ID: 1015082209

View in Genome Browser
Species Human (GRCh38)
Location 6:129240550-129240572
Sequence AGGTGTGACCAGGATGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015082209_1015082213 18 Left 1015082209 6:129240550-129240572 CCATCAACATCCTGGTCACACCT 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1015082213 6:129240591-129240613 TTGTCAACTACTCTCTTAAATGG 0: 1
1: 0
2: 0
3: 13
4: 244
1015082209_1015082214 21 Left 1015082209 6:129240550-129240572 CCATCAACATCCTGGTCACACCT 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1015082214 6:129240594-129240616 TCAACTACTCTCTTAAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015082209 Original CRISPR AGGTGTGACCAGGATGTTGA TGG (reversed) Intronic
900664935 1:3808798-3808820 AGTTGAGCCCAGGAGGTTGAAGG + Intergenic
901028941 1:6294960-6294982 AGGTGTGACCATGAAGCTCATGG - Exonic
901612917 1:10513349-10513371 AGGTGGGAACAGGATGGTGGCGG + Intronic
901705680 1:11071269-11071291 AGGTTTGTCCACGATGGTGATGG - Intronic
902619888 1:17644624-17644646 AGGTGTGAGCGGTATCTTGAAGG + Intronic
902725471 1:18333029-18333051 AAGTGTGTCCAGGAGGCTGAAGG + Intronic
904060472 1:27706065-27706087 AGGTCTGAGCAGGTTGTGGAAGG - Intergenic
905641489 1:39593006-39593028 AGGTATGAGCAGGATGTGGCTGG - Intergenic
909210100 1:72812422-72812444 AGGTGTGAACAAGTTGTGGAAGG - Intergenic
909529227 1:76662931-76662953 AGATGTGACCAGAAAGTTCATGG - Intergenic
909707121 1:78598822-78598844 ACTTGAGACCAGGATGTCGAGGG - Intergenic
910293995 1:85626545-85626567 AGGTGTGGGCAGCATGTTGCCGG - Intergenic
910986323 1:93008205-93008227 AGCTTTGACCAGGCTGTGGAAGG - Intergenic
912474354 1:109926065-109926087 GAGTGTGTCCAGGATGGTGAGGG - Intronic
912560949 1:110551151-110551173 AGGTGGGGCCAGGATGGTGATGG - Intergenic
915553313 1:156647432-156647454 AGGAGTGACAAGGAGGGTGAGGG + Intronic
918465178 1:184814115-184814137 AGGTTTGAACAGGTTGTGGAAGG + Intronic
918585868 1:186187788-186187810 ATGTGTGACTAGAATGTGGAGGG - Intronic
919800230 1:201349585-201349607 ATGTTTGCCCAGGAAGTTGAGGG - Intergenic
920298559 1:204974773-204974795 AGCTTTGCCCAGGATGTTGGTGG - Exonic
920788021 1:209061444-209061466 ATTTGAGACCAGGATGCTGAAGG - Intergenic
921925508 1:220707270-220707292 AGGTGTGGTCCGGATGTGGATGG + Intergenic
923852582 1:237813475-237813497 AGGAGAGACCAGGATGTTGCTGG - Intronic
924610605 1:245570477-245570499 AGGTAAGACCAGCATGTGGAAGG - Intronic
1065287717 10:24201907-24201929 AGGGGTGATCAGGAGGTTGGGGG - Intronic
1065788596 10:29239341-29239363 AGCTGTCACCAGGCTGCTGACGG - Intergenic
1067541845 10:47160577-47160599 AGGTGAGGACAGGATGCTGAGGG + Intergenic
1067774188 10:49150218-49150240 AGGTGTGAACAGGGTGCTGTTGG - Intergenic
1068281521 10:54877068-54877090 AGGTATTACCTTGATGTTGATGG - Intronic
1068835236 10:61545538-61545560 AGATGTCACCATGATGCTGAAGG + Intergenic
1069073181 10:64011184-64011206 AGGTTTGTCCATGGTGTTGATGG + Intergenic
1071449896 10:85784337-85784359 AGGTGTGTCCAGGAGGCTAATGG + Intronic
