ID: 1015091535

View in Genome Browser
Species Human (GRCh38)
Location 6:129364675-129364697
Sequence CAAATTTGGTGGTAGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015091535_1015091541 -4 Left 1015091535 6:129364675-129364697 CCTGGCCCCTACCACCAAATTTG 0: 1
1: 1
2: 2
3: 15
4: 318
Right 1015091541 6:129364694-129364716 TTTGAATAGCACCTCTTTGATGG 0: 1
1: 0
2: 1
3: 23
4: 498
1015091535_1015091543 11 Left 1015091535 6:129364675-129364697 CCTGGCCCCTACCACCAAATTTG 0: 1
1: 1
2: 2
3: 15
4: 318
Right 1015091543 6:129364709-129364731 TTTGATGGCCAAAAATATTATGG 0: 1
1: 0
2: 3
3: 28
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015091535 Original CRISPR CAAATTTGGTGGTAGGGGCC AGG (reversed) Intronic
900097123 1:944370-944392 CAGAGGTGGTGGAAGGGGCCAGG + Exonic
900708102 1:4093333-4093355 CACATGTTGTGGGAGGGGCCCGG - Intergenic
901042930 1:6376431-6376453 AAAATAAGGTGGGAGGGGCCAGG + Intronic
901556884 1:10038799-10038821 AAAATTTGGGAGTTGGGGCCGGG + Intronic
903866738 1:26404409-26404431 CAAATTAGGAGGCTGGGGCCGGG + Intergenic
904736226 1:32636195-32636217 CAATTTGGCTGGTAGGGGCTTGG - Intronic
905461027 1:38123138-38123160 TAAATTTGTTGCTATGGGCCTGG - Intergenic
905996543 1:42386259-42386281 CAAATTTGGTGGAAGTGTTCTGG - Intronic
907201330 1:52729157-52729179 CACACATGGTGGCAGGGGCCAGG + Intronic
908176918 1:61565196-61565218 CAATGTTGGTGGTAAGGCCCTGG - Intergenic
908727405 1:67191574-67191596 GAAATTGGGTGGTAGAGGTCAGG - Intronic
910964716 1:92796798-92796820 CAAAGTAGGTGGTGGGGGCTGGG + Intergenic
911628149 1:100150830-100150852 CAAATTTACTGCTAAGGGCCAGG + Intronic
914675829 1:149906607-149906629 CAGATCTGATAGTAGGGGCCAGG - Intronic
914840650 1:151245829-151245851 AAAATTTGGGGGTGGTGGCCTGG - Intronic
917412688 1:174776072-174776094 TAAAGTTGGTGTTAGAGGCCAGG + Intronic
917686885 1:177425295-177425317 CTAAATAGGAGGTAGGGGCCTGG - Intergenic
918119716 1:181528122-181528144 CACATGTTGTGGGAGGGGCCCGG + Intronic
919795464 1:201318980-201319002 CAAAGGGGGTGGTAGGGTCCTGG - Intronic
920128388 1:203712037-203712059 CACATTTGGTGGCAATGGCCCGG - Exonic
922338282 1:224635280-224635302 CAAGTGTCGTGGGAGGGGCCTGG - Intronic
923795342 1:237148928-237148950 CAAAATTTGGGGTAGGGGGCTGG - Intronic
1063856101 10:10255740-10255762 CACATGTGGTGGGAGGGACCTGG - Intergenic
1063857482 10:10271615-10271637 CAAATGTTGTGGGAGGGACCTGG - Intergenic
1063894977 10:10670499-10670521 CAAATGTGGGGGCAGGGGGCAGG - Intergenic
1065177482 10:23093810-23093832 AAAAATTGGTGCTAGGAGCCAGG + Intergenic
1065641456 10:27786727-27786749 AAAATTAGGTGGTGGTGGCCGGG - Intergenic
1066066855 10:31767763-31767785 CAAATTTTCTGCTATGGGCCAGG - Intergenic
1067278076 10:44851942-44851964 CAAGGTGGATGGTAGGGGCCTGG + Intergenic
1067412187 10:46074765-46074787 GTAATGTGGTGGTAGGGGCTGGG + Intergenic
1067628768 10:47944541-47944563 CACATGTCGTGGGAGGGGCCTGG + Intergenic
1068473523 10:57495669-57495691 CACATGTGGTGGAAGGGGCTCGG - Intergenic
1068487383 10:57677619-57677641 CATATGTGGTGGGAGGGACCTGG - Intergenic
