ID: 1015079041

View in Genome Browser
Species Human (GRCh38)
Location 6:129201237-129201259
Sequence TGGCAAGGCCAGGCTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 245}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015079041_1015079048 6 Left 1015079041 6:129201237-129201259 CCAAACACAGCCTGGCCTTGCCA 0: 1
1: 0
2: 4
3: 29
4: 245
Right 1015079048 6:129201266-129201288 AAGACAGAGGTTAGGGTTCATGG No data
1015079041_1015079046 -2 Left 1015079041 6:129201237-129201259 CCAAACACAGCCTGGCCTTGCCA 0: 1
1: 0
2: 4
3: 29
4: 245
Right 1015079046 6:129201258-129201280 CAAATTGAAAGACAGAGGTTAGG No data
1015079041_1015079050 15 Left 1015079041 6:129201237-129201259 CCAAACACAGCCTGGCCTTGCCA 0: 1
1: 0
2: 4
3: 29
4: 245
Right 1015079050 6:129201275-129201297 GTTAGGGTTCATGGAGGCCAAGG 0: 1
1: 0
2: 0
3: 26
4: 364
1015079041_1015079047 -1 Left 1015079041 6:129201237-129201259 CCAAACACAGCCTGGCCTTGCCA 0: 1
1: 0
2: 4
3: 29
4: 245
Right 1015079047 6:129201259-129201281 AAATTGAAAGACAGAGGTTAGGG 0: 1
1: 0
2: 8
3: 55
4: 491
1015079041_1015079049 9 Left 1015079041 6:129201237-129201259 CCAAACACAGCCTGGCCTTGCCA 0: 1
1: 0
2: 4
3: 29
4: 245
Right 1015079049 6:129201269-129201291 ACAGAGGTTAGGGTTCATGGAGG No data
1015079041_1015079044 -7 Left 1015079041 6:129201237-129201259 CCAAACACAGCCTGGCCTTGCCA 0: 1
1: 0
2: 4
3: 29
4: 245
Right 1015079044 6:129201253-129201275 CTTGCCAAATTGAAAGACAGAGG 0: 1
1: 0
2: 1
3: 20
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015079041 Original CRISPR TGGCAAGGCCAGGCTGTGTT TGG (reversed) Intronic
900555446 1:3278149-3278171 CGGTAAGGCCAGGCTATGATAGG - Intronic
900556231 1:3282278-3282300 TGGCAGGGCCAGCCTGTGTCTGG - Intronic
901585001 1:10282714-10282736 TGACATGGCCAGGCAGAGTTGGG + Intronic
902186478 1:14729216-14729238 GGAAAAGGCCAGGCTGTCTTCGG + Intronic
902190446 1:14759191-14759213 TGGCACAGCCAGGCTGAGATAGG - Intronic
904311736 1:29633444-29633466 TGGGAAGCCCACGCTGTGTCTGG + Intergenic
904599430 1:31665499-31665521 TGACCAGGCCAGGCTGGGGTAGG - Intronic
905786381 1:40760991-40761013 TGCCAAGGGCAGGCTCTGATTGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906165711 1:43684618-43684640 GGGCAAGGCCAGGGAGTGATAGG + Intronic
906678349 1:47709018-47709040 TGGCAGGGCCAGGCTCTGAAAGG - Intergenic
907319920 1:53595774-53595796 TGGAAAGGCCAGGCTGCTTGGGG - Intronic
910111002 1:83683274-83683296 TGCCAAAGCAAGGCTGTCTTAGG + Intergenic
911254571 1:95619307-95619329 TGGCCTGGCCAGGCTGTGGGAGG + Intergenic
913003425 1:114604796-114604818 TGGCAAGTCAAGGATGTGGTAGG - Intronic
913240603 1:116826323-116826345 TGTGAAGGCCAGGGTGTGTAGGG - Intergenic