1071468757 10:85963658-85963680 AGGTGTGACCAGGAGAATCATGG - Intronic
1071666852 10:87567107-87567129 AGTTGTGACCAAAATGCTGATGG + Intergenic
1071986516 10:91056674-91056696 AAGTGTGACCAGGGTGATAATGG - Intergenic
1072105920 10:92273864-92273886 TGGTTTGACCTGGATCTTGAAGG - Intronic
1072434250 10:95400994-95401016 AGGTGTAAGCAGGAAGTTGGGGG + Intronic
1072443918 10:95481260-95481282 AGGTGTGGCCTGGATGTGTAGGG - Intronic
1072808888 10:98444818-98444840 AGGTGTGAAAAGGAGGTTGCTGG + Intronic
1073071249 10:100794569-100794591 ATGGGTAACCAGGATGGTGAGGG - Intronic
1073339607 10:102735091-102735113 AGGAGTGACCAGGATGGGGAGGG - Intronic
1075312714 10:121428284-121428306 AGGTGTCCCCAGGATAATGAGGG + Intergenic
1076987997 11:253243-253265 AGTGGTGACAAGGATGTGGATGG - Intergenic
1077552417 11:3206581-3206603 AGGAGTGACAATGATGATGATGG + Intergenic
1078657863 11:13259092-13259114 AGGTGTGACCAGGCAGGAGAAGG + Intergenic
1081775621 11:45674304-45674326 AGGGGGGCCCAGGATGTTGAAGG + Intergenic
1081858752 11:46320202-46320224 GAATGTGGCCAGGATGTTGAGGG + Intronic
1081870056 11:46379319-46379341 AGATGTGACCAGGAAGTTTATGG - Intronic
1084252070 11:67907579-67907601 AGGGGAGCCCAGGATTTTGAGGG - Intergenic
1085799405 11:79575050-79575072 AAGAGTGACCAGGATGATGAGGG + Intergenic
1086862128 11:91936990-91937012 AAGAATGACTAGGATGTTGAAGG - Intergenic
1087604212 11:100356203-100356225 AGTTTTCACCAGGAAGTTGAAGG - Exonic
1088945840 11:114511777-114511799 AGGTGAGAGCAGGTTGTTTAAGG + Intergenic
1089080037 11:115767974-115767996 ATATTTGACCAGGATCTTGAAGG - Intergenic
1089647063 11:119887235-119887257 AGCTGTGGCCAGGTTGCTGAAGG - Intergenic
1090531925 11:127600091-127600113 CAGTGTGACCAGCTTGTTGAAGG + Intergenic
1091875138 12:3927532-3927554 CAGTGTGCCCAGGATATTGAGGG - Intergenic
1093985889 12:25532639-25532661 AGGTGAGACCACTATTTTGAAGG - Intronic
1097071951 12:56361612-56361634 AGCTGTGCCCAGGTTGTAGAAGG + Exonic
1102255718 12:111413854-111413876 ATGTGTGACCAGTGTGCTGAAGG + Intronic
1105029018 12:132869687-132869709 AGGTCTGACGTCGATGTTGATGG + Exonic
1106518956 13:30480024-30480046 CAGTGTGACCAGAATCTTGAAGG - Intronic
1109948105 13:69464351-69464373 AGGTATGACCATGAGGATGAAGG - Intergenic
1110007659 13:70293240-70293262 AGCTTTGACCAAAATGTTGATGG + Intergenic
1110225664 13:73117097-73117119 AGGTTTTACCAGGAAGATGAGGG + Intergenic
1110299522 13:73909537-73909559 ATATGTGGCCAGGATGGTGAGGG - Intronic
1111705860 13:91748773-91748795 AGGTTTAAGCAGGATCTTGAAGG + Intronic
1112226173 13:97542736-97542758 TGCAGTGACCAGGATGTGGACGG - Intergenic
1112365362 13:98751798-98751820 AGATGTGGCCACGTTGTTGAGGG - Intronic
1112410715 13:99161152-99161174 GGGGGCCACCAGGATGTTGAAGG + Intergenic
1113031969 13:106003382-106003404 AGGAGCAACCAAGATGTTGAAGG + Intergenic
1115877765 14:37879851-37879873 AGATGTGACCAGATTGTGGAAGG + Intronic
1118008150 14:61583851-61583873 AGGTGTGGAGAGGTTGTTGAGGG - Intronic
1119035294 14:71225284-71225306 GGATGTGAGTAGGATGTTGATGG - Intergenic
1119995864 14:79253064-79253086 TAGCGTGACCTGGATGTTGAGGG + Intronic