1068700558 10:60015222-60015244 CAAAATGGGTGGTTGCGGCCAGG - Intergenic
1069215817 10:65818906-65818928 CAAATTTGGTGGTGGGGGCGGGG - Intergenic
1071462058 10:85907405-85907427 CAAATTTATAGGTATGGGCCAGG - Intronic
1071549936 10:86559168-86559190 CATATGTGGTGGGAGGGACCAGG - Intergenic
1073089015 10:100917716-100917738 CAAATATGGTGGCAGGTACCTGG - Intronic
1077377578 11:2212381-2212403 CACATTCGGTGGAAGAGGCCGGG + Intergenic
1077942019 11:6852796-6852818 CATATCTTGTGGTAGGGGCATGG + Intergenic
1078231819 11:9450645-9450667 AAAAATTGGTGGTATTGGCCAGG + Intergenic
1078650865 11:13191004-13191026 CAACGTTGGAGGTGGGGGCCTGG - Intergenic
1079539809 11:21559651-21559673 CAACTTTGGTGGTAGGATCTAGG + Intronic
1079899075 11:26158713-26158735 CAAATTTGGTCCTAGGGATCCGG + Intergenic
1080019331 11:27543705-27543727 CACGTCTGGTGGGAGGGGCCCGG - Intergenic
1080226899 11:29972213-29972235 TAAATTTGTTGGCAGGGGTCAGG - Intergenic
1081080348 11:38732885-38732907 CACATATGGTGGGAGGGGCCTGG - Intergenic
1082275045 11:50212317-50212339 CACATGTTGTGGGAGGGGCCTGG - Intergenic
1084016949 11:66389378-66389400 CAAAGATGGTAGGAGGGGCCGGG + Intergenic
1085529612 11:77183697-77183719 CAAATGTGGGGATGGGGGCCTGG - Intronic
1085719079 11:78897415-78897437 CAAACCTGGGGGTGGGGGCCTGG + Intronic
1086197854 11:84162971-84162993 CAAATATGCTGGTAGGGTCCTGG - Intronic
1086819229 11:91414224-91414246 CATATGTCGTGGGAGGGGCCAGG - Intergenic
1088321351 11:108557485-108557507 CAGATGTGGTGGCAGGCGCCTGG - Intronic
1089093984 11:115902873-115902895 CAAATTTGGTGGAAGAAGGCTGG - Intergenic
1090472449 11:126992129-126992151 CAAATTTTCTTGTAGGTGCCTGG - Intronic
1092613121 12:10192318-10192340 CAAATAAGGTGGTAGGGGCTAGG - Intergenic
1092724623 12:11473337-11473359 CACATGTTGTGGGAGGGGCCCGG + Intronic
1094489686 12:30951806-30951828 CAAATATGGTGTTAGGGGAAAGG + Intronic
1094707465 12:32928244-32928266 GAAATTTAGAGGTGGGGGCCGGG + Intergenic
1095382775 12:41615398-41615420 AAAATATGGTTGTATGGGCCGGG + Intergenic
1095516730 12:43014702-43014724 CTAATTTTGGGGGAGGGGCCTGG + Intergenic
1096804853 12:54134361-54134383 CAACTTGGGAGGTAGTGGCCAGG + Intergenic
1096992256 12:55814572-55814594 CAAATGTGTTAGTATGGGCCAGG + Intronic
1099184283 12:79500552-79500574 GAAATGTGATGTTAGGGGCCAGG - Intergenic
1100038578 12:90282678-90282700 CACATGTGGTGGGAGGGACCTGG + Intergenic
1100375946 12:94016398-94016420 CACATGTCGGGGTAGGGGCCTGG + Intergenic
1100446753 12:94668210-94668232 AAAATTTGATGGAAGAGGCCAGG + Intergenic
1101564865 12:105895658-105895680 CACATGTTGTGGGAGGGGCCTGG - Intergenic
1101761035 12:107659356-107659378 CACATTGGATGGTAGGGGCTGGG - Exonic
1104123871 12:125825246-125825268 AAAATTTGGGGGTAGGGGAGGGG + Intergenic
1104140082 12:125979510-125979532 CACATGTTGTGGGAGGGGCCTGG - Intergenic
1104572057 12:129934167-129934189 CAAATGTTGTGGGAGGGACCTGG + Intergenic
1105681364 13:22731134-22731156 CAAATTTGGTGATAGTGTCTTGG - Intergenic
1107183074 13:37484898-37484920 CACATGTGGTGGGAGGGACCCGG - Intergenic
1108007179 13:45961056-45961078 CAAATCTGGTGATAGAGCCCAGG - Intronic
