ID: 1015092620

View in Genome Browser
Species Human (GRCh38)
Location 6:129376590-129376612
Sequence CAGTATGGCTGGAGTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 582}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015092620 Original CRISPR CAGTATGGCTGGAGTGCAGA TGG (reversed) Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901316315 1:8311948-8311970 CACTATGGATGGTGTGAAGAGGG + Intergenic
901379268 1:8862217-8862239 CACTCAGGCTGGAGTGCAGTGGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901854063 1:12032855-12032877 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
901886717 1:12228831-12228853 CACTCTGTCTGGAGTGCAGAGGG + Intergenic
902205535 1:14865633-14865655 CAGGATGGCTGGAGAGCAAGGGG - Intronic
902351777 1:15861171-15861193 CACCTAGGCTGGAGTGCAGATGG + Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903505159 1:23828785-23828807 GAGGATGGCTTGAGTGCAGGAGG - Intronic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
903997659 1:27317770-27317792 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
904439179 1:30518628-30518650 CAGCATGGATGGAGCCCAGATGG + Intergenic
904447628 1:30587670-30587692 TACTATGACTGGAGAGCAGAGGG - Intergenic
904552237 1:31328666-31328688 GGGTATGGCTGGAGTGGAGTGGG + Intronic
905576762 1:39050650-39050672 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
907275606 1:53315111-53315133 CAGGAGGGGTGGGGTGCAGAAGG - Intronic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907867416 1:58411683-58411705 CAGCATAGCTGGAGTAGAGAGGG + Intronic
908266173 1:62381419-62381441 CACCCTGGCTGGAGTGCAGCGGG - Intergenic
908543445 1:65143051-65143073 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
908992284 1:70106713-70106735 TGCTATGGCTGGAGTGCTGATGG - Intronic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909673157 1:78211503-78211525 CAGTCTGTTTGGAGTCCAGAGGG + Intergenic
912049476 1:105507726-105507748 AAGTATGAGTGGAGTACAGATGG - Intergenic
913077348 1:115352253-115352275 CAGCATGCCTGGAGTGTTGAAGG - Intergenic
913106018 1:115614821-115614843 GAGGATGGCTTGAGTCCAGAAGG - Intergenic
913435342 1:118841715-118841737 CAGTGTGGCTGGTGTGCATGAGG - Intergenic
914225811 1:145718797-145718819 CACCAAGGCTGGAGTGCAGTGGG - Intergenic
914243046 1:145865255-145865277 CACTCAGGCTGGAGTGCAGTAGG - Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916826668 1:168448464-168448486 CAGTATGGATAGAGTGGAGAGGG - Intergenic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
918180388 1:182081920-182081942 CAGGATGGCTGGAATGTAGCAGG + Intergenic
918319974 1:183355067-183355089 CAGCATGGCTACAGTGCAGTGGG - Intronic
918445811 1:184615701-184615723 CAGTAGGGCCAGTGTGCAGATGG + Intronic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
918514154 1:185343970-185343992 CACCAAGGCTGGAGTGCAGTAGG - Intergenic
920202624 1:204269043-204269065 GAGCATCGCTGGAGTGCAGGTGG - Intronic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
921383033 1:214544387-214544409 CACCAAGGCTGGAGTGCAGTGGG - Intronic
921678168 1:218000536-218000558 AAATTTGGCTGGAGAGCAGAAGG - Intergenic
921824336 1:219655288-219655310 CAACACAGCTGGAGTGCAGAAGG + Intergenic
922592836 1:226791463-226791485 CATTATGTCTGCAGTCCAGAAGG + Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
924031163 1:239887240-239887262 CACTCAGGCTGGAGTGCAGTGGG + Intronic
924162781 1:241251439-241251461 AAGTTTGCCTGGAGTGAAGAAGG + Intronic
924449560 1:244165300-244165322 CAGTATGACTGTAGTGCAGAGGG + Intergenic
924463634 1:244281516-244281538 CAGGATGGGTGGAGTGCAGTGGG - Intergenic
924832608 1:247614153-247614175 GTGTTTGGCTGGAGTGGAGAAGG - Intergenic
1062951307 10:1505796-1505818 GAAGATGTCTGGAGTGCAGACGG - Intronic
1064919598 10:20502276-20502298 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067725681 10:48768963-48768985 CACTACGGCTGCAGTACAGAGGG + Intronic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070776341 10:79112047-79112069 TGGTGTGGCTGGAGTGTAGAGGG + Intronic
1071373983 10:84983713-84983735 CACCCAGGCTGGAGTGCAGAGGG - Intergenic
1071548558 10:86547759-86547781 CAGGATGGCTTGAGCCCAGAAGG + Intergenic
1071896296 10:90071079-90071101 CATTCAGGCTGGAGTGCAGCTGG + Intergenic
1072050864 10:91701667-91701689 GAGCATGGCTGGAGGGCAGGTGG + Intergenic
1072120800 10:92403997-92404019 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1072526911 10:96280059-96280081 CACTCTGGCTGGAGTGCATCAGG + Intergenic
