ID: 1015086260

View in Genome Browser
Species Human (GRCh38)
Location 6:129295363-129295385
Sequence GAACCTATACAGTTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015086259_1015086260 -2 Left 1015086259 6:129295342-129295364 CCGAGAGAGACACATTTATGGGA 0: 1
1: 0
2: 1
3: 19
4: 244
Right 1015086260 6:129295363-129295385 GAACCTATACAGTTTCTCACTGG 0: 1
1: 0
2: 0
3: 5
4: 89
1015086257_1015086260 -1 Left 1015086257 6:129295341-129295363 CCCGAGAGAGACACATTTATGGG 0: 1
1: 0
2: 0
3: 23
4: 142
Right 1015086260 6:129295363-129295385 GAACCTATACAGTTTCTCACTGG 0: 1
1: 0
2: 0
3: 5
4: 89
1015086255_1015086260 0 Left 1015086255 6:129295340-129295362 CCCCGAGAGAGACACATTTATGG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1015086260 6:129295363-129295385 GAACCTATACAGTTTCTCACTGG 0: 1
1: 0
2: 0
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015086260 Original CRISPR GAACCTATACAGTTTCTCAC TGG Intronic
907989635 1:59567060-59567082 AAACCTTTACAGTTGCTAACTGG - Intronic
908148889 1:61278856-61278878 TAACCTATTCAGTATCACACAGG - Intronic
909119764 1:71587170-71587192 GAGCCCATACAGTTGCTTACTGG + Intronic
911428498 1:97752850-97752872 GAACCCAACCATTTTCTCACTGG - Intronic
912649710 1:111426924-111426946 GATCCAACACAGTTTCTCAGAGG - Intronic
912970012 1:114272287-114272309 GAACCCATCCATTTTCTCAGAGG - Intergenic
913173519 1:116253703-116253725 GCTCCCACACAGTTTCTCACTGG + Intergenic
913552913 1:119934407-119934429 TAACCAGTACAGTTTCTCAAAGG + Intronic
915818903 1:159000238-159000260 AAACCTATCCAGTTCCTCATCGG + Intronic
919467589 1:197941020-197941042 GAACCTTTACTGTTTCACAGAGG - Intergenic
1065043338 10:21719837-21719859 GTTCCTGTACAATTTCTCACTGG - Intronic
1071552411 10:86576985-86577007 GAAGCTAAACATTTTTTCACAGG - Intergenic
1071759750 10:88588766-88588788 TAAAATATTCAGTTTCTCACTGG + Intronic
1080178363 11:29393936-29393958 TAATCCATACAGTTTCTCCCAGG - Intergenic
1085327651 11:75619402-75619424 GTACATGTACAGTTTGTCACAGG + Intronic
1085836112 11:79958442-79958464 GAACCTCTATTGTTTCTCTCAGG - Intergenic
1085896258 11:80642926-80642948 GAACCTGAACAGTTTGTGACGGG + Intergenic
1090858832 11:130634975-130634997 GTTTCTATACAGTTCCTCACTGG - Intergenic
1093563827 12:20578030-20578052 TAACCTATCCAGTTTCTCCCTGG - Intronic
1095347728 12:41171227-41171249 GAAGCTATACTGTCTCTCAAAGG + Intergenic
1100315169 12:93438615-93438637 GAACCTCTACAGTTTTTAGCAGG + Intronic
1107322039 13:39200403-39200425 TGACCTGTACAGTTTCTCCCAGG - Intergenic
1108792506 13:53988760-53988782 TAAACTATACAGTCTCTAACTGG - Intergenic
1114667811 14:24390734-24390756 GAGCCTACAAAGTTTCTCAGAGG - Intergenic
1118685341 14:68285165-68285187 GGACCTGAACAATTTCTCACAGG + Intronic
1120985511 14:90331357-90331379 AAACCTAATCAGTTTCTCTCTGG - Intronic
1121036230 14:90705886-90705908 CAGCCTATAGAGTTTCCCACTGG + Intronic
1129164816 15:73770898-73770920 CAACCAATACAGATTCTCCCTGG - Intergenic
1130163543 15:81427186-81427208 AAAACTATATAGTGTCTCACAGG - Intergenic
1135204273 16:20469548-20469570 CAACCTATACAGTATGTCAGTGG - Exonic
1135214723 16:20555418-20555440 CAACCTATACAGTATGTCAGTGG + Exonic
1138130719 16:54477386-54477408 GAAGGTATTCAGGTTCTCACTGG - Intergenic
1138812249 16:60164714-60164736 AAACCTATGCAGTTTCTAAAGGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1145853127 17:28123189-28123211 GAACCTATTGAGTTTCGCATTGG + Intronic
1149743005 17:59065923-59065945 GTAGCTATACAGTTAATCACAGG - Intronic
1150472520 17:65449266-65449288 GAACTTATGCAGTTCCTAACAGG + Intergenic
1155995524 18:32327256-32327278 GAACCTATACAGATGCTGAATGG + Intronic
1160133345 18:76249493-76249515 ATACCAATACAGTTGCTCACAGG + Intergenic
1160487308 18:79305532-79305554 GAAGGAATACAGTTTCTCCCAGG + Intronic
1160546665 18:79661531-79661553 TAACATAGACTGTTTCTCACAGG + Intergenic