916025210 1:160827655-160827677 AGGCAAGGCCAGGCTATGACTGG - Intronic
917482507 1:175424318-175424340 TGGCCTGGCCAGGCAGTGGTGGG + Intronic
917798999 1:178553200-178553222 GGCCATGGACAGGCTGTGTTTGG - Intergenic
919074504 1:192797409-192797431 TGGCAAGGCCAGGCTGGGCTGGG - Intergenic
919871722 1:201827037-201827059 TGGCAAGGCCAGACTGCTTGTGG + Intergenic
920438033 1:205960797-205960819 TGGCAAGGCCAGGCTGGCTGAGG + Intergenic
922592494 1:226787990-226788012 TGGCAACCCCAGCCTGTGTTCGG - Intergenic
1062883822 10:1000655-1000677 TGACAAGGTCTGGCTGTGTTAGG + Exonic
1063892717 10:10646931-10646953 TGGCATGACCAGGCTGTGTGAGG - Intergenic
1064553667 10:16526991-16527013 TGGCAAGTTCTGGCTCTGTTGGG - Intergenic
1065326171 10:24552465-24552487 TGGCAAGGCCAGGAGGAGGTGGG - Intergenic
1065750187 10:28878895-28878917 TGGGAGGGCCATGCTGTGTAGGG + Intronic
1067442533 10:46317548-46317570 TGGCAAAGCCAGGCTGGCTGTGG + Intronic
1067568484 10:47354732-47354754 TGGGATGGCCTGGCTGGGTTCGG - Intronic
1068108771 10:52653637-52653659 TGCCAATGCCAGGCTGGGTGGGG + Intergenic
1068657916 10:59593521-59593543 TGGCATGGCTAAGCTGTGCTGGG - Intergenic
1073547948 10:104368601-104368623 TGCCAAGGCAAACCTGTGTTAGG - Intronic
1074156423 10:110804202-110804224 GGGCTAGGCCATGCTGTGATTGG + Intronic
1074370044 10:112893226-112893248 TGGCAGGGAAAGGCTTTGTTAGG - Intergenic
1075079182 10:119371260-119371282 TGGGAGGGCCTGGCTGTGCTCGG + Intronic
1075248229 10:120843952-120843974 AGGCAAGGACAGGCTGGGTTTGG - Intergenic
1075662203 10:124205725-124205747 TGGCAAGCTCAGGCTTGGTTTGG + Intergenic
1076065191 10:127442908-127442930 TGTCCAGCCCAGGCTGTGTGAGG + Intronic
1076485470 10:130812956-130812978 TGGGAGGGCCTGGCTGTGTGAGG - Intergenic
1077002858 11:333381-333403 CAGCCAGGACAGGCTGTGTTAGG - Intergenic
1077179560 11:1206191-1206213 TGGCCAGGCCAGGCCGAGTGCGG + Intergenic
1077192759 11:1262324-1262346 TGGGAAGGCCAGGCAGGGTGGGG + Intergenic
1077248387 11:1549933-1549955 TCTGAAGGCCAGGTTGTGTTTGG - Intergenic
1077327940 11:1971709-1971731 TGGCCCGGCCAGGCTGGGTGTGG - Intronic
1080680408 11:34470367-34470389 TGGCAAGGTCAGGGAGTGTCTGG - Intronic
1080691082 11:34558596-34558618 TGCCAAGGCCTGGATGTGCTGGG + Intergenic
1082081793 11:48017977-48017999 TGGCTCTGCCAGGCTGGGTTGGG + Intronic
1084020364 11:66413691-66413713 TGACTGGGCCAGGCTGTGCTGGG - Intergenic
1086960990 11:92980015-92980037 TGGAGAGGCCAGGCTCTGTGTGG - Intronic
1088226826 11:107629812-107629834 TGACAAGGCCAGGGAATGTTAGG + Intronic
1089363534 11:117907155-117907177 TGTCAAACCCAGGCTGTATTTGG - Intronic
1089640753 11:119845691-119845713 TGCCAAGGGCAGGCTTTGGTGGG + Intergenic
