ID: 1015086320

View in Genome Browser
Species Human (GRCh38)
Location 6:129296802-129296824
Sequence AACCCTGAAGTATTTTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015086319_1015086320 27 Left 1015086319 6:129296752-129296774 CCAGATTAAAATATCATAATAAT 0: 1
1: 0
2: 7
3: 80
4: 716
Right 1015086320 6:129296802-129296824 AACCCTGAAGTATTTTAAGCAGG 0: 1
1: 0
2: 1
3: 39
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015086320 Original CRISPR AACCCTGAAGTATTTTAAGC AGG Intronic
901099435 1:6708028-6708050 ACCACTGAAGGATTCTAAGCAGG + Intergenic
902253855 1:15174567-15174589 AACTCTGAAGTGTTTCAACCTGG + Intronic
903561760 1:24233395-24233417 AACCCAGAAGTGGTTCAAGCAGG + Intergenic
904837052 1:33345516-33345538 AACCTTGAAGTTTTCTATGCTGG + Intronic
908316445 1:62937434-62937456 AACCCTGAAGAATGGTAAGCCGG + Intergenic
908336642 1:63132257-63132279 AACCATGAGTTATTTTATGCAGG + Intergenic
908555863 1:65255590-65255612 AACACTGAAGTGTGCTAAGCAGG + Intronic
909279377 1:73729457-73729479 GCCACTGAAGAATTTTAAGCCGG + Intergenic
911445234 1:97984238-97984260 AAGCTTGAAGTTTCTTAAGCAGG - Intergenic
913143891 1:115970089-115970111 ACCACTGAAGTGTTTTAAGTCGG - Intergenic
913507652 1:119533095-119533117 AACCCAGAAGTTTAATAAGCTGG + Intergenic
914837661 1:151221129-151221151 AACCCTGTAGTATTTTTTGAGGG + Intronic
914943219 1:152040998-152041020 AACATTGAAGATTTTTAAGCAGG + Intronic
915246748 1:154560929-154560951 ACTCCTGGAGGATTTTAAGCAGG + Intergenic
915988007 1:160485632-160485654 AAACCTGCAGGGTTTTAAGCAGG + Exonic
916626498 1:166563706-166563728 AACTCTTAAGTATTTCCAGCAGG + Intergenic
916875870 1:168968067-168968089 AACCCTGAACTTTTTTGAGTAGG - Intergenic
918545034 1:185672628-185672650 AACCCTGAAGTGTCTTAAAAGGG - Intergenic
919333131 1:196196893-196196915 AACCCTGAAATATTTCAGGGTGG + Intergenic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
920849984 1:209622247-209622269 GCCACTGAAGGATTTTAAGCAGG + Intronic
921110508 1:212032382-212032404 AACCATGGAGGATTTTCAGCAGG - Intronic
921557262 1:216613676-216613698 TAACCTGAAGTTTTCTAAGCAGG - Intronic
922647675 1:227306081-227306103 GTCACTGAAGTATATTAAGCAGG + Intronic
924925968 1:248681130-248681152 AACCTTGAAATATTTTATGAAGG + Intergenic
1064072111 10:12239356-12239378 CAAACTGAACTATTTTAAGCAGG - Intronic
1067658392 10:48215108-48215130 GCCCCTGAAGAATTTTAAACAGG - Intronic
1068448607 10:57157266-57157288 AATTCTAAAGTATTTTAAGAGGG + Intergenic
1070342816 10:75513206-75513228 AACCCTGAAGTTTGTTACACCGG - Intronic
1071100739 10:82034716-82034738 AACCATGAAGGATTTAAAGAAGG - Intronic
1072827828 10:98626414-98626436 AACCCTGAACTGGTATAAGCGGG - Intronic
1072952396 10:99859148-99859170 TAGCATGAAGTATTTAAAGCTGG + Intergenic
1073018394 10:100420380-100420402 ACCAATGAAGTGTTTTAAGCAGG + Intergenic
1073265359 10:102224965-102224987 ACCACTGAAGGTTTTTAAGCAGG + Intergenic
1074032731 10:109704744-109704766 ACCACTGAAGTACTTTAAGTAGG + Intergenic