1108714735 13:53068046-53068068 CAAAATTGGTGGAGGGAGCCAGG + Intergenic
1109219531 13:59627295-59627317 GACATTTGGTGGTAGGGGTGGGG + Intergenic
1110552109 13:76821807-76821829 CACATGTTGTGGGAGGGGCCTGG - Intergenic
1110734450 13:78919553-78919575 CACATTTTGTGGGAGGGACCTGG + Intergenic
1111687375 13:91517943-91517965 CACATGTTGTGGGAGGGGCCCGG - Intronic
1111981388 13:95019334-95019356 AAACTCTGGTGGTGGGGGCCAGG - Intergenic
1113210265 13:107970232-107970254 GAGATTTGGAGGGAGGGGCCAGG + Intergenic
1114312039 14:21476753-21476775 CAAATTGGGTGGCGGGGGCGGGG - Exonic
1114780052 14:25529033-25529055 CACATGTTGTGGGAGGGGCCTGG - Intergenic
1115025138 14:28735591-28735613 AAAAATTTGTGTTAGGGGCCGGG - Intergenic
1115132547 14:30071693-30071715 CACATGTTGTGGTAGGGACCTGG + Intronic
1115779402 14:36752708-36752730 CACATGTTGTGGGAGGGGCCTGG + Intronic
1117873708 14:60227322-60227344 CAAAGTTGGTGGTTGTGTCCGGG - Intergenic
1119363831 14:74074270-74074292 AAAATTTAGTGAAAGGGGCCGGG - Intronic
1119971869 14:78979915-78979937 CACATGTTGTGGGAGGGGCCCGG - Intronic
1120151256 14:81036845-81036867 TAAATTTGGTGGGGGAGGCCAGG + Intronic
1120475704 14:84984259-84984281 CAAATGTTGTAGAAGGGGCCCGG - Intergenic
1122137816 14:99644961-99644983 CAAATTCGATGGGAGTGGCCCGG - Intergenic
1124368134 15:29088389-29088411 CAAGTTTAGTGGCAGGAGCCTGG - Intronic
1125438227 15:39671539-39671561 AAAATTTGGTGGTTGCGCCCAGG - Intronic
1125685202 15:41559557-41559579 GAAAGTTGGGGGTGGGGGCCCGG - Intronic
1126399707 15:48256818-48256840 GAAATTTGGGGGGGGGGGCCAGG - Intronic
1128499455 15:68217735-68217757 CAAGTTGGGTGGGAGGGGTCTGG + Intronic
1129912738 15:79241810-79241832 CAAAAATGGTAGCAGGGGCCAGG - Intergenic
1131712123 15:95067490-95067512 CACATGTGGTGGGAGGGACCTGG - Intergenic
1132011646 15:98281664-98281686 CAAATGTGGTGGCACGTGCCTGG + Intergenic
1134099088 16:11439083-11439105 CAAATTTGGTGGGGGGGACAGGG + Intronic
1134305512 16:13028601-13028623 CAAATGTTGTGGGAGGGACCCGG - Intronic
1135054071 16:19216037-19216059 CACATATAGTGGGAGGGGCCTGG - Intronic
1135103990 16:19631413-19631435 CAATTTTGGTGTTAGAGGCCAGG - Intronic
1135642207 16:24130459-24130481 CTATTTTGGGGGTGGGGGCCAGG - Intronic
1138163598 16:54778734-54778756 CAAACCTAGTGGTAAGGGCCTGG + Intergenic
1141947946 16:87323207-87323229 CACAGTTGGTGTTTGGGGCCGGG - Intronic
1142199991 16:88756456-88756478 CAAAACTGGTGGCTGGGGCCGGG + Intronic
1142593178 17:1016609-1016631 GAAATGTTGGGGTAGGGGCCAGG - Intronic
1143721075 17:8810320-8810342 CACATGTTGTGGGAGGGGCCTGG - Intronic
1144808372 17:17982508-17982530 CAAAATTGGTGCTGTGGGCCAGG - Intronic
1146526386 17:33570517-33570539 CAAATTTGGGGTAAGGGGACAGG - Intronic
1147343801 17:39773108-39773130 GAAAGTTGGTGGGAGAGGCCAGG - Intronic
1148749472 17:49936170-49936192 CAAGTTTGGGGCTAGGGGCAAGG - Intergenic
1148941814 17:51220995-51221017 CAAAGTTTGAGGTAGAGGCCAGG + Intronic
1150302982 17:64061721-64061743 CAGACTTGCTGGTAGGGCCCAGG + Intronic
1150739268 17:67766337-67766359 AAAAGTTGGTGGTATAGGCCGGG - Intergenic