1089709069 11:120302111-120302133 TGGCAATGCCTGGCAGTGCTAGG + Intronic
1090380701 11:126325799-126325821 TGGTTATCCCAGGCTGTGTTTGG + Intronic
1090421241 11:126576632-126576654 ATGCAAGGCCAAGCTGTGGTGGG - Intronic
1090866927 11:130709571-130709593 TGGCAAGGGCAGCAGGTGTTGGG + Intronic
1091106357 11:132922998-132923020 TGGGAAGTCAAGGCTGTATTGGG + Intronic
1202810919 11_KI270721v1_random:26889-26911 TGGCCTGGCCAGGCTGGGTGTGG - Intergenic
1092077441 12:5685384-5685406 TGGGAGGGCCAAGCTGTCTTGGG - Intronic
1092253892 12:6915957-6915979 TTCCACGGCCAGGCTGGGTTCGG + Intronic
1092601708 12:10073318-10073340 TGGCAAGGCCTGGCTGTGGATGG - Exonic
1096194725 12:49642523-49642545 TGTCCAGGCCAGGCTGAGTGGGG + Exonic
1096263151 12:50105245-50105267 TGCCAAGCCCAGGCTGCTTTTGG + Intronic
1097020248 12:56015684-56015706 TGGAAAGCTCAGGCTGGGTTTGG - Intronic
1099104861 12:78485238-78485260 TGGCAGGGACAAGCTGCGTTAGG + Intergenic
1102385418 12:112505097-112505119 TGGTTAGCCCAGGCTGTGCTGGG + Intronic
1102427889 12:112858770-112858792 TGGCAAGGCCAGACCACGTTGGG + Intronic
1102878457 12:116466100-116466122 TGGGAAGTTCAGGCTGTGGTAGG - Intergenic
1104598544 12:130136806-130136828 TGGCAGGGCCAGGCTCTCTCTGG - Intergenic
1104706569 12:130951826-130951848 GGGCAGAGCCAGGCTGGGTTTGG + Intergenic
1104924126 12:132305445-132305467 TGCCCAGGTCAGGCTGTGTCTGG - Intronic
1106183166 13:27385560-27385582 GGTCCAGGCCAGGCAGTGTTGGG + Intergenic
1106764733 13:32902540-32902562 TGGCAGAGGCAGCCTGTGTTTGG + Intergenic
1110887176 13:80654833-80654855 TGGCCAGGCCAGGCTGGGAATGG + Intergenic
1111288200 13:86123463-86123485 TGACAAGGTCTGACTGTGTTAGG + Intergenic
1113552498 13:111204105-111204127 TGTCAAGGCAGGGCTGTGTCAGG + Intronic
1113747249 13:112754001-112754023 GGTCAAGGTCAGGCTGTGATCGG - Intronic
1116121404 14:40725319-40725341 AGGCAAGGCCAGGGTTTGTGTGG + Intergenic
1117057381 14:51926783-51926805 TGAGAAGGACAGGGTGTGTTGGG - Intronic
1117959961 14:61153100-61153122 GGGCAAGAACAGCCTGTGTTGGG + Intergenic
1121007544 14:90499991-90500013 TGGGAAGCCCTGGATGTGTTGGG - Intergenic
1121996664 14:98608194-98608216 GGGCAAGGCCAGGCTGTCCCCGG + Intergenic
1122181200 14:99956107-99956129 TGGCCAGGGCAGGGGGTGTTAGG - Intergenic
1122352381 14:101103588-101103610 TGGCCAGCTCAGGCTGTGTGTGG + Intergenic
1122540001 14:102492787-102492809 TGGCAAGGCCAGGGTGAGGCTGG + Intronic
1122550198 14:102545210-102545232 TTGCAAGGCGAGGCCGGGTTTGG - Intergenic
1122603461 14:102932541-102932563 TGGCAGGGCTAGGCGGTGCTGGG + Exonic
1122690037 14:103527937-103527959 AGGCCAGGCCAGGCTGTTTGTGG - Intergenic
1122864603 14:104597879-104597901 TTAAAAGGCCAGGCTGTGATTGG + Intronic
