522069 1:98941120-98941142 CTGTTGGAAGGGATAACAGAGGG + Intronic
915018118 1:152755765-152755787 CTGCTGGCAAGGATGATGGAAGG - Intronic
915058618 1:153160494-153160516 CTGTTGGCATGAATGAAGAATGG - Intergenic
915229693 1:154436117-154436139 CGGTGGGCACTGAGAAAGGAAGG + Intronic
915311571 1:155008132-155008154 CTGTGGGCACCGAAAGAGGAAGG - Intronic
918634142 1:186754914-186754936 CTGAAGGCAGGGTTAAAGGATGG + Intergenic
924461867 1:244266799-244266821 CAGGTGGCAGGGAGAAAGGAAGG + Intergenic
1074103814 10:110374384-110374406 CTGTTGACATGGGTAAAGGAAGG + Intergenic
1087162887 11:94967348-94967370 GTGTTGTAACTGATAAAGGATGG - Intronic
1087962940 11:104374563-104374585 AAAGTGGCACGGATAAAGGATGG + Intergenic
1089156262 11:116405279-116405301 CTCTTGGCATGGAGAAGGGATGG - Intergenic
1090361876 11:126178445-126178467 CTGTTGCCCAGGTTAAAGGATGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092144447 12:6204879-6204901 AAGTTGGCACTGATACAGGAAGG - Intronic
1092659801 12:10725701-10725723 CTGTTGGAAGGGCTGAAGGAGGG + Intergenic
1098409221 12:70161973-70161995 ATGCTGGCAAGGATAAAGAAAGG + Intergenic
1098463685 12:70762945-70762967 CTGTTTGCAAGGGTGAAGGAGGG - Intronic
1098781299 12:74690174-74690196 TTGTGGGCAAGGATGAAGGAGGG - Intergenic
1101080604 12:101179610-101179632 TTGTTGCCAGGGATTAAGGAGGG + Intronic
1101348527 12:103907058-103907080 CTGTTGGAAGGGAGGAAGGAAGG + Intergenic
1105890385 13:24678392-24678414 CTTTTGGAACGGAAGAAGGAGGG + Intergenic
1106490431 13:30216588-30216610 CTGTTGGCTGGGATCAAGGATGG - Intronic
1106669434 13:31888857-31888879 ATGTTGGCACATATAAGGGAGGG + Intergenic
1106909022 13:34443129-34443151 ATGTTGGCACCGACAATGGATGG + Intergenic
1108729781 13:53222870-53222892 CTGTTGTCTCTGATATAGGATGG + Intergenic
1108805181 13:54145842-54145864 CTGATGGCAAGGATAAGAGATGG - Intergenic
1115162627 14:30413183-30413205 CTGGGGGCACGGATTAGGGATGG - Intergenic
1118584134 14:67335979-67336001 CTGTTGGCACAGGTATAGGTAGG + Intronic
1121668985 14:95693663-95693685 GTGTTGGCATGGTTAAAGGGAGG + Intergenic
1125499661 15:40231567-40231589 TTGTTGGGAAGGAGAAAGGAAGG + Intergenic
1130844477 15:87731929-87731951 CTGTTGACTCGGATACTGGATGG + Intergenic
1133116776 16:3582080-3582102 CTGTGAGCACGGACAGAGGAAGG + Exonic
1135822861 16:25699994-25700016 CTGATGGGCAGGATAAAGGAAGG - Intronic
1137036429 16:35573564-35573586 CTGGTGGGCTGGATAAAGGAGGG + Intergenic
1140925838 16:79582716-79582738 CTGTTGGCACTGAGAAAATAAGG - Intergenic
1141172417 16:81699843-81699865 CTATCGGCACGGACAAGGGACGG - Intronic
1143216319 17:5227803-5227825 CGGTAGGCAAGGAGAAAGGATGG - Intronic
1143264667 17:5627329-5627351 CTGTTGTGACGGATAGAGTATGG + Intergenic
1148081487 17:44969517-44969539 CCGGTGGGCCGGATAAAGGAGGG - Intergenic
1151115897 17:71734531-71734553 CTAATGGCACCCATAAAGGAAGG - Intergenic
1153919112 18:9772542-9772564 CTGTTGGCATGGGAAAGGGAGGG + Intronic
1160057686 18:75500049-75500071 CTGTTTCCACAGAGAAAGGAAGG - Intergenic
1161437586 19:4273034-4273056 CTGTCGGCAGGGATAGGGGAAGG - Intergenic
1163583276 19:18150803-18150825 AGGTGGGCACTGATAAAGGAAGG + Exonic
1164596462 19:29533581-29533603 CTCTGGGCACGGAAAATGGATGG + Intronic
1168231077 19:55032128-55032150 TCGTTGCCACGGGTAAAGGAAGG - Exonic
926370114 2:12170910-12170932 CAGTTGGCATGGAAACAGGACGG - Intergenic
926937911 2:18104465-18104487 TTGTAGGCAAGGCTAAAGGAAGG + Intronic
927920696 2:26970359-26970381 CTGTTGCCAGGGAAAAAGGAAGG + Intergenic
929423971 2:41825265-41825287 TTGTTGCCACGTATTAAGGAGGG + Intergenic
929603555 2:43219825-43219847 CTGCTGGCACGGCTGAGGGAGGG - Intergenic
932296774 2:70630879-70630901 CAGTTGGCAGTTATAAAGGAGGG + Intronic
935059030 2:99592347-99592369 CTGTTAGCATTGATCAAGGAGGG - Intronic
935502844 2:103862377-103862399 ATGTTGACAAGGAAAAAGGAGGG + Intergenic
942814365 2:180034340-180034362 CAGGTGGCATGGCTAAAGGAGGG - Intergenic
944466982 2:200011636-200011658 CTATTGGCAATGGTAAAGGAAGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169952919 20:11066593-11066615 CTGTTTGCAAGAATAAAGGAGGG - Intergenic
1170324395 20:15140208-15140230 CTCTTGGGAGGGAAAAAGGAGGG - Intronic
1171222268 20:23409758-23409780 CTGTAGGCACGGATTATGGGTGG - Intronic
1178867360 21:36340430-36340452 AGGTTGCCACGGATTAAGGAGGG - Intronic
1181618670 22:24072460-24072482 CTGGTGGCACAGAGAATGGAAGG - Exonic
1181985905 22:26799713-26799735 CGGTGGGCACAGATAAAGGCTGG + Intergenic
1184445895 22:44546700-44546722 CTGTTGACAGGGATTAAGAAGGG - Intergenic
950747555 3:15102488-15102510 CTGCTGGCACAGAGAAATGAGGG + Intergenic
950844127 3:15998140-15998162 CTACTGGCAAGGAAAAAGGAGGG + Intergenic
951126277 3:18988013-18988035 CTGCTGCCACTGTTAAAGGATGG + Intergenic
954916344 3:54151287-54151309 ATGTAGGGACGGATAATGGATGG + Intronic
955467249 3:59250194-59250216 CTGCTGGCACAGAGGAAGGAGGG + Intergenic
956289382 3:67646053-67646075 CTGTGGGCACGGGGAAGGGAGGG + Intronic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
957835007 3:85575750-85575772 CTGTTGGGTGGGAAAAAGGAAGG + Intronic
968690544 4:1987701-1987723 GTGTGGGCACGGAGACAGGAGGG - Intronic
970613959 4:17750786-17750808 TTGTTGGCAAGGAAGAAGGAAGG - Intronic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
973738953 4:53901484-53901506 CTGTTGGTTCGAAGAAAGGAAGG + Intronic
978636980 4:110821382-110821404 CTGTTTGCAGGGACAATGGATGG + Intergenic
982763556 4:159317057-159317079 CTGTTGGAATTGATAAAGGATGG + Intronic
986073650 5:4312465-4312487 CTGTTTGCACAGTGAAAGGAAGG - Intergenic
992692587 5:79255763-79255785 CTGTTGTTAAGGATAAAGTAAGG - Intronic
993010832 5:82480496-82480518 CTGCTGGCAGGGAGAAAGGATGG + Intergenic
994278280 5:97866274-97866296 GTGATGGCACTGATAAACGAAGG - Intergenic
994434043 5:99706191-99706213 CTGATGGCAAGGACAAAGGGCGG - Intergenic
996213577 5:120840719-120840741 CTGTTGCCCAGGATAAAGGCTGG - Intergenic
997893280 5:137694084-137694106 CTGTGGGCAGGGATAATGAAGGG - Intronic
998325378 5:141275520-141275542 CTGTCAGAAGGGATAAAGGATGG + Intergenic
999873771 5:155779784-155779806 GTGTTGGCAAGGATGCAGGAGGG - Intergenic
1004172126 6:13303318-13303340 CTCTTGGCCAGGAGAAAGGAAGG - Intronic
1008504488 6:52216380-52216402 CTGTTGGAAGGCACAAAGGATGG + Intergenic
1013078451 6:106791630-106791652 CGGGGGGCAAGGATAAAGGAGGG - Intergenic
1015074805 6:129143000-129143022 CTGTTGGCACGGATAAAGGAAGG - Intronic
1025225403 7:57155906-57155928 CTCTTGGCAGGGAAAAAAGAAGG - Intergenic
1026461134 7:70616056-70616078 CTTTTAGCAGAGATAAAGGAGGG + Intronic
1027428532 7:78086123-78086145 CAGTTGACAAGGAAAAAGGAAGG - Intronic
1031868836 7:127069953-127069975 ATATTGGCAGGGAAAAAGGAAGG - Intronic
1036455953 8:8907703-8907725 ATGTTGGCATGGATATATGATGG + Intergenic
1038431591 8:27504691-27504713 CTGTTGTCAAGGAGGAAGGAGGG + Intronic
1042973297 8:74434669-74434691 CTCTTGGGACGGCTGAAGGAAGG - Intronic
1044731635 8:95233059-95233081 CTGTTGGCAGGGATTGAGAATGG - Intergenic
1044822246 8:96162096-96162118 CTGTTGGCACGATTAAAGGAGGG - Intergenic
1051307545 9:15729723-15729745 CTGCTGGCACAGACAAAAGAAGG + Exonic
1057546514 9:96022945-96022967 CTGTTGGCAGGGGTGAGGGACGG - Intergenic
1060588033 9:124798982-124799004 CTGTTGGCACTGAGAAATAAAGG + Intronic
1185565245 X:1090309-1090331 TTGTTGCCAGGGATTAAGGAGGG + Intergenic
1187172150 X:16862503-16862525 CTGTAGGCACTGGTATAGGAAGG - Intronic
1188641697 X:32513603-32513625 CTGTTTGCAGGGTGAAAGGAAGG + Intronic