1152559482 17:81070804-81070826 CAGATTTGGTGCCAGAGGCCCGG + Intronic
1152651486 17:81495810-81495832 AAAAGATGGTGGTAGGGGCTAGG + Intergenic
1153136767 18:1926423-1926445 CACATGTTGTGGGAGGGGCCTGG + Intergenic
1155374263 18:25138807-25138829 TCAATTTGGTGGCAGGAGCCTGG + Intronic
1155442752 18:25879309-25879331 CAAATTTGGTGAGAGTTGCCAGG - Intergenic
1156289010 18:35728992-35729014 CACATGTTGTGGGAGGGGCCCGG + Intergenic
1157474113 18:48010592-48010614 CACATGTTGTGGGAGGGGCCTGG - Intergenic
1158353860 18:56594328-56594350 CAGATGTGGTGGCAGGTGCCTGG + Intergenic
1158628960 18:59095634-59095656 CATATGTTGTGGGAGGGGCCTGG - Intergenic
1158831407 18:61283515-61283537 CCAATTTTGAGGAAGGGGCCTGG - Intergenic
1158875122 18:61726339-61726361 CACATGTTGTGGGAGGGGCCTGG - Intergenic
1161109375 19:2460797-2460819 AAAATTTTTTTGTAGGGGCCGGG - Intergenic
1162116707 19:8434377-8434399 AAAATATGCTGGTAGGGGCAGGG - Intronic
1162781082 19:13007272-13007294 GGAATTTGGGGGTGGGGGCCGGG + Intronic
1163325264 19:16599566-16599588 GATATTTGGTGGGAGAGGCCAGG + Intronic
1165119740 19:33551464-33551486 CTTATATGGTGGAAGGGGCCAGG + Intergenic
1166185556 19:41136703-41136725 AAGATTTGGTGGTGCGGGCCCGG - Intergenic
1166629379 19:44391667-44391689 CATATGTTGTGGGAGGGGCCTGG - Intronic
1167009429 19:46797012-46797034 TAAATTTTTTTGTAGGGGCCGGG + Intergenic
1168229828 19:55023379-55023401 CAATGTTGGAGGTGGGGGCCTGG + Intronic
1168372596 19:55848805-55848827 CACATGTGGTGGGAGGGACCCGG + Intronic
1168559816 19:57373430-57373452 AAAATTGGGTGGGGGGGGCCGGG - Intronic
1168615596 19:57834536-57834558 TAAATTTGGTGTTCTGGGCCGGG + Intronic
1168621188 19:57880911-57880933 TAAATTTGGTGTTCTGGGCCGGG - Intronic
925767684 2:7252702-7252724 CAGATTTGGTGGAATGTGCCTGG + Intergenic
925815044 2:7739224-7739246 CAAATGTTGAGGGAGGGGCCTGG + Intergenic
928001704 2:27528800-27528822 CCAATGTTGTGGGAGGGGCCGGG + Intergenic
929315974 2:40479065-40479087 AAAATTAGGTGGTTGAGGCCGGG - Intronic
931041283 2:58304120-58304142 CATATATGGTGGGAGGGACCTGG + Intergenic
932846818 2:75143821-75143843 GAAATGTGGTGCTAGTGGCCTGG + Intronic
934708309 2:96499871-96499893 CAAATTTGCTGGCAGGAGGCGGG + Intronic
934892302 2:98081198-98081220 CACATATTGTGGGAGGGGCCCGG - Intergenic
936115933 2:109703011-109703033 CAAATTTGGGGGTGGGGGCTAGG + Intergenic
936983764 2:118288778-118288800 AAAATATGTTGGTGGGGGCCAGG + Intergenic
937327282 2:120998149-120998171 CACATGTTGTGGTAGGGACCCGG + Intergenic
938303484 2:130231902-130231924 CAGAGGTGGTGGAAGGGGCCAGG - Intergenic
938453195 2:131442354-131442376 CAGAGGTGGTGGAAGGGGCCAGG + Intergenic
940664736 2:156594556-156594578 CAAACTTGGGGGTAGGAGACTGG - Intronic
941433559 2:165440122-165440144 CTACTTTGGAGGTAGGGCCCAGG + Intergenic
942078629 2:172380143-172380165 CACATGTGGTGGGAGGGACCTGG - Intergenic
942185436 2:173420830-173420852 CAAATGTTGTGGGAGGGACCTGG - Intergenic
942653566 2:178193689-178193711 CAAATTTGCTGGGAGGGACGGGG - Intergenic
943491443 2:188559796-188559818 CACATTTTGTGGAAGGGACCTGG + Intronic
944470191 2:200045102-200045124 CATATATTGTGGGAGGGGCCTGG - Intergenic
945053857 2:205850664-205850686 TGAGTTTGGTGGTAGGGGGCTGG + Intergenic
946222203 2:218237506-218237528 AAAAATTGGTGGTGGGGGGCAGG - Intronic
946316962 2:218922751-218922773 CACATGTGGGGGGAGGGGCCTGG - Intergenic
946958816 2:224961031-224961053 AGAATTTGGTGATGGGGGCCGGG - Intronic
947459590 2:230292293-230292315 CAAATTTGGAAGTAGAGGCCAGG - Intronic
947815820 2:233035343-233035365 CAAAGCTGGGGGTAGGGGACAGG - Intergenic
948638440 2:239356999-239357021 CAAGTTGGGTGGTAGTGGTCAGG - Intronic
1168985586 20:2045812-2045834 CAAATTGGGTAGTAGAGGCTAGG + Intergenic
1170373271 20:15672837-15672859 CACATGTCGTGGGAGGGGCCCGG + Intronic
1171089256 20:22268560-22268582 CACAGGTGGTGGTAGGGGCGGGG - Intergenic
1172041335 20:32048330-32048352 CAAAAGTGGTGCTAAGGGCCAGG - Intergenic
1172111114 20:32545575-32545597 GAAGTTTGGTGGTGGTGGCCAGG - Intronic
1172726942 20:37051474-37051496 CAAGATTGGTGGGAGAGGCCAGG - Intronic
1175100780 20:56577330-56577352 TAAATTTGGAGGTTGGGCCCTGG - Intergenic
1175296996 20:57915315-57915337 CAGATTTGGTGGGAGGGGGTTGG + Intergenic
1176026494 20:62988437-62988459 AAAATGTGGTGGAAGGGGCCGGG + Intergenic
1177515526 21:22147006-22147028 TAAAGTTGGAGGTGGGGGCCTGG + Intergenic
1177857274 21:26413723-26413745 CACATGTGGTGGGAGGGACCCGG + Intergenic
1178805377 21:35834771-35834793 CAAATGTGCTGGTGGGAGCCAGG + Intronic
1179469245 21:41599513-41599535 CACATGTTGTGGGAGGGGCCCGG + Intergenic
1182515260 22:30855060-30855082 CACATGTCGTGGGAGGGGCCAGG - Intronic
1182686113 22:32122602-32122624 CAATGTTGGTGGTGGGGGACGGG + Intergenic
1182725871 22:32445098-32445120 CAAATATTGTGGTAGGTGCTTGG - Intronic
950961616 3:17114116-17114138 CACATTTTGTGGGAGGGACCAGG - Intergenic
951177031 3:19614513-19614535 CACATGTGGTGGGAGGGACCCGG - Intergenic
951670034 3:25170876-25170898 CACATTTAGTGGTAGGGTCTTGG - Intergenic
952009508 3:28884343-28884365 CAAAGTGGCTTGTAGGGGCCAGG - Intergenic
952347616 3:32502902-32502924 CAAATTTGCTGAGAGGGGGCGGG - Exonic
952971736 3:38655273-38655295 CAGGTGTGGTGGTAGGTGCCTGG + Intergenic
954588819 3:51762538-51762560 CCAATTTGGGGGAAGGGGCACGG + Intergenic
956149580 3:66226382-66226404 CACATGTTGTGGGAGGGGCCTGG - Intronic
956379119 3:68647318-68647340 CAAGTGTGGTGGGAGGGACCCGG + Intergenic
956567194 3:70652228-70652250 CACATGTCGTGGGAGGGGCCCGG - Intergenic
956579105 3:70790864-70790886 CACATATTGTGGTAGGGACCCGG + Intergenic
956624751 3:71256329-71256351 TGAATTTGGTGGTGGGGGCGGGG + Intronic
957285139 3:78208077-78208099 GAAATTTGGTGGAAGGTGGCTGG - Intergenic
957625334 3:82647402-82647424 CACATGTTGTGGGAGGGGCCAGG + Intergenic
957736851 3:84214597-84214619 CACATGTTGTGGTAGGGACCTGG - Intergenic
957838420 3:85632091-85632113 CATGTGTGGTGGGAGGGGCCTGG + Intronic
958860370 3:99437950-99437972 CATGTGTGGTGGGAGGGGCCAGG + Intergenic
959937046 3:112040037-112040059 CAAATGTGGGGGTGGGGGCAGGG - Intronic
962026933 3:131557504-131557526 CAAATTTGGGGTTAGGGGCTGGG + Intronic
962680213 3:137791571-137791593 ATAATTTGGTGGTGGGGGCGGGG - Intergenic
962934610 3:140068219-140068241 GAAATTTGGTAGAAAGGGCCTGG + Intronic
964138585 3:153371710-153371732 CAAATTTGGTGGAGAGGGCTGGG - Intergenic
964505295 3:157392437-157392459 CACATGTGGTGGGAGGGACCCGG - Intronic
965331273 3:167377883-167377905 CACATGTGGTGGGAGGGCCCTGG + Intronic
966934273 3:184695460-184695482 AAAAGTTGGAGGAAGGGGCCAGG + Intergenic
967396426 3:189014573-189014595 CACATTTCATGGGAGGGGCCTGG + Intronic
967595638 3:191324435-191324457 CACATGTGGTGGGAGGGACCTGG + Intronic
967904518 3:194488884-194488906 TAAATTTTGTGGAAGGGGTCTGG - Intronic
967950378 3:194835822-194835844 AAGAGTTGGAGGTAGGGGCCGGG - Intergenic
970357548 4:15270518-15270540 CAAATATGGTGGAAGGGGAAAGG - Intergenic
970554407 4:17216569-17216591 CACATGTTGTGGGAGGGGCCTGG - Intergenic
972565351 4:40264506-40264528 ATAATTTGGTGGTATGGGCTCGG + Intergenic
973716037 4:53677214-53677236 CAATGTTGGAGGTGGGGGCCTGG + Intronic
973909409 4:55564381-55564403 CAAATTTGGTGTTGGGGCTCAGG + Intronic
974867217 4:67596107-67596129 CAAATGTTGAGGTAGGGACCTGG + Intronic
975190600 4:71456565-71456587 TAAATTTGGTGCTAAGGCCCAGG + Intronic
981989094 4:150894180-150894202 CAAATCTGGTGGTAGTGGTAGGG + Intronic
982577626 4:157135409-157135431 CACATGTGGTGGGAGGGACCTGG + Intronic
982609211 4:157552020-157552042 CACATGTGATGGTAGGGACCTGG + Intergenic
984228345 4:177063440-177063462 CACATTTTGTGGGAGGGACCTGG - Intergenic
985406189 4:189640474-189640496 CATATGTGGTGGGAGGGACCTGG - Intergenic
986399793 5:7369900-7369922 CTAATTTTGTGGTAGGATCCTGG + Intergenic
987422632 5:17738299-17738321 TATCTTTGGTGGTAGGGGTCGGG - Intergenic
987426080 5:17774335-17774357 CAGACATGGTGGTAGGTGCCTGG - Intergenic
988450113 5:31333653-31333675 CACATGTGGTGGGAGGGACCTGG + Intergenic
989494873 5:42100884-42100906 CACATGTGGTGGGAGGGACCTGG + Intergenic
990277412 5:54212761-54212783 CATGTTTGGTGGTAGGGGTGGGG + Intronic
990699077 5:58456128-58456150 CAACTGTGGTGGTAGGTGGCTGG + Exonic
990795343 5:59533745-59533767 GAAATTTTGGGGAAGGGGCCTGG + Intronic
992311354 5:75502863-75502885 CAAATTTTGTAGCAGGGGCTGGG + Intronic
992386725 5:76291690-76291712 ATAATTTGGTGGAAGGGGTCGGG + Intronic
992584333 5:78220060-78220082 AAAATTTGGTGGTGGGGGGCAGG + Intronic
994776526 5:104041718-104041740 CAAATGTTGTGGAAGGGACCTGG - Intergenic
995091863 5:108187580-108187602 CAAATATTGAGGAAGGGGCCAGG + Intronic
998304982 5:141066302-141066324 CAAGTTTTGTAGTAGTGGCCAGG - Intergenic
999136444 5:149323032-149323054 CAAATCTGGTGTTAGGGGCCTGG - Intronic
999181798 5:149675031-149675053 CAAATGGAGAGGTAGGGGCCAGG - Intergenic
999508330 5:152221607-152221629 CAAGTATGGTGTTAGGTGCCAGG - Intergenic
999750047 5:154621403-154621425 CACATGTTGTGGTAGGGACCCGG - Intergenic
999941135 5:156544468-156544490 CAAATTTGGTGGAGTGGGCTAGG - Intronic
1001708017 5:173756094-173756116 GAAGTTTGGTGGCAGGGGGCGGG - Intergenic
1002672355 5:180878389-180878411 CACATGTCGTGGTAGGGACCTGG - Intergenic
1003484288 6:6562552-6562574 CACATGTTGTGGGAGGGGCCTGG - Intergenic
1004409455 6:15367019-15367041 CAGATTTCCTGGAAGGGGCCTGG + Intronic