1074032733 10:109704778-109704800 ACCACTGAAGTACTTTAAGCAGG + Intergenic
1077868607 11:6242919-6242941 ACTATTGAAGTATTTTAAGCAGG - Intronic
1078846237 11:15120733-15120755 AGCACTGAGGTATTTTAAGAAGG + Intronic
1079676365 11:23231886-23231908 TACCCTAAAATATTTTAAGATGG + Intergenic
1080134904 11:28843334-28843356 ATCACTGGAGCATTTTAAGCAGG - Intergenic
1080580360 11:33637380-33637402 ACTACTGAAGAATTTTAAGCAGG - Intronic
1081447038 11:43140589-43140611 ACCCCTGAAGCATTTGAAGCAGG - Intergenic
1081767135 11:45619282-45619304 ATCCCTGTAGTTTTTTCAGCTGG + Intergenic
1081953927 11:47072189-47072211 CACACTGAATTATTTGAAGCTGG + Intronic
1085386356 11:76160432-76160454 AACAGGGAAGGATTTTAAGCTGG + Intergenic
1085928446 11:81052053-81052075 AACGATGGAGTATTTTAAGGAGG - Intergenic
1087579550 11:100034813-100034835 AACGTTGAAGTGTTTTAAGCAGG - Intronic
1087777766 11:102272233-102272255 ACCACTGAAGTATTTTGAGCAGG - Intergenic
1088446851 11:109940087-109940109 ATCACTGAAGAATATTAAGCAGG - Intergenic
1089220991 11:116871494-116871516 ATCACTAAAGGATTTTAAGCAGG + Intronic
1089866185 11:121634265-121634287 AACCCTGAAGTATTATCATCTGG + Intergenic
1089977766 11:122747143-122747165 ACCTCTGCAGGATTTTAAGCAGG + Intronic
1090325412 11:125882089-125882111 GAAACTGAAGTGTTTTAAGCAGG - Intergenic
1090575650 11:128100060-128100082 AATACTGAAGAATTTTAAGTAGG - Intergenic
1091162140 11:133433754-133433776 AACCCTGAAGTGGGTTAAGGGGG - Intronic
1091820842 12:3474110-3474132 TACCCTGAAGAATCTCAAGCTGG - Intronic
1091837980 12:3599274-3599296 AACACTGAAGGATTTTAATCAGG + Intergenic
1091896703 12:4110792-4110814 GACTTTGAAGTATTTTAAGCAGG + Intergenic
1092396028 12:8127525-8127547 AAAATTGAAGAATTTTAAGCAGG + Intronic
1093005829 12:14049743-14049765 CCACGTGAAGTATTTTAAGCAGG - Intergenic
1093459162 12:19392803-19392825 GGCCCTGAGGTATTTTAAGTAGG + Intergenic
1093505267 12:19857896-19857918 TGCCATGAAGTATTTTAAGGGGG + Intergenic
1095281798 12:40360629-40360651 ACCACTGAAGGGTTTTAAGCAGG - Intronic
1095774218 12:45994429-45994451 AACTATGAAGTATTTTAATCAGG + Intergenic
1095939093 12:47714320-47714342 GCCACTGAAGGATTTTAAGCAGG + Intronic
1096089623 12:48890239-48890261 AACCCTGGTCTATTTTGAGCTGG - Intergenic
1096312113 12:50530446-50530468 GCCACTGAAGTATTGTAAGCAGG + Intronic
1098086252 12:66847231-66847253 ACCCCTAAAGGATTTGAAGCAGG - Intergenic
1099265500 12:80441839-80441861 GCCACTGAAGAATTTTAAGCAGG - Intronic
1099611450 12:84877407-84877429 ATTCCTGGAGTGTTTTAAGCAGG - Intronic
1100592320 12:96040978-96041000 GACCTTGAAGGATTTTAAGCAGG - Intronic
1101156330 12:101931071-101931093 TACCCAGAAGAATTTAAAGCAGG - Intronic
1101191566 12:102338889-102338911 AACACTGAATGATTTTGAGCAGG - Intergenic
1102908180 12:116693575-116693597 GCCCCTGGAGTACTTTAAGCCGG - Intergenic
1103546403 12:121704789-121704811 AACCCTGAGGTTTTTGAGGCTGG - Intergenic
1104592334 12:130094583-130094605 AACCCTGAAGAAGTGAAAGCAGG + Intergenic