1128988199 15:72236553-72236575 TGGCAAGGCCATGGTGTGGGGGG + Intergenic
1129740822 15:77988798-77988820 TTGCAGGGCCAGGTGGTGTTGGG - Intronic
1130808604 15:87353236-87353258 GGGCAAGGCTAGGCTTTGATTGG + Intergenic
1131766719 15:95684284-95684306 GGGCAAGAACAGTCTGTGTTGGG - Intergenic
1132957022 16:2599644-2599666 TGGAAAGGCTTGGCTGTGTTGGG + Exonic
1132969373 16:2678097-2678119 TGGAAAGGCTTGGCTGTGTTGGG + Intergenic
1133177363 16:4025434-4025456 TAGCAAAGCCAGCCTGGGTTTGG + Intronic
1133880536 16:9777573-9777595 AGGCAGGGACAGGCTGTCTTTGG + Intronic
1134247660 16:12552021-12552043 TGGCAAGTCCAGGCTCAGATGGG + Intronic
1134280002 16:12808906-12808928 TGGCAAGACCAGGCTGGGCATGG - Intergenic
1135121133 16:19767487-19767509 TGGCAGGACGAGGCTGAGTTTGG - Intronic
1136625920 16:31462227-31462249 TGCCAAGGCCAGGCGGTGCTGGG - Exonic
1139648372 16:68348451-68348473 TGGCCACGCTGGGCTGTGTTAGG + Intronic
1140326088 16:74005082-74005104 TGGCATGGGCAGGCTGGGTAGGG + Intergenic
1140768047 16:78178175-78178197 TGGCCTGGCCTGGCTGGGTTTGG + Intronic
1141168284 16:81675149-81675171 TGGAAAGGCCTGGCAGTGATGGG + Intronic
1143494070 17:7301033-7301055 TGGGAAGTCCAAGCTGTGGTGGG + Intergenic
1143782975 17:9239183-9239205 TTGGAGGGCCAGGCTGTGTGTGG + Intronic
1146301228 17:31691414-31691436 TGGCAGGGCCTGGCTGTCATTGG + Intergenic
1146818635 17:35965890-35965912 TGGAAAGGCGAGGCTGTGGCGGG + Intergenic
1147471499 17:40666373-40666395 TGGCCAGGCCAGTCTATGCTGGG + Intergenic
1147569172 17:41557109-41557131 TGGCAGGAGCAGGCTCTGTTCGG - Intergenic
1148221031 17:45862105-45862127 TGGCTGGGAGAGGCTGTGTTGGG + Intergenic
1149363088 17:55914224-55914246 AGGCATGGCCAGGCTGGGCTGGG + Intergenic
1150197324 17:63313946-63313968 TGGAAAGGCCAGGCTGTGGCGGG - Intronic
1151704530 17:75759638-75759660 GGGCAAGGACAGGCTGGGGTGGG + Intronic
1152670315 17:81600290-81600312 GGGCGTGGCCAGGCTCTGTTGGG - Intronic
1153841435 18:9011542-9011564 TGGGAAGGCAGGGCTGTGGTGGG + Intergenic
1157557661 18:48623140-48623162 GGGCAAGGCAAGGCTGTGGAGGG + Intronic
1157567285 18:48688158-48688180 AGGCAAGGCCAGTCTGTGCACGG + Intronic
1157672308 18:49540748-49540770 TAGCAGGGCATGGCTGTGTTAGG + Intergenic
1157726376 18:49967458-49967480 TGGAAAGACCAGGCTGAGCTAGG - Intronic
1158490030 18:57901734-57901756 TGGCAGGGCCATGCTGTCTCTGG - Intergenic
1160662127 19:306106-306128 TGGGAAGGCGAGGCTGGGGTGGG + Exonic
1160681103 19:412039-412061 TGGCCAAGCCAGGCTGTGGTGGG - Intergenic
1163253147 19:16138744-16138766 TAGCAAGGGCAGGCTGGGTGCGG - Intronic
1165358284 19:35317649-35317671 GTGCAAGGTCAGGCTGTGCTGGG + Intergenic
1165982568 19:39737118-39737140 TGGGAAGGCCAGGCTAGGGTAGG + Intronic
1166532248 19:43550053-43550075 GGGCAGGGGCAGGCTCTGTTGGG - Intronic
1166772218 19:45290744-45290766 TGGCAATGACCGGCTGTGTTTGG + Intronic
1167009603 19:46798367-46798389 TAGCAGGGCCACGCTCTGTTAGG + Intergenic
1167503436 19:49859721-49859743 TGGGCAGGCCAGGCTGTGTCTGG - Intronic
1168486214 19:56764663-56764685 TGGCCAGGCCATGATGTGCTGGG - Intergenic
926425492 2:12735497-12735519 TGGCAAGGCAAGGCAGTGGCTGG - Intronic
929572040 2:43028742-43028764 TGGGGAGGCCAGGCTGTGCCTGG - Intergenic
930091894 2:47536863-47536885 TAGCGAGGCCAAGCTGTGATTGG + Intronic
932568467 2:72924218-72924240 GCGCGAGGCCAGGCTCTGTTGGG + Intronic
932619497 2:73257444-73257466 TGTCCAAGCCAGGTTGTGTTAGG + Exonic
932822783 2:74915619-74915641 TGGTCAGGCCAGGCTCTGCTGGG + Intergenic
933921214 2:87048718-87048740 AGGCATGGCCATGCTGTGCTGGG - Intergenic
933930420 2:87145079-87145101 AGGCATGGCCATGCTGTGCTGGG + Intergenic
934001752 2:87720867-87720889 AGGCATGGCCATGCTGTGCTGGG + Intergenic
935229336 2:101082260-101082282 TGGAAAGTCCAGGCTGTTGTAGG - Intronic
935690858 2:105731295-105731317 TGGGTAGAACAGGCTGTGTTGGG + Intergenic
936362710 2:111820369-111820391 AGGCATGGCCATGCTGTGCTGGG - Intronic
937154596 2:119710205-119710227 TGGCAAGGCTGGGGTGTGGTTGG - Intergenic
938318620 2:130346816-130346838 TAGCAGGGCCAGCCTGTGTCAGG + Intronic
940812251 2:158258605-158258627 TGTCAGGGACAGGCAGTGTTAGG - Intronic
941486425 2:166087535-166087557 AGGCAAGGGCAGCCTGTGTGGGG - Intronic
941872429 2:170399882-170399904 TGGCATGGTAAGGCTGTGCTGGG + Intronic
943745913 2:191462745-191462767 GGGAAAGGCAAGGCTGTGTAGGG - Intergenic
945441225 2:209882314-209882336 AAGCAAGGCCAGGCGGTGTGGGG + Intronic
946165257 2:217859605-217859627 TGGGAAGGCCAGTGTGTGTCTGG + Intronic
946729870 2:222698826-222698848 TGGCAAGGCCTGGCTATGGAAGG - Intronic
948460492 2:238127818-238127840 AGGAAAGGCCTGGCTGTGCTGGG - Intronic
948869745 2:240792004-240792026 TGGCAGGGCCAGGGTGGGGTGGG - Intronic
948988293 2:241539484-241539506 TTGCCAGGCCATGCTGTGTGAGG + Intergenic
1168863269 20:1061613-1061635 TGGCAAGGCCAGGCAGGGTTGGG - Intergenic
1169576390 20:6966608-6966630 TGGCAGGGCCATGCTTTGTCTGG - Intergenic
1171188938 20:23144708-23144730 AGGCAAGGCCAGGCTCTCCTTGG - Intergenic
1171247464 20:23623509-23623531 TGGCAAGTCCAGGATTTGTCAGG - Intergenic
1171431387 20:25085006-25085028 TGGCAGCGCCAGGCTGAGGTTGG + Intergenic
1172387753 20:34546046-34546068 TAGCAAGGCCTGGCAGAGTTGGG - Intergenic
1172509946 20:35493610-35493632 TGGGAAAGCCTGGCTGTGTTGGG - Intronic
1172639737 20:36433508-36433530 GGGCAAAGCCAGGCTGTGGGTGG + Intronic
1173012105 20:39191765-39191787 TGGAAAGACCAGGCAGTGTTGGG + Intergenic
1174533967 20:51236814-51236836 CAGCAAGGCCAGGCTGAGTGAGG + Intergenic
1175953980 20:62598847-62598869 TGGCTAGGCTGGGCTGGGTTGGG + Intergenic
1179013458 21:37574458-37574480 TGGCAAGGCCAGGCTGCGGGAGG + Intergenic
1179238385 21:39567151-39567173 CGGCAAGGCCAGGAGGTGGTGGG - Intronic
1179928669 21:44552262-44552284 GGGCAAAGCCAGCCTGTGCTTGG + Intronic
1180103459 21:45601154-45601176 TGTCAAGGTCAGGCTGCCTTTGG - Intergenic
1181493037 22:23272754-23272776 TGGCAAGGACGGGCTGGGGTGGG - Intronic
1181748989 22:24976074-24976096 TGGGAAGACCAGGCTGTCTGAGG - Intronic
1182044805 22:27265971-27265993 TGGCGATGCCAGGCTCTGTTTGG - Intergenic
1182528392 22:30936468-30936490 GGGCAAAGCCAGCCTGTGTCAGG - Intronic
1183556244 22:38529563-38529585 TTGCCAGGTCAGGCTGTTTTGGG - Intronic
1183803909 22:40192325-40192347 TGGAAAGACCAGGCTGGGTGTGG + Intronic
1183935332 22:41258592-41258614 TCAAAAGGCCAGGCTGTGATAGG - Intronic
1184031011 22:41894723-41894745 TCACAAGGCATGGCTGTGTTTGG + Intronic
951755896 3:26090783-26090805 TGGCAAGGTCAGCATGTTTTTGG + Intergenic
952448570 3:33408684-33408706 TGGCAAAGCGAGGCAGTGTAAGG - Exonic
952863277 3:37832719-37832741 TGGGAAGCCCAGGCTGGGCTGGG - Intergenic
953831357 3:46300306-46300328 TGGCAAGTCTAGCCTGTGTCAGG + Intergenic
955512550 3:59695997-59696019 TGTTAAAGCCATGCTGTGTTGGG - Intergenic
955540440 3:59970601-59970623 TGGCAAGGACAGATTGTTTTAGG + Intronic
956652051 3:71513254-71513276 TGGGAAGGACAAGTTGTGTTGGG - Intronic
958780522 3:98536175-98536197 TGGCAAGGCATGATTGTGTTAGG - Intronic
959732842 3:109623547-109623569 TGGCAAGGCCATGCTTAGTTTGG + Intergenic
961839369 3:129696023-129696045 TTGCAAGGCCATGCTTTGTAGGG + Intronic
965123583 3:164595344-164595366 TGGCAAGAGCAGGCTCTGTGCGG + Intergenic
968624491 4:1620880-1620902 TGGCCATGCCAGGCTGGGATCGG + Intronic
969333141 4:6491516-6491538 TGGCAAGGCCAGGCCATCATGGG + Intronic
969710043 4:8837541-8837563 TAGGAAGGCCTGGCTTTGTTTGG + Intergenic
970115305 4:12687912-12687934 TGGAAAAGCCAGCCTGTGGTAGG - Intergenic
971388441 4:26162683-26162705 TGGCAAGACCACGATGTCTTAGG + Intergenic
972963698 4:44484993-44485015 TTGCAAGGCCAACCTGTGTTGGG - Intergenic
974894496 4:67922845-67922867 TGCCAAGGCCAGGCCGCCTTGGG + Exonic
975991205 4:80262121-80262143 TGGGAAGGGCCGGCTGTGTGAGG - Intergenic
977427166 4:96881963-96881985 AGGAAAGGCCAAGCTGTGCTAGG + Intergenic
978348052 4:107792584-107792606 GGGCAAGGAGAGGCTCTGTTAGG + Intergenic
980197518 4:129609787-129609809 TGTCAATGTCAGGCTCTGTTTGG + Intergenic
982997262 4:162365564-162365586 TGACAATGCCTTGCTGTGTTAGG + Intergenic
983647007 4:170002115-170002137 TAGCAAGGTCAGACAGTGTTAGG - Intronic