1168162401 19:54520250-54520272 GAACCTATAGAGTTCCCTACAGG - Intergenic
929401726 2:41590439-41590461 GAACCCATGCAGATTCCCACAGG + Intergenic
930130145 2:47841516-47841538 GGACCTGTAGAGTTTCTTACAGG - Intronic
931113374 2:59137655-59137677 CATCCTACACAGTTTTTCACAGG - Intergenic
931281067 2:60792451-60792473 AAGCCTATACCGTTTCCCACAGG - Intronic
937135627 2:119549749-119549771 GGACCTAGACAGATTCTCTCTGG - Intronic
937873185 2:126801116-126801138 CAACTAATTCAGTTTCTCACTGG - Intergenic
938738357 2:134207009-134207031 GAACCAATACAGAGTCTCACTGG + Intronic
940072795 2:149708411-149708433 GAAACAATACAGTTACTCAGAGG + Intergenic
941140250 2:161771521-161771543 GAACCCATACAGTTAACCACCGG - Intronic
941997004 2:171610685-171610707 GAACCCACACAGAATCTCACAGG + Intergenic
944401452 2:199331228-199331250 GAAGCTATACAGTTTCAAAATGG - Intronic
947436885 2:230080503-230080525 GAACTTATTCAGTTTCTCCAGGG - Intergenic
1174435355 20:50502682-50502704 GAAGCTATACAGTCTCTCCAAGG - Intergenic
1174927531 20:54777050-54777072 GCAACTATAAAGTTTCTCATTGG - Intergenic
1183114802 22:35682767-35682789 GAACTTATACAGTTTGTTTCTGG + Intergenic
949663724 3:6312422-6312444 AAATATATACAGTTTCTGACTGG + Intergenic
953330401 3:42048231-42048253 GAACCTGTAGAGTTTACCACGGG + Intronic
958679981 3:97316837-97316859 TAATCTAAACAGTTTCTTACTGG + Intronic
960410009 3:117311551-117311573 GAAGCTATAGAGTTTGTCCCAGG + Intergenic
972215177 4:36889978-36890000 CATCTTATACAGTATCTCACAGG + Intergenic
976399747 4:84594270-84594292 GAACCTATTCAGCTTCTAAGGGG + Intronic
978222647 4:106295079-106295101 GATACTATACAGTACCTCACAGG + Exonic
986909202 5:12533592-12533614 CATCCTATATAGTATCTCACTGG - Intergenic
990080922 5:51912659-51912681 GAAGCAACACAGATTCTCACTGG - Intergenic
992409417 5:76490687-76490709 TAACCTATACAGTTCCTTGCTGG - Intronic
997538076 5:134638271-134638293 CAACCTTTACAGTTTCTCATAGG - Intronic
999172084 5:149603958-149603980 GTACCTATAGATGTTCTCACAGG + Intronic
999622631 5:153488229-153488251 GAACCTATTCTGTATCTCACAGG - Intergenic
1004169527 6:13285188-13285210 AAACATATCCAGTTTCTCAATGG + Intronic
1009508028 6:64510840-64510862 GAACCTGCACTGTTTCTCTCCGG + Intronic
1011541148 6:88431538-88431560 GACCTTATTCAGTTTTTCACTGG - Intergenic
1015086260 6:129295363-129295385 GAACCTATACAGTTTCTCACTGG + Intronic
1016872604 6:148833577-148833599 GAACATATACTTTTTCTCCCTGG - Intronic
1024419397 7:49144584-49144606 GAATCTATTCAGTTTGACACTGG + Intergenic
1026178449 7:68018075-68018097 GAAACAATACAGTTTCTACCTGG - Intergenic
1027884264 7:83883217-83883239 GTATCTATAGAGATTCTCACTGG - Intergenic
1029837635 7:103330219-103330241 GAACACATAGAGTTTCTCTCAGG - Intronic
1029895494 7:103979128-103979150 GAACCTACAGAGGTTCTCAGAGG - Intronic
1030821087 7:114092598-114092620 GCACTTATAAAATTTCTCACTGG + Intronic
1032845981 7:135752380-135752402 GAACATCTACAGCTTCTCAAGGG + Intergenic
1034533785 7:151714220-151714242 CATCCTATGCAGTTACTCACCGG + Intronic
1042152922 8:65808790-65808812 GAACCTATACAATTCCTTGCAGG + Intronic
1044491214 8:92817765-92817787 AAGCTTATACAGTTTTTCACGGG + Intergenic
1047057727 8:121185348-121185370 GAACCTCTCCAGTTCTTCACAGG - Intergenic
1047113021 8:121811890-121811912 GAACCAATACAGTGTCTGACTGG + Intergenic
1053724583 9:40986195-40986217 GAAACTGTACAGTTTCTAAGAGG - Intergenic
1055538487 9:77275542-77275564 GAACCTCTTCAGTTTCCAACTGG + Exonic
1057814468 9:98284617-98284639 CAACCTATACAGTTTTTAAAGGG - Intergenic
1193569435 X:83124494-83124516 GAATCTATTCACTCTCTCACTGG + Intergenic
1194869481 X:99110661-99110683 GTAAGTATTCAGTTTCTCACAGG + Intergenic
1196291820 X:113950710-113950732 TAACCCATCCATTTTCTCACTGG + Intergenic
1199110074 X:143921416-143921438 GAGCTCATACAGATTCTCACAGG + Intergenic
1200882973 Y:8239871-8239893 GAACCCACACAGTTGCTCTCTGG + Intergenic