1121654959 14:95588406-95588428 AGGGGAGACCAGGATGAGGAGGG + Intergenic
1124716885 15:32072052-32072074 GGTTGTGACCAGAATGCTGATGG + Intronic
1128806788 15:70536909-70536931 AGGTGTGGCCAGGATCTTTAGGG + Intergenic
1128928573 15:71681802-71681824 AGGTGGTACCAAGATGTTCATGG + Intronic
1131248541 15:90816562-90816584 AGGTGTGAAGAGGGGGTTGATGG + Intergenic
1132456905 16:29129-29151 ACTTGTGGCCAGGATGCTGAGGG + Intergenic
1132496555 16:266180-266202 AGGAGTGACCAGGAATTTGCTGG + Intronic
1132596773 16:755032-755054 AGCTGTGATGAGGATGTGGAGGG - Intronic
1134241828 16:12512275-12512297 AGGTGGGAGCTGGATGGTGAGGG + Intronic
1134717731 16:16365274-16365296 AGCTGTGACGATGATATTGAAGG - Intergenic
1134957021 16:18386885-18386907 AGCTGTGACGATGATATTGAAGG + Intergenic
1136591946 16:31222972-31222994 GTGTGTGACCAGGCAGTTGATGG + Intronic
1137586997 16:49669716-49669738 GGGGGTGACCTGGATGGTGAGGG - Intronic
1138378929 16:56587021-56587043 AAGGGTGGCCAGGATTTTGAGGG - Intergenic
1139436400 16:66939100-66939122 ATGTGTGAGCAGGATATTGTGGG + Intronic
1140200371 16:72890027-72890049 GGCTGTGACCAGGATGGTGTGGG - Intronic
1141167281 16:81669078-81669100 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167311 16:81669216-81669238 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167321 16:81669264-81669286 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141167374 16:81669492-81669514 AGGTGTGAGGTGGATGTGGAAGG - Intronic
1141873485 16:86805848-86805870 AGATGTTACCAGCATGTTGCAGG - Intergenic
1143679887 17:8468417-8468439 AGGAAGGACCAGGATGTTGAGGG + Intronic
1144727555 17:17509478-17509500 GGGGTTGTCCAGGATGTTGAAGG + Exonic
1145060263 17:19728767-19728789 AGCTGTGAGCAGGAGGTGGAAGG - Intergenic
1148377241 17:47159592-47159614 GAGTTTGGCCAGGATGTTGATGG + Intronic
1151658263 17:75505752-75505774 AAGTGGTACCAGGATGTGGAGGG - Intronic
1152631328 17:81411855-81411877 AAGAGTGACCAGGGTGTGGAGGG - Intronic
1153513006 18:5875926-5875948 AGGTGTGAACAGAAGGATGAAGG + Intergenic
1154229167 18:12538932-12538954 AGCTGTGACCATGATGATGGTGG - Intronic
1156499557 18:37548913-37548935 AGGGGTGGCCTGGATGTTGCAGG - Intronic
1156607299 18:38681012-38681034 GGCTGTGACCAAAATGTTGATGG - Intergenic
1156887437 18:42151767-42151789 AAGTGTGCCCAGGGTGTTGCTGG - Intergenic
1160799601 19:961491-961513 AGGTGCGAACAGGATGATAAAGG - Intronic
1162819050 19:13211930-13211952 AGGTGTGACCAGGTGGTGGGTGG + Intronic
1163454009 19:17395300-17395322 AGGTGTGATCAGGTCCTTGAAGG - Intergenic
1164675895 19:30101214-30101236 AGCTGGGACAAGGATGTGGATGG + Intergenic
1165894948 19:39136031-39136053 AGGTGTGACCAGGAAGGGGGTGG - Intronic
1167643116 19:50692903-50692925 AGGTCTGAGGAGGATGTTTAGGG - Intronic
926892369 2:17649566-17649588 ATGTATGACCTGGATGGTGATGG + Exonic
929258590 2:39839804-39839826 ATGTGTGACTAGGATTTTAAAGG + Intergenic
929533400 2:42766010-42766032 AGGGGTGACGAGGAGGTTGAAGG + Intergenic
929766081 2:44845003-44845025 GGTTGTGAGCAGGATGATGATGG + Intergenic
929973468 2:46607628-46607650 AGATGTGGCCTTGATGTTGACGG + Intronic
935105608 2:100040577-100040599 TGATGAGAGCAGGATGTTGAAGG + Intronic
938200582 2:129369347-129369369 AAGTGTGACAGGGATGTTGAGGG - Intergenic
938549516 2:132367472-132367494 GGGGCTGACCAGGATGGTGAGGG - Intergenic
938779950 2:134575923-134575945 AGGTGAGCCCAGGATGCAGAAGG + Intronic
939931243 2:148236114-148236136 AGGTCTTACCTGGATGTTGATGG + Intronic
945808010 2:214513980-214514002 AGATGACAGCAGGATGTTGATGG + Intronic
946110216 2:217408394-217408416 AGATGTCTCCAGGGTGTTGAAGG + Intronic
946137289 2:217657671-217657693 AAGTGTGGGCAGGATGTTAAAGG - Intronic
946413816 2:219529355-219529377 AGGTGTGTGGGGGATGTTGAGGG + Intronic
946602868 2:221371315-221371337 ATGTGTGACGTGGATGTGGAGGG - Intergenic
946815120 2:223569166-223569188 AGGTATGGCCAGGATGTTTTGGG - Intergenic
947770749 2:232668340-232668362 AGGTGTGACAGGGATGCTGCTGG + Intronic
948432275 2:237927420-237927442 AGGTGGCACCAGGAAGATGATGG + Intergenic
1168810874 20:703788-703810 CAGTGTGAACAGGAAGTTGACGG + Intergenic
1170400465 20:15977714-15977736 CGGTGTGATCAGGATCTGGATGG + Intronic
1171127787 20:22619520-22619542 AGGTGGGACAAGCCTGTTGAAGG - Intergenic
1171188657 20:23142341-23142363 AGGTGTGGCCAACATGTCGAGGG + Intergenic
1171324890 20:24282653-24282675 AGGGGTGACAAGGATGTAGTTGG + Intergenic
1172595501 20:36148520-36148542 AGGTGAGACCAGGCTGTGGAAGG + Intronic
1174214606 20:48906511-48906533 AGCTGTGAGCTGGATGTTGAAGG - Intergenic
1175860901 20:62149501-62149523 TGGTGTTACCAGGATGGGGATGG + Intronic
1176980783 21:15378508-15378530 AGGGGTCATCAGGATGTGGATGG + Intergenic
1179148521 21:38790058-38790080 AGGAGTCACCAGGAGGCTGATGG - Intergenic
1179219026 21:39390138-39390160 AGGTGGGAGTAGGATGTTGGAGG + Intronic
1179960968 21:44766803-44766825 AGGTGTGTCTGGGATGGTGAGGG + Intergenic
1181607311 22:23988502-23988524 GTGTGTGAGTAGGATGTTGAGGG - Intergenic
1181762678 22:25068814-25068836 AGATGGGCCCAGGATGTTGCTGG + Intronic
1183221450 22:36516441-36516463 TGGTGTCACCAGGAGGGTGATGG + Intronic
1183822889 22:40361191-40361213 AGCTGTGACTAGGCTGATGAAGG - Intronic
949091959 3:39237-39259 AGGTGAGACCAGGAGGCTAAAGG + Intergenic
951524431 3:23640161-23640183 AGGTGTGGCCAAGATGATGGGGG - Intergenic
953964848 3:47296211-47296233 TGGTCTGAGCAGGATGTAGATGG + Intronic
954872839 3:53780787-53780809 AGGAGTGACCAGGAGGTGGGGGG + Intronic
956143775 3:66172013-66172035 AGGGGAGCGCAGGATGTTGATGG - Intronic
956204403 3:66740767-66740789 AGGTGGGAGCAGGATATTTAGGG + Intergenic
956748013 3:72324800-72324822 ATATGTGCCCAGGATGTTCAAGG + Intergenic
957032273 3:75255463-75255485 AGGTGAGACCAGGAGGCTAAAGG + Intergenic
960583441 3:119299948-119299970 AGGTGTGACCACGATGTGCCAGG - Intronic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
964530402 3:157661582-157661604 AGGTGTGATTGGGAAGTTGAGGG + Intronic
965922279 3:173931560-173931582 AAGTGTGTCCTGGATATTGAAGG + Intronic
967842648 3:194019216-194019238 AAGTGTAACCAGGAGGGTGATGG - Intergenic