1004916896 6:20340672-20340694 CAAATCTGCCAGTAGGGGCCCGG + Intergenic
1005188946 6:23196203-23196225 CAAAGTTGAAGGTGGGGGCCTGG + Intergenic
1005410841 6:25544362-25544384 CAGAGTTGGTGGTTGGGGGCAGG + Intronic
1006142596 6:31939327-31939349 CAAATGTGGTGGCAGTGGCAGGG - Intronic
1006515317 6:34542180-34542202 CAGCTTTGGGGGCAGGGGCCGGG + Intronic
1011106637 6:83788932-83788954 CAAAATTAGAGGTAGGGGTCAGG - Intergenic
1012918460 6:105196415-105196437 CAAAATTTGTGATAGGGGCAGGG + Intergenic
1013708294 6:112865567-112865589 CAAATATGGAGGTAGGAGGCAGG - Intergenic
1014773761 6:125485826-125485848 CACATGTGGTGGGAGGGACCTGG - Intergenic
1014860315 6:126458471-126458493 CAGATGTGGTGGTAGAAGCCTGG - Intergenic
1015091535 6:129364675-129364697 CAAATTTGGTGGTAGGGGCCAGG - Intronic
1015879401 6:137856210-137856232 CACATTTTGTGGGAGGGACCCGG + Intergenic
1016127545 6:140424143-140424165 CACATGTGGTGGGAGGGACCTGG - Intergenic
1016568474 6:145485973-145485995 CACATGTGGTGGGAGGGACCTGG - Intergenic
1017126749 6:151071982-151072004 CAAATGTGGTGGTGGGTGCCTGG - Intronic
1018345898 6:162899209-162899231 ACAATTTGCTGGTAGTGGCCAGG + Intronic
1019716185 7:2540537-2540559 CAACTTTGGAGGAAGGGCCCAGG - Intronic
1021763341 7:23922626-23922648 CAAGTTTGGGGCTAGAGGCCTGG + Intergenic
1021857073 7:24867433-24867455 CACATTTTGTGGGAGGGACCTGG + Intronic
1021974425 7:25997876-25997898 CACATGTGGTGGGAGGGTCCCGG - Intergenic
1022349437 7:29553820-29553842 CACATGTGGTGGGAGGGACCTGG - Intergenic
1022410816 7:30136878-30136900 CAAATTTGGGGTTAGAGACCTGG + Intronic
1024617088 7:51125106-51125128 AAATTTTGGTGGGAGAGGCCAGG - Intronic
1026146305 7:67749675-67749697 CAATGTTGGAGGTTGGGGCCTGG - Intergenic
1026218694 7:68372673-68372695 CAAATTTGGACCTAGGGGCTGGG - Intergenic
1026224761 7:68430592-68430614 CACATGTGGTGGGAGGGACCTGG + Intergenic
1026421271 7:70239728-70239750 AAAATTAGGTTGCAGGGGCCGGG - Intronic
1026660585 7:72298697-72298719 CAAATGTTGTGGGAGGGGCCTGG + Intronic
1026925755 7:74192072-74192094 CAAATCTGTTGGTGGGGGCCGGG - Intronic
1027364844 7:77446754-77446776 CAAATTTGAAGGTAGGCTCCTGG + Intergenic
1027388555 7:77682375-77682397 CACATGTGGTGGGAGGGACCCGG + Intergenic
1027958668 7:84916091-84916113 AAAATTTGGGGGTTGGGACCGGG - Intergenic
1027972213 7:85099223-85099245 CAAATGTTGTGGGAGGGACCCGG + Intronic
1028562821 7:92194215-92194237 GAAATTTGGTGGTAGGGGAGAGG - Intergenic
1028824836 7:95259607-95259629 CAGATATGGTGGTAGGGGTCTGG - Intronic
1028922957 7:96327050-96327072 CACATGTTGTGGTAGGGACCTGG - Intergenic
1029451866 7:100646064-100646086 CAAATCGGGGGGCAGGGGCCCGG - Intronic
1030594561 7:111521995-111522017 ACAATTTGGTGGTAGGAGCAGGG + Intronic
1033130922 7:138744842-138744864 CAGATGTGGTGGCAGGTGCCTGG - Intronic
1033471497 7:141653584-141653606 CAAATTTGGGGATGGGGCCCAGG + Exonic
1033487545 7:141805749-141805771 CACATGTGGTGGGAGGGACCAGG + Intergenic
1034045971 7:147927974-147927996 CACATGTGGTGGGAGGGACCTGG + Intronic
1034321778 7:150191002-150191024 CAAGTGTGGTGGGAGGGACCTGG - Intergenic
1034627283 7:152503407-152503429 CAGATTGGGTGGTAGGCTCCTGG - Intergenic
1035020813 7:155799111-155799133 CAAGCTTGGCGGTAGGGGCTGGG - Intergenic
1036729209 8:11247124-11247146 CAAATTGGGTGTTTGGGGCAGGG - Intergenic
1041350478 8:56943282-56943304 CATATGTGGTGGGAGGGACCTGG - Intergenic
1043345948 8:79297562-79297584 CACATGTGGTGGGAGGGACCCGG + Intergenic
1043558920 8:81467821-81467843 TAAATTTGGGTTTAGGGGCCGGG + Intergenic
1044092725 8:88022330-88022352 CACATGTGGTGGGAGGGACCTGG + Intergenic
1044861689 8:96530011-96530033 CAGATTTAGTGGCAGGGGCGGGG + Intronic
1045922556 8:107548176-107548198 CACATATCGTGGGAGGGGCCCGG - Intergenic
1046231661 8:111365674-111365696 CAAATGTTGTGGGAGGGACCCGG - Intergenic
1046583245 8:116119633-116119655 GATATTTGGTGGCAGGGGCTTGG - Intergenic
1047308518 8:123673037-123673059 CAAGTGTTGTGGGAGGGGCCCGG - Intergenic
1047865748 8:129022626-129022648 CACATGTTGTGGGAGGGGCCTGG + Intergenic
1048241182 8:132743069-132743091 CACATGTTGTGGGAGGGGCCTGG - Intronic
1048331182 8:133471778-133471800 CAGAGTTGGTGCTAGGCGCCGGG + Intronic
1048372965 8:133795684-133795706 CACATATGGAGGGAGGGGCCTGG + Intergenic
1049614930 8:143571961-143571983 CCAAGGTGGTGGGAGGGGCCTGG - Intronic
1050008483 9:1160116-1160138 CTAATTTGGTGGGAAGGGGCTGG - Intergenic
1051326801 9:15980804-15980826 CAAATTGGGTGGGCGGGGCAGGG - Intronic
1051383104 9:16478954-16478976 AAAACTTGGTGGTTGGGGCTGGG + Intronic
1052271701 9:26634388-26634410 CAAATGTTGTGGGAGGGACCCGG - Intergenic
1052904810 9:33824339-33824361 CAAATTAGCTGGTGTGGGCCGGG + Intronic
1055489697 9:76792142-76792164 CATGTGTGGTGGGAGGGGCCTGG + Intronic
1057798433 9:98174564-98174586 CAAGTGTGGAGGGAGGGGCCTGG + Intronic
1059082469 9:111265223-111265245 CACATGTTGTGGTAGGGACCTGG - Intergenic
1059686240 9:116639505-116639527 CAACAGTGGTGGTAAGGGCCTGG - Intronic
1060266974 9:122117517-122117539 CACATGTTGTGGGAGGGGCCCGG - Intergenic
1061099800 9:128484100-128484122 CCAATTTGATGGTAGCGGCCTGG + Intronic
1061168213 9:128936817-128936839 AAAATTTGGTGGTAGGGGCCGGG + Intronic
1061168292 9:128937279-128937301 AAAATTTGGTGGTAGGAGGGAGG + Intronic
1202630123 M:9521-9543 CTAATTGGGGGGTAGGGGCTAGG - Intergenic
1188083900 X:25880136-25880158 CACATATTGTGGTAGGGACCCGG + Intergenic
1188502265 X:30840546-30840568 CACATATTGTGGGAGGGGCCTGG + Intronic
1188510293 X:30928496-30928518 CACATGTGGTGGGAGGGACCCGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1191126660 X:56963017-56963039 CATATATTGTGGTAGGGACCCGG - Intergenic
1192178160 X:68898815-68898837 CACATCTGGGGGTGGGGGCCTGG - Intergenic
1192842063 X:74866633-74866655 CATATGTGGTGGGAGGGACCTGG + Intronic
1193675588 X:84448123-84448145 CAAATGTGGTGGATGGGGCGGGG - Intronic
1193919838 X:87411224-87411246 CAATGTTGGGGGTAGGGACCTGG - Intergenic
1197015463 X:121620809-121620831 CCACGTTGGTGGGAGGGGCCAGG - Intergenic
1197333239 X:125180169-125180191 CTAATTTGGGGGGTGGGGCCGGG - Intergenic
1198996225 X:142577240-142577262 CACATGTGGTGGGAGGGACCTGG + Intergenic
1199273175 X:145909720-145909742 CCAATGTTGTGGGAGGGGCCTGG + Intergenic