984537032 4:180989455-180989477 TGGCAGGGCCAGGCTCTTTGAGG + Intergenic
986007166 5:3677782-3677804 TGGCCAGTCCTGGGTGTGTTTGG + Intergenic
988019977 5:25609519-25609541 TGGGAAGACGGGGCTGTGTTTGG - Intergenic
993626474 5:90230658-90230680 TGGCAACGCAAGGCTTTGATGGG - Intergenic
994221726 5:97204153-97204175 GGGCCAAGTCAGGCTGTGTTAGG + Intergenic
997473518 5:134129818-134129840 TGTCAAGGCCAGGCGGTGGGTGG + Intronic
997723624 5:136101684-136101706 TGGCCAGGCCATGCTGTGTAAGG - Intergenic
998069233 5:139183725-139183747 CGGCAAAGGCAGGCTGTGTATGG + Intronic
998121201 5:139579487-139579509 TAGCAAGGCTAGGCTGGTTTGGG + Intronic
999287829 5:150404815-150404837 GGGCAAAGCCAGGCAGTGTAGGG - Intronic
999671198 5:153960434-153960456 GGGCAAGGCCTGGCTGTGCAGGG - Intergenic
1000434598 5:161192685-161192707 TGGCAAAGCCATGCTATTTTAGG + Intergenic
1001922455 5:175611227-175611249 TGTCTTGGCCAGGCTGTGCTGGG - Intergenic
1002383918 5:178851388-178851410 GGGCGATACCAGGCTGTGTTTGG + Intergenic
1003946015 6:11076733-11076755 TGGGAAGGAGAGGATGTGTTTGG - Intergenic
1004329367 6:14707759-14707781 TGTCAGGGCCAAGCTGTATTTGG - Intergenic
1007335235 6:41150781-41150803 TGGTAGGGCCAGGCTGAGATAGG + Intronic
1007726999 6:43922544-43922566 TGGCTAGGGCAGCCGGTGTTTGG + Intergenic
1008616974 6:53235892-53235914 TGGACAGGCCAGGATGTTTTGGG + Intergenic
1009983560 6:70755546-70755568 AGGCTAGGCTAGGCTATGTTTGG + Intronic
1014213495 6:118730989-118731011 AGCCAAGACCAGGCTGTGGTGGG - Intergenic
1015079041 6:129201237-129201259 TGGCAAGGCCAGGCTGTGTTTGG - Intronic
1015736814 6:136409651-136409673 TGGCAAAGCCAGGCTGGTTTAGG + Intronic
1016863868 6:148747394-148747416 TGGCACGGGCAGGCTGTGGGAGG + Exonic
1017277102 6:152582125-152582147 TGGGAAGTCCTGGCTATGTTTGG - Intronic
1017708453 6:157146118-157146140 TGGCAAGGGCAGACTGACTTGGG - Intronic
1017960127 6:159214402-159214424 TAGCATGGCCAGGCTTTGTCTGG + Intronic
1018272444 6:162094534-162094556 TGGAAAGGCAAGGCTATGTTGGG + Intronic
1018862533 6:167721408-167721430 TGGGACGCCCAGGGTGTGTTTGG - Intergenic
1018903590 6:168063182-168063204 CGGCATGGCCAGGCTCTCTTAGG - Intronic
1021038945 7:15837397-15837419 TCAGAAGGACAGGCTGTGTTTGG - Intergenic
1022369723 7:29759070-29759092 TGGCAAGGTTAGCCTGGGTTGGG - Intergenic
1023553918 7:41400107-41400129 TGGCAAGGCCAAGCTATGAGAGG - Intergenic
1026990032 7:74579828-74579850 TGGATAGGGCAGGCTGTGGTAGG + Intronic
1029052827 7:97707478-97707500 TGGCAAAGCTTGGCTGTTTTTGG - Intergenic
1032214535 7:129947722-129947744 CGGAAAGGACAGGCTGTGTTAGG - Intronic
1033159364 7:138982125-138982147 CCGCAAGGCCAGGCCGTTTTAGG + Intergenic