1106804553 13:33292848-33292870 AACTCTAGAATATTTTAAGCTGG - Intronic
1106953283 13:34908014-34908036 AATCCTGAAAGGTTTTAAGCAGG - Intergenic
1108302841 13:49097128-49097150 ACCATTGAAGGATTTTAAGCAGG + Intronic
1108349747 13:49581112-49581134 ATCCCTGAAGGGTCTTAAGCAGG + Intronic
1108703851 13:52967457-52967479 AGCCATGAAAGATTTTAAGCAGG - Intergenic
1110130404 13:72001855-72001877 GCCACTGAAGTATTTTAAGCAGG + Intergenic
1110443236 13:75548825-75548847 ACCACTGAAGGATCTTAAGCAGG - Intronic
1110708954 13:78628648-78628670 AACACTGAATAGTTTTAAGCAGG + Intronic
1113085405 13:106565126-106565148 AAACGGGAAGGATTTTAAGCAGG - Intronic
1113898069 13:113778170-113778192 AACCCTGCAGTATAAAAAGCCGG + Intronic
1114941395 14:27614797-27614819 AACCCAAAAGTATTTGAGGCAGG - Intergenic
1115389750 14:32841790-32841812 AATCCTGAACTCTTTTAAGTAGG - Intergenic
1115807511 14:37068178-37068200 AGCTCCGAAGGATTTTAAGCAGG + Intronic
1116467967 14:45254880-45254902 AACCCTGAAGTATTAACAGCAGG + Intergenic
1117490248 14:56240140-56240162 AACACAGAAGTAGTTTCAGCAGG + Intronic
1117816661 14:59606002-59606024 AACCCATAAGTATTTTAATATGG - Intronic
1117950129 14:61074581-61074603 AACCCACAAGTATTTCAAGATGG - Intronic
1118899503 14:69974594-69974616 ATCACTGAAGGATTCTAAGCAGG + Intronic
1119564227 14:75615095-75615117 CACCTTGAAGTTCTTTAAGCAGG + Intronic
1121108122 14:91293864-91293886 AACACTGAAGTATCTCAAGGGGG - Intronic
1125912092 15:43449742-43449764 AACCTTGAAGTTTTTTGACCAGG - Intronic
1126575747 15:50194543-50194565 AGCCCTGAAGGATCTTAAACAGG + Intronic
1127940244 15:63688003-63688025 ACCATTGGAGTATTTTAAGCAGG + Intronic
1128295551 15:66515964-66515986 ACCTCTAAAGGATTTTAAGCAGG - Intronic
1130305168 15:82708652-82708674 ACTCCTGAAGGATTCTAAGCAGG - Intronic
1130577683 15:85106817-85106839 GACGCTGAAGGATTTTGAGCAGG + Intronic
1130821082 15:87496243-87496265 GCCACTGAAGAATTTTAAGCAGG - Intergenic
1130858868 15:87867767-87867789 AAATGTGAAGTAGTTTAAGCAGG - Intronic
1132040237 15:98519097-98519119 AGCCCTGAAGTACTTTAGGATGG - Intergenic
1132163229 15:99562610-99562632 ACCCCTGACAGATTTTAAGCAGG - Intergenic
1133589504 16:7229244-7229266 GACACTGAAGTATTTTATGAAGG + Intronic
1133628551 16:7595315-7595337 ACCCCTGAAGTATTCAAAGAAGG - Intronic
1133633759 16:7646767-7646789 AACCCTCAAGTATTTTCCACTGG + Intronic
1133907755 16:10037505-10037527 AACATTAAAGTGTTTTAAGCAGG - Intronic
1134019028 16:10908604-10908626 GTCCCTGAAGGATTGTAAGCAGG - Intronic
1135487429 16:22878574-22878596 AACACTGAAGGATATGAAGCGGG + Intronic
1135828975 16:25756255-25756277 AATCTTGAAGGATTTTAAGCAGG + Intronic
1135859940 16:26047062-26047084 AATCATGTATTATTTTAAGCAGG - Intronic
1137795669 16:51215863-51215885 GAACATGAAATATTTTAAGCAGG - Intergenic
1138479017 16:57289455-57289477 AGGCCTGGAGTGTTTTAAGCAGG + Intergenic
1138480974 16:57303343-57303365 CAGCCTGGAGTGTTTTAAGCAGG + Intergenic
1140330319 16:74050046-74050068 GCCCCTGAAGGATTTTAAGTTGG - Intergenic
1144400264 17:14890616-14890638 AACCCAGTAGTTTTTTAACCTGG - Intergenic
1144768415 17:17745693-17745715 AGCCCTGAAGGCTTTTAAGCAGG + Intronic
1145016428 17:19401621-19401643 AGCCATAAACTATTTTAAGCAGG - Intergenic
1147452511 17:40514600-40514622 AAGCATGAAGGATTTCAAGCAGG + Intergenic
1148016614 17:44526197-44526219 AAGCGTGAAGAATTCTAAGCAGG + Intergenic
1149159364 17:53672303-53672325 AACCATGGAGAATTTTGAGCAGG + Intergenic
1149162050 17:53706136-53706158 ATCACTGAGATATTTTAAGCAGG + Intergenic
1152294212 17:79457198-79457220 AACCCTGAAATATTCTAACAAGG - Intronic
1152493748 17:80655733-80655755 AAATTTGACGTATTTTAAGCTGG - Intronic
1152982048 18:287654-287676 ACCACTGAAGGATTTTCAGCTGG - Intergenic
1153976427 18:10272097-10272119 AGCCCTTCAGGATTTTAAGCAGG + Intergenic
1155130439 18:22929255-22929277 GACCCTGAAATGCTTTAAGCAGG + Intronic
1157978605 18:52354280-52354302 AACCCTGAAAGATTTTCAGCAGG + Intronic
1158318528 18:56238088-56238110 CACCCTGATGCTTTTTAAGCAGG - Intergenic
1158374838 18:56851133-56851155 CGCCCTGAAGAATTTTAAGCAGG - Intronic
1159101998 18:63968306-63968328 AACACAAAAGGATTTTAAGCTGG - Intronic
1159495115 18:69192696-69192718 AACCATGAAGGATTTGAAGATGG - Intergenic
1160321137 18:77896808-77896830 AAGCCTGAAATATTTGAAACAGG + Intergenic
1162793402 19:13074478-13074500 ACCCCTGAGGGGTTTTAAGCAGG + Intronic
1164064602 19:21705155-21705177 CAGCCTGAAGTATTTTAAAATGG + Intergenic
927610916 2:24539541-24539563 AGCCATGAAGAGTTTTAAGCTGG + Intronic
929241684 2:39659959-39659981 AACTTTGAAGAGTTTTAAGCAGG - Intergenic
930979866 2:57510755-57510777 ACCACTGAAGAATTTTAAGAAGG + Intergenic
931546779 2:63396984-63397006 AGACATGAAGTATTTCAAGCTGG + Intronic
931717072 2:65037719-65037741 GACCCTGAAGGATATTCAGCAGG - Intergenic
932137051 2:69240532-69240554 ATCACTGAAGAATTTTGAGCTGG + Intronic
932986312 2:76729809-76729831 TACACTGAAATATTTGAAGCAGG + Intergenic
933971505 2:87473486-87473508 AACCATTAAGAATTTTAAGATGG - Intergenic
934772797 2:96918575-96918597 AACCCTAAAGTATGTAAAGCTGG - Intronic
935974780 2:108567394-108567416 AACCCTGAACTAGAATAAGCAGG + Intronic
936558191 2:113514142-113514164 AACCCTGAAGCATTCGAAGCAGG + Intergenic
936682273 2:114787424-114787446 AGCCCTGGAGAATTTTGAGCAGG + Intronic
937334435 2:121052827-121052849 AACACTGACGTATTGTATGCAGG - Intergenic
937797669 2:126043199-126043221 AACCCTGAAGTAGTTAAATGGGG + Intergenic
939320177 2:140609883-140609905 ATCATTGAAGGATTTTAAGCAGG - Intronic
940600605 2:155854638-155854660 GACCCTGAAGGATGTTAAGCAGG - Intergenic
940936652 2:159503153-159503175 AACACTGAAAGATTTTAAGTAGG - Intronic
943596455 2:189863171-189863193 AACCCTCAATTATTTAAAGTAGG - Intronic
944721707 2:202429240-202429262 ACCACTGAAGAATTTTAAGCAGG - Intronic
946202872 2:218081122-218081144 GCCCCTGAAGTATTTTAATCAGG - Intronic
946212878 2:218161732-218161754 AACTCAGAAGTGTTTTAAACAGG - Intergenic