1074936925 10:118190880-118190902 CGGGAAGGCTGGAGTGCAGGAGG + Intergenic
1075790882 10:125083697-125083719 CAGGACGGCTGGAGTCCAGGAGG - Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076273703 10:129178487-129178509 CAGTGTGGAGGGGGTGCAGAGGG - Intergenic
1076617797 10:131768237-131768259 AAGTTAGGATGGAGTGCAGATGG - Intergenic
1077141320 11:1026171-1026193 CAGTATGGCAGGAGGGCCGCAGG - Intronic
1078229282 11:9424699-9424721 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1079046709 11:17110946-17110968 CACCCAGGCTGGAGTGCAGAGGG + Intronic
1079202732 11:18389344-18389366 CAGAATTGCTTGAGTCCAGAAGG - Intergenic
1079505799 11:21150606-21150628 AAGTATGCCTGGAAAGCAGATGG + Intronic
1079591800 11:22191945-22191967 CACTTAGGCTGGAGTGCAGCGGG + Intergenic
1080619983 11:33979201-33979223 CACTCAGGCTGGAGTGCAGTTGG - Intergenic
1081866942 11:46365407-46365429 CTGTATGTCTGAAGTGCTGATGG - Intronic
1081996655 11:47369448-47369470 CACTCTGGGTGGAGAGCAGATGG - Intronic
1083001379 11:59294618-59294640 CAGGCTGGCTGGAGTGTAGTGGG + Intergenic
1083174507 11:60941110-60941132 CATTGTGGCAGGTGTGCAGAGGG - Exonic
1083760202 11:64811760-64811782 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1083838185 11:65286426-65286448 CAGTCTCACTGGAGTGCAGTGGG + Intronic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084190334 11:67495758-67495780 CATTCTGGCAGGAGTGCAGCTGG - Intronic
1084284790 11:68123899-68123921 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1084706638 11:70819745-70819767 CAGCATGGCAGGAGCACAGAGGG - Intronic
1084892905 11:72245152-72245174 CACGAGGGCTGGAGCGCAGAGGG + Intronic
1084899557 11:72299471-72299493 CAGTACTGCTCGATTGCAGAGGG - Intronic
1087620666 11:100538053-100538075 CAATATGGCTGCAGGGCAGTGGG + Intergenic
1089610396 11:119665439-119665461 CAGGATGGGTGGAGTGCTGCGGG - Intronic
1089677265 11:120098368-120098390 GACAATGGCTGGAGTGGAGAGGG + Intergenic
1089922641 11:122224784-122224806 CAGCATGTCTGGAGTGCCCAAGG + Intergenic
1090547680 11:127783154-127783176 CAGTATGGATGCAGTGGGGAGGG + Intergenic
1090570108 11:128036513-128036535 CAGAATGGCTGGAGTGACTATGG - Intergenic
1092224275 12:6736788-6736810 CACTCAGGCTGGAGTGCAGTTGG - Intergenic
1092249034 12:6881664-6881686 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1092268074 12:6998753-6998775 CAGGATTGCTGGAGTGTGGAAGG - Intronic
1092779189 12:11969739-11969761 CAGTAGGGCAAGACTGCAGATGG + Intergenic
1092833263 12:12465059-12465081 GAGGATGGCTTGAGTCCAGAAGG - Intronic
1094085762 12:26589744-26589766 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1095176878 12:39102847-39102869 CAGTATGACTGCATTGAAGAAGG + Intergenic
1095407004 12:41877917-41877939 CAGTCAGGCTGGGGTGCAGTGGG - Intergenic
1095858390 12:46887199-46887221 CCATCTGGCTGAAGTGCAGAGGG + Intergenic
1096910262 12:54976498-54976520 CAGGAGGGCAGGAATGCAGAAGG + Intronic
1097935026 12:65238232-65238254 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1099560345 12:84165234-84165256 CATTATGGCTAGAGTGAAGGAGG + Intergenic
1100098325 12:91071833-91071855 CACCCAGGCTGGAGTGCAGAGGG + Intergenic
1100448033 12:94679023-94679045 CAGAATGACTGCAGGGCAGAGGG - Intergenic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102496796 12:113325292-113325314 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1102853121 12:116269614-116269636 CACTAAGGCTGGAGTGCAGTGGG - Intronic
1103901143 12:124304108-124304130 CAGGCTGGCTGGAGTCCACAGGG + Intronic
1104061997 12:125276554-125276576 CTGAATGGCTGGAGTGGAGTTGG + Intronic
1104113318 12:125724809-125724831 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1104197762 12:126557185-126557207 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105277987 13:18947360-18947382 CAGAGTGGCTGGGGTGCAGGAGG - Intergenic
1105844435 13:24282093-24282115 CAGTGTGGCTGAAGTGATGAGGG + Intronic
1106230133 13:27815234-27815256 CTCTATGGCTAGAGTGGAGAGGG + Intergenic
1108429036 13:50335473-50335495 CTGGAGGGCTGGAGTGCAAATGG + Intronic
1109597912 13:64580508-64580530 CATTCAGGCTGGAGTGCAGTGGG - Intergenic
1110321945 13:74170803-74170825 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1110710058 13:78640758-78640780 CACCCAGGCTGGAGTGCAGATGG - Intronic
1111013356 13:82342528-82342550 CACTCGGGCTGGAGTGCAGTGGG + Intergenic
1111145338 13:84171015-84171037 CAGTATGTGTGGAGTCCTGAGGG - Intergenic
1112079487 13:95953458-95953480 AACTTTGGCGGGAGTGCAGAAGG + Intