ID: 1015075860

View in Genome Browser
Species Human (GRCh38)
Location 6:129156958-129156980
Sequence AAATGGCAACAGAGGAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015075855_1015075860 25 Left 1015075855 6:129156910-129156932 CCACCAATATCTTCCTGTGCATG 0: 3
1: 0
2: 0
3: 16
4: 169
Right 1015075860 6:129156958-129156980 AAATGGCAACAGAGGAATCCTGG No data
1015075854_1015075860 29 Left 1015075854 6:129156906-129156928 CCGGCCACCAATATCTTCCTGTG 0: 3
1: 0
2: 1
3: 13
4: 215
Right 1015075860 6:129156958-129156980 AAATGGCAACAGAGGAATCCTGG No data
1015075857_1015075860 12 Left 1015075857 6:129156923-129156945 CCTGTGCATGCATATAAATTATT 0: 3
1: 0
2: 1
3: 21
4: 254
Right 1015075860 6:129156958-129156980 AAATGGCAACAGAGGAATCCTGG No data
1015075856_1015075860 22 Left 1015075856 6:129156913-129156935 CCAATATCTTCCTGTGCATGCAT 0: 3
1: 0
2: 0
3: 19
4: 219
Right 1015075860 6:129156958-129156980 AAATGGCAACAGAGGAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015075860 Original CRISPR AAATGGCAACAGAGGAATCC TGG Intronic
No off target data available for this crispr