948497205 2:238358940-238358962 AAGCCTGAAGTATTTTTATCTGG - Intronic
1168980407 20:1998752-1998774 ACCACTGGAGTGTTTTAAGCAGG - Intergenic
1169287653 20:4322914-4322936 AACAGTGAAAGATTTTAAGCAGG - Intergenic
1169477328 20:5943454-5943476 AACCCTGAAGTAATTCAATTTGG + Intronic
1170662435 20:18355969-18355991 AACCCTAAAGAATTTCAAGCAGG + Intergenic
1172510184 20:35495322-35495344 ACCTCTGGAGAATTTTAAGCAGG + Intronic
1172707757 20:36895117-36895139 GACACTGAAGGGTTTTAAGCAGG - Intronic
1172957124 20:38768864-38768886 AACCATGAAGGAGTCTAAGCAGG + Intronic
1173878494 20:46392532-46392554 GACATTGAAGAATTTTAAGCAGG - Intronic
1174937532 20:54887466-54887488 ATCCTTGAAGGGTTTTAAGCTGG + Intergenic
1175716786 20:61260368-61260390 AACCCTTAGATATATTAAGCCGG + Intronic
1177005153 21:15663522-15663544 ATCACTTAGGTATTTTAAGCAGG + Intergenic
1181913422 22:26258858-26258880 AAATATGAAGGATTTTAAGCTGG + Intronic
1182637426 22:31739668-31739690 AACCATGTAATATTTTAGGCAGG - Intronic
1182679172 22:32064902-32064924 GACACTGGAGGATTTTAAGCAGG - Intronic
1182781718 22:32873709-32873731 TACACTGAAGTAATATAAGCTGG + Intronic
1183591544 22:38782000-38782022 AACACTGAAGGGTTTTAAGCAGG - Intronic
1183766041 22:39875827-39875849 AACCCAGAAGGAAATTAAGCAGG + Intronic
949251763 3:1993569-1993591 AACCCTGCAGACTTTAAAGCGGG + Intergenic
950983418 3:17333182-17333204 AACCCTAAAGTTTTTTTAACTGG - Intronic
951013951 3:17708795-17708817 AACCCAGAGGTATTATATGCTGG - Intronic
953034931 3:39203208-39203230 CATCCTGAAGGATTTTAATCAGG + Intergenic
953173309 3:40526725-40526747 GGCACTGAAGAATTTTAAGCAGG + Intronic
954444719 3:50540527-50540549 AACCCTGATGTGTTAGAAGCTGG + Intergenic
954996800 3:54889246-54889268 ATCACTGAAGGATTTTAAGAAGG + Intronic
955029135 3:55199565-55199587 ACCACTGAAGTGTTTTAAGTAGG + Intergenic
955806566 3:62741886-62741908 AGCCCAGAAGTTTCTTAAGCTGG + Intronic
955835180 3:63046859-63046881 AACCAAGAAGGACTTTAAGCAGG + Intergenic
956881973 3:73520055-73520077 AACACAGAAGAGTTTTAAGCAGG + Intronic
957001015 3:74884876-74884898 AACCCCTCAGTATTTTAACCAGG - Intergenic
958830344 3:99079742-99079764 AACACTGAAGAGTTTAAAGCAGG + Intergenic
959622514 3:108413505-108413527 AACCTTGAATGATTATAAGCTGG + Intronic
961629354 3:128284944-128284966 GCCACTGAAGGATTTTAAGCAGG + Intronic
961891872 3:130137272-130137294 TATCCTGAAGTATTTTAGGTAGG + Intergenic
962023674 3:131526260-131526282 ACCACTAAAGTATTTTAGGCAGG + Intergenic
962049023 3:131793330-131793352 AACCACAAAGAATTTTAAGCAGG - Intronic
962580183 3:136791050-136791072 ACCCCTGAGAGATTTTAAGCTGG - Intergenic
963443136 3:145366929-145366951 AGCCCTGCAGTATTTTGAGAGGG - Intergenic
964729381 3:159848832-159848854 AACTCTCAGATATTTTAAGCTGG + Intronic
964847804 3:161062600-161062622 ATCACTGAAGGGTTTTAAGCAGG - Intronic
964870968 3:161313447-161313469 GACCCTGAAGAATCTTAAGCTGG - Intergenic
965096748 3:164238880-164238902 AACACTGAAATGTTTTAAGTAGG + Intergenic
966032926 3:175372782-175372804 AACCTTGCAGTATTTTAGGATGG + Intronic