1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG + Intergenic
1035208552 7:157310875-157310897 TGGCAAGACCTGGCTGGCTTGGG + Intergenic
1035605270 8:926353-926375 TGGGAAGGCCAGGAGGTGTGAGG - Intergenic
1035610103 8:956304-956326 TGGCAAGGCCAGGCCTTGTTAGG + Intergenic
1035759159 8:2056444-2056466 AGGCCAGGCCTGGCCGTGTTGGG + Intronic
1035767170 8:2115748-2115770 TGACAAAGCCTGGCTGTGTGAGG - Intronic
1036633461 8:10531478-10531500 TGGCAGGGCCGGGCTGCGTGGGG - Exonic
1037590720 8:20309931-20309953 TGACATGGCCAGGCTGTTTAGGG - Intergenic
1038589736 8:28825565-28825587 TGGAAAGGGGAGGCTGTGCTGGG - Intronic
1039401574 8:37274434-37274456 TGGCAAGGCTATGCAGTGCTGGG - Intergenic
1039895387 8:41713338-41713360 TGGGAAGGCGAGGCTGTGTAGGG - Intronic
1039944899 8:42120549-42120571 TGGGCTGGCCAAGCTGTGTTGGG + Intergenic
1041249444 8:55920148-55920170 TGGGAAGGCCAGTGTGAGTTGGG + Intronic
1042297855 8:67242161-67242183 AGGCAAGGCCTAGCTGTGCTGGG + Intronic
1043437984 8:80252925-80252947 TGGCAAAGCCAGGCTATTGTTGG + Intergenic
1043973529 8:86559979-86560001 TGCCAAGGCCAGGCTGAGAGGGG + Exonic
1046644682 8:116773135-116773157 TGGCAAGCCAAGGTAGTGTTTGG + Exonic
1047212219 8:122849167-122849189 TGGCAGTGCCAGGCTCTCTTGGG - Intronic
1048095076 8:131283438-131283460 TGGGAAGGCAAGGCAGAGTTAGG + Intergenic
1048878895 8:138857399-138857421 TGTCCAGGCGAAGCTGTGTTTGG - Intronic
1048984646 8:139728715-139728737 TGGCAGAGCCAGGCTGTATTTGG + Intergenic
1050154468 9:2651199-2651221 TGGGAAGGACAGTCGGTGTTTGG - Intronic
1050177584 9:2884191-2884213 AGGCAATGCCAGCCTCTGTTGGG + Intergenic
1052837961 9:33265347-33265369 TGGCAGGGCAAGGCAGTGATGGG - Intronic
1053130338 9:35610959-35610981 TGGGAAGGCCAGGCTGGGCACGG + Intronic
1057267749 9:93630325-93630347 AGGCCAGGCCAGCCTGAGTTAGG + Intronic
1058491223 9:105501800-105501822 TGGAAAGTACAGTCTGTGTTTGG - Intronic
1060547184 9:124468430-124468452 TGGCAAGGCCGGGCTGGGCATGG + Intronic
1060554815 9:124502868-124502890 TGGCAAGGCCAGCCTGGGTTGGG - Intronic
1060923060 9:127436259-127436281 TGCCAGGGCCAGGAGGTGTTTGG + Intronic
1061275382 9:129567085-129567107 TGGCAGGGCCAGGCCGTGGTGGG - Intergenic
1062173450 9:135148092-135148114 TGGCACGGCCACGCTGTGGAAGG - Intergenic
1062288887 9:135785839-135785861 GGGCAAGGCCAGGATGTGCTGGG + Intronic
1188201708 X:27299926-27299948 TGGCTTTGCCAAGCTGTGTTGGG - Intergenic
1188921660 X:35985474-35985496 TGGCAGGGGAAGGCTGTGATGGG + Intronic
1189322011 X:40092425-40092447 TGGCGGGGACAGCCTGTGTTGGG - Intronic
1192154386 X:68733058-68733080 TGCCAGGGCCTGGCTGTTTTGGG - Intergenic
1195063831 X:101221080-101221102 TGGCAAGGCTGGGCTGGGGTGGG + Intronic