967844009 3:194030297-194030319 AGGTGTCTCCAGGATGTTAAAGG + Intergenic
968324236 3:197798450-197798472 AGGTGAGAGCAGGATGCTGTGGG + Intronic
969046506 4:4340365-4340387 AAGTGTGAACAGGATGGTGGGGG + Intergenic
969269998 4:6093135-6093157 AGGTGTGAGCTGGGTTTTGAAGG - Intronic
969719018 4:8882892-8882914 AAGTGTGAGAAGGATTTTGAAGG + Intergenic
971708946 4:30086272-30086294 GGGTGTTGCCTGGATGTTGATGG + Intergenic
973810671 4:54566941-54566963 AGGTGTGACCAGGAAGAACAGGG + Intergenic
975633857 4:76426426-76426448 AGGTGTGAGCAGAACCTTGAAGG + Intergenic
975936648 4:79589302-79589324 TGGTGTGACGAGGAGGATGATGG + Intergenic
977593516 4:98852525-98852547 AGGTGTGACTAGCATCTTGTAGG - Intergenic
981218257 4:142197937-142197959 AAGCGTGACTAAGATGTTGAAGG - Intronic
981943075 4:150307247-150307269 AGTTGTTGCCAGGAGGTTGAGGG + Intronic
982579965 4:157163958-157163980 AGGTATGATGAGGATGCTGAGGG - Intronic
983553978 4:169043583-169043605 AGATGAGACCTGGATGATGAAGG - Intergenic
984402692 4:179287269-179287291 AAATGTGACAAGTATGTTGAAGG + Intergenic
989695631 5:44197152-44197174 AAGTGTGGCCAAGAGGTTGAGGG - Intergenic
992461332 5:76963225-76963247 TGGTATTGCCAGGATGTTGAGGG + Intronic
992551445 5:77864355-77864377 AGATGTGCCCAGGATGTTCTGGG - Intronic
994682750 5:102909600-102909622 AGATTTGACCAAGATGTTGATGG + Intronic
996412649 5:123175303-123175325 TGGTGTGCCCAGGAGGCTGAAGG - Intronic
997970813 5:138400054-138400076 AGGTATGTCCAAGATGTTGTGGG + Intronic
999545273 5:152622500-152622522 AAGGGTGACCAGGATGATGATGG - Intergenic
999998460 5:157114801-157114823 AGGTATGCCCAGGATCTTGGTGG - Intronic
1001280849 5:170385337-170385359 AGTCGTGACCAGGATGTAGTAGG + Exonic
1001307051 5:170582827-170582849 AGCTGAGAACTGGATGTTGAAGG + Intronic
1002100764 5:176856478-176856500 AGGTCTCACCAGGATGCTGATGG - Intronic
1002318871 5:178363144-178363166 AGGTGTGAGCAGTATTTTTAGGG + Intronic
1002405510 5:179027164-179027186 AGGTGTGACCTGTAAGATGAGGG + Intronic
1003099864 6:3168803-3168825 AGGTTTTACTAGGATGGTGATGG - Intergenic
1005003108 6:21262694-21262716 ATGTGTGAGCAGGGTTTTGAAGG - Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006501720 6:34463744-34463766 AGGTGTGACAAGCATGTGGGTGG - Intergenic
1006810810 6:36819479-36819501 TGGTGGGACCAAGAGGTTGAAGG - Intronic
1007496240 6:42261819-42261841 AGTTCTGAGCAGGATTTTGAAGG - Intronic
1009932653 6:70194393-70194415 AAGGGGCACCAGGATGTTGAAGG - Intronic
1010075661 6:71794203-71794225 AGGACTGGCCAGGATGTAGATGG - Intergenic
1012447278 6:99319466-99319488 AGGCGTGACCAGCATCTGGAAGG - Intronic
1013749616 6:113388471-113388493 CTGTGTGACAAAGATGTTGATGG - Intergenic
1015082209 6:129240550-129240572 AGGTGTGACCAGGATGTTGATGG - Intronic
1016799843 6:148157457-148157479 AGCAGTCACCAGGATGGTGAAGG + Intergenic
1017137368 6:151160260-151160282 AGGTGTGACCATGACATTCAAGG - Intergenic
1020012681 7:4815296-4815318 GGGTGTGGCCAGCAGGTTGAGGG + Exonic
1023877616 7:44295978-44296000 ATGTGACAGCAGGATGTTGAGGG - Intronic