966417525 3:179704897-179704919 AACCTTGGAGAGTTTTAAGCTGG + Intronic
967245504 3:187482691-187482713 GTCACTGGAGTATTTTAAGCAGG - Intergenic
967543713 3:190698765-190698787 AACACTACAGTGTTTTAAGCAGG + Intergenic
967552413 3:190812013-190812035 AACCCTGTACTTTTGTAAGCCGG - Intergenic
968027068 3:195451380-195451402 ACCCTTGAAGAATCTTAAGCAGG - Intergenic
969234867 4:5858701-5858723 AATGTTGAGGTATTTTAAGCAGG - Intronic
970638406 4:18036102-18036124 ATCACTGACATATTTTAAGCAGG + Intergenic
971963115 4:33515413-33515435 AACACTGAAGGATTTTAAACAGG + Intergenic
972825024 4:42748404-42748426 AACCCTGAAGGATTTCGGGCAGG - Intergenic
974276649 4:59728982-59729004 ACCACTGAAGTATTTCAAGCAGG - Intergenic
975148560 4:70995818-70995840 ATCAGTGAAGAATTTTAAGCAGG - Intronic
975260867 4:72297065-72297087 AAGACTGAAGGATTTTAATCTGG + Intronic
975867153 4:78735936-78735958 AACACTGAAGCATTTCAAACAGG - Intergenic
975877693 4:78863544-78863566 AACATTGAAGGATTTTAAGCAGG + Intronic
976122115 4:81794850-81794872 TTCACTGAAGAATTTTAAGCAGG - Intronic
976779190 4:88739396-88739418 AACCTTGAGGAGTTTTAAGCAGG - Intronic
977130743 4:93233643-93233665 GACACTGAGGTATTTTAAACAGG + Intronic
977132921 4:93265950-93265972 AACCCTGAACTAGAATAAGCTGG - Intronic
979203768 4:118010136-118010158 AACACTGAAGGTTTTTGAGCAGG + Intergenic
980170014 4:129277741-129277763 AATGCTGAAGAATGTTAAGCAGG - Intergenic
981030238 4:140118140-140118162 AACCCACAAATATTTTAACCTGG - Intronic
981056172 4:140364267-140364289 AAACCTGAAGAATTTAATGCTGG + Intronic
981769291 4:148288842-148288864 AGCCTGGAAGTATATTAAGCAGG - Intronic
982987227 4:162225727-162225749 AACCCTGAAACACTTTAAGGGGG - Intergenic
983304525 4:165968965-165968987 AACCTGGAAGTGTTTTGAGCTGG + Intronic
983414011 4:167432822-167432844 AATCTTGAAGTATATTAAGATGG + Intergenic
983579603 4:169294177-169294199 ATCCCTGACATATTTTAGGCTGG - Intergenic
983875776 4:172873045-172873067 ACCACTGAAGAATTTTAATCAGG - Intronic
984187030 4:176557281-176557303 AATCCTGTAGTACTTTAATCTGG - Intergenic
984468820 4:180138564-180138586 AGGCCAGATGTATTTTAAGCTGG - Intergenic
985000727 4:185479907-185479929 AGCCCAGAAGTATTTTAGTCTGG - Intergenic
987943126 5:24568287-24568309 AAAACTAAAGAATTTTAAGCAGG + Intronic
988619521 5:32808878-32808900 AAACCTGAAGTATTTTAGTGAGG + Intergenic
989774035 5:45181309-45181331 AGCCCTGAAGTATGTGAAGTGGG - Intergenic
990474091 5:56144633-56144655 GACAATGAAGGATTTTAAGCAGG + Intronic
991406249 5:66303534-66303556 AACCCTGAAGTGGTATAAGTGGG + Intergenic
992472138 5:77068574-77068596 TCCACTGAAGGATTTTAAGCAGG + Intergenic
993628647 5:90257150-90257172 ATCACTGAAGAATCTTAAGCAGG + Intergenic
995260170 5:110094610-110094632 CACCTTGAAAGATTTTAAGCAGG - Intergenic
996084253 5:119287892-119287914 AACCCTGAGGAATTTTTAGGAGG + Intronic
996307994 5:122072828-122072850 CACTCTGAAATATTTGAAGCTGG - Intronic
996783812 5:127216559-127216581 AATCCTGAATTTTTTAAAGCAGG - Intergenic
997511490 5:134457852-134457874 CACCCTGAAGGGTTTTCAGCAGG + Intergenic
997709927 5:135995773-135995795 GACACTGAAGGATTTTAACCAGG + Intergenic
997865961 5:137463060-137463082 ATCACTGAAGCATGTTAAGCAGG + Intronic
998254319 5:140573158-140573180 GCCACAGAAGTATTTTAAGCAGG - Intronic
998365332 5:141626999-141627021 ACCATTGAAGGATTTTAAGCAGG - Intronic
998916421 5:147016976-147016998 AAACATGAAGTATTTTAAATGGG + Intronic
999084988 5:148880041-148880063 ATCACTAAAGTGTTTTAAGCAGG + Intergenic
999874232 5:155784456-155784478 GTCCCTGAGATATTTTAAGCAGG + Intergenic
999891518 5:155983083-155983105 AAGCTTGAATTATTTTAAGATGG - Intronic
999940854 5:156541271-156541293 AAGTCTGAGGAATTTTAAGCTGG + Intronic
1000323048 5:160150168-160150190 TTCCCTGAATTATTTTAATCAGG + Intergenic
1000428208 5:161117196-161117218 ATCACTGAAGGATTTTATGCAGG - Intergenic
1001503815 5:172260436-172260458 AATCCTTAAGCATTTTAAGAAGG - Intronic
1005000545 6:21235857-21235879 AACTGTGAACTATTTTGAGCTGG - Intergenic
1005314136 6:24587926-24587948 ATCCCTGAATGGTTTTAAGCAGG - Intronic
1006287585 6:33108760-33108782 ATCATTGAAGGATTTTAAGCAGG + Intergenic
1008040055 6:46788074-46788096 GATCCTAAAGTATTTTAAGAAGG - Intergenic
1008735736 6:54541676-54541698 ACCACTGAAGAATTTTAAGTTGG + Intergenic
1009351890 6:62690767-62690789 AAAAATGAAGTATTTTAAGAAGG + Intergenic
1010743287 6:79532402-79532424 ACCATTGAAGTATATTAAGCAGG - Intronic
1011887498 6:92115146-92115168 ACTCTTGAAGAATTTTAAGCTGG - Intergenic
1012464393 6:99501321-99501343 ATTACTAAAGTATTTTAAGCAGG - Intronic
1012558840 6:100553104-100553126 GTCCCTCAAGTATTTTATGCTGG + Intronic
1015086320 6:129296802-129296824 AACCCTGAAGTATTTTAAGCAGG + Intronic
1015217700 6:130768901-130768923 GCCACTGAAGTATTTTGAGCAGG - Intergenic
1015536708 6:134273957-134273979 CTCACTGAAGTATTTTAAGCAGG + Intronic
1016318547 6:142817262-142817284 AACCATAGAGTATTCTAAGCTGG - Intronic
1019400434 7:849250-849272 AACCCAGAACTATTTTAAGCAGG + Intronic
1022138011 7:27467324-27467346 AATCATGAAGCCTTTTAAGCTGG + Intergenic
1022387756 7:29917492-29917514 CCCCCTGTAGTATTTTAAGGTGG + Intergenic
1022394097 7:29970166-29970188 ACTGCTGAAGTATTTTAAGCAGG - Intronic
1028415884 7:90580258-90580280 ACCCATGGAGGATTTTAAGCAGG - Intronic
1030448124 7:109673076-109673098 CCCCATGAAGTATTTTAAGATGG - Intergenic
1031047239 7:116905327-116905349 ATCTCTGAAGGATTTCAAGCAGG - Intronic
1031203341 7:118720444-118720466 AATACTGAAGTATTTTCAACAGG - Intergenic
1032426814 7:131829388-131829410 AACCCAGAGGTATTTTAAGGAGG - Intergenic
1032577531 7:133071471-133071493 ACTACTGAAGGATTTTAAGCAGG + Intronic
1032948179 7:136875658-136875680 AACACTGAAGAATTTTAAACAGG - Intronic
1034380263 7:150686231-150686253 AACCGTGCAGTCCTTTAAGCTGG - Intronic
1035874317 8:3170963-3170985 ACCACTGAAGGATTTTTAGCCGG + Intronic
1036777142 8:11621201-11621223 AGCCCTGAAGTGTTTTCATCAGG - Intergenic