1023878724 7:44306865-44306887 AGGTGTGAGCAGGAGGAGGAGGG + Intronic
1026497655 7:70917584-70917606 AGGTGTGAACTGGATATTGGAGG - Intergenic
1027469373 7:78554313-78554335 AAGTGTGACCAAGATCATGATGG - Intronic
1030144295 7:106337398-106337420 AGGTTTGAACAGGTTGTGGAAGG + Intergenic
1032284325 7:130529405-130529427 AGATGGGTCCAGGAAGTTGATGG + Intronic
1036492447 8:9240636-9240658 ACCTGAGCCCAGGATGTTGAGGG - Intergenic
1036565610 8:9935358-9935380 GGGTGTGATTAGGATGCTGAGGG + Intergenic
1036565620 8:9935418-9935440 AGGTGTGATTAGGATGATGGAGG + Intergenic
1036565644 8:9935516-9935538 AGGTGTGATTAGGATGATGGAGG + Intergenic
1036988791 8:13568156-13568178 AGTTTGGGCCAGGATGTTGATGG + Exonic
1038070601 8:24008559-24008581 AGGTGTGACTAGGAAGATAATGG - Intergenic
1039508835 8:38072650-38072672 AGTTCTGACCAGGATGTGGTAGG - Intergenic
1044099803 8:88120686-88120708 ATGTGTGACTAGGCTGTTCATGG - Intronic
1044193532 8:89347789-89347811 AGGTGAGAGGAGGTTGTTGATGG - Intergenic
1045880243 8:107029916-107029938 AGCTGTGACCAAAATGCTGATGG + Intergenic
1046807066 8:118490670-118490692 AGGTGTGACCAGCATCTTCAAGG + Intronic
1047374395 8:124282268-124282290 AGTTCTGACCTGGAAGTTGAAGG - Intergenic
1047507787 8:125493701-125493723 ATGTGTAACCCTGATGTTGAGGG + Intergenic
1048338952 8:133524384-133524406 AGGTGAGACCAGCATTTTGCAGG + Intronic
1049244493 8:141554760-141554782 AGGTGTGTCCATGGTGTTGGAGG + Intergenic
1049244520 8:141554957-141554979 AGGTGTGTCCATGTTGTTGAAGG + Intergenic
1049244543 8:141555133-141555155 AGGTGTGTCCATGGTGTTGAAGG + Intergenic
1049244550 8:141555172-141555194 AGGTGTGTCCATGGTGTTGGAGG + Intergenic
1049244557 8:141555211-141555233 AGGTGTGTCCATGGTGTTGGAGG + Intergenic
1049244564 8:141555250-141555272 AGGTGTGTCCATGGTGTTGGAGG + Intergenic
1049244570 8:141555289-141555311 AGGTGTGTCCATGGTGTTGGAGG + Intergenic
1051797738 9:20892923-20892945 AGGTCTTGCCTGGATGTTGATGG - Intronic
1052721960 9:32182817-32182839 AGGGGTGACTAGCATGTTAAAGG + Intergenic
1055087129 9:72325771-72325793 AGGTGTGACATGAAAGTTGAAGG + Intergenic
1059049751 9:110911216-110911238 AGGTCTGGCCTTGATGTTGATGG - Intronic
1059463749 9:114452298-114452320 AGGTGTCACCAACATGCTGACGG + Intronic
1060517518 9:124275372-124275394 AGGGGTGACCTGGTTGATGACGG + Intronic
1061007464 9:127936306-127936328 AGGTGTGAGCAGAGTGATGATGG + Intronic
1185642414 X:1596101-1596123 AGGTGTGAACAGCATGTGGAGGG - Intronic
1186386148 X:9112225-9112247 CCGTGACACCAGGATGTTGATGG - Intronic
1189091017 X:38082911-38082933 AAGTTGGACCAGGATGTAGATGG + Intronic
1189616267 X:42787677-42787699 AGCTGTAAACAGGATGTTTAGGG + Intergenic
1192066527 X:67890960-67890982 GGCTGTGACCAAAATGTTGATGG + Intergenic
1192155498 X:68743497-68743519 AGGTGTGTCCAGTATGGTGGAGG - Intergenic
1192676784 X:73204783-73204805 AGGTGTTACCTTGATGTTGATGG - Intergenic
1198098319 X:133401889-133401911 ACCTGTCACCAGGATGTTGGAGG - Intronic
1200399455 X:156010594-156010616 ACTTGTGGCCAGGATGCTGAGGG - Exonic
1201623357 Y:15985200-15985222 ACATGAGACCAGGAGGTTGAAGG - Intergenic