1038444786 8:27595828-27595850 AACCCTGAAGTCCCTTCAGCAGG + Intergenic
1040864976 8:52039597-52039619 ACCTTTGAAGAATTTTAAGCAGG - Intergenic
1041507935 8:58622173-58622195 AATCTTGAAGAATTTTAAACGGG + Intronic
1042807683 8:72789663-72789685 GACCCTGGAGTTTTTTGAGCAGG + Intronic
1042901026 8:73727702-73727724 TACCCTGAAGAATTGAAAGCAGG - Intronic
1043116810 8:76266339-76266361 CACTCTGAAATATTTTAATCTGG + Intergenic
1044319433 8:90785923-90785945 GCCTCTGAAGGATTTTAAGCAGG + Intronic
1044422821 8:92017747-92017769 AAACCTGAAGTCTGTTATGCAGG + Intronic
1044951079 8:97435994-97436016 TCCTTTGAAGTATTTTAAGCAGG - Intergenic
1045898749 8:107248879-107248901 AACACTGAAGTGTTTTGAGCAGG + Intergenic
1046287174 8:112109259-112109281 AGCCCTGGAGAGTTTTAAGCAGG + Intergenic
1046350320 8:113001253-113001275 GACACAGAAGAATTTTAAGCAGG - Intronic
1047394624 8:124484320-124484342 GCCGCTGAAGTATTTTGAGCAGG + Intronic
1047978799 8:130158698-130158720 GCCGCTGGAGTATTTTAAGCAGG + Intronic
1048258324 8:132923198-132923220 AACACTGAAGAGTTTTAAGCTGG + Intronic
1049075693 8:140394586-140394608 ATCCCTGAAGGAATCTAAGCTGG - Intronic
1049894671 9:102124-102146 AACCCTGAAGCATTCGAAGCAGG - Intergenic
1051635629 9:19178568-19178590 ACCCCTGAAGTATTTTTAATTGG + Intergenic
1053735878 9:41102114-41102136 AACCCTGAAGCATTCGAAGCAGG - Intergenic
1054692495 9:68329284-68329306 AACCCTGAAGCATTCGAAGCAGG + Intronic
1055518404 9:77056226-77056248 AACACTGAATTATTTTAGGAGGG - Intergenic
1056380797 9:86055442-86055464 AACCCAGAAGCATTTAAAGCAGG + Intronic
1059538255 9:115104437-115104459 GACCCTGAAAAATTTTAAGAAGG + Intronic
1060038344 9:120278359-120278381 AAGCTAGAAGGATTTTAAGCAGG + Intergenic
1060251263 9:121988333-121988355 GTCCCTGGAGAATTTTAAGCAGG - Intronic
1187509676 X:19906451-19906473 AATCCTGAACTATTTTTAGTAGG + Intergenic
1187546869 X:20263902-20263924 AATCCTGAAATCTTTTAACCTGG + Intronic
1188837108 X:34971651-34971673 AGCCCTGTAGTAATTTAAACTGG + Intergenic
1189565029 X:42232864-42232886 AACCCTGAAGTACCAAAAGCGGG - Intergenic
1189817119 X:44835112-44835134 AACACACAAGTATTTTATGCAGG - Intergenic
1190433125 X:50396937-50396959 AACTCTGAAGTACTCAAAGCTGG + Intronic
1192285290 X:69728605-69728627 AATAATGAAGCATTTTAAGCAGG + Intronic
1192487424 X:71541118-71541140 AACCCTGAGTTGTTTTAAACAGG + Intronic
1193929035 X:87529292-87529314 AGCCCTGGAGTATTTTGAGTTGG - Intronic
1195134727 X:101893750-101893772 AACCCTGAAGTAATTGAATGAGG + Intronic
1196059335 X:111390695-111390717 CCCACTGAAGGATTTTAAGCAGG - Intronic
1196970788 X:121106292-121106314 AACACTGAAGTAGTTTAATGTGG + Intergenic
1197208566 X:123810916-123810938 GACCTTGAAGTTTTTTAATCAGG + Intergenic
1197330560 X:125148997-125149019 ACCACTGAAGTGTTTTAAGCAGG - Intergenic
1198188067 X:134273822-134273844 AACCCAGAAATATTGTAACCAGG + Intergenic
1202349798 Y:23976158-23976180 AACACTGACGTGTTTTCAGCTGG - Intergenic
1202520981 Y:25693961-25693983 AACACTGACGTGTTTTCAGCTGG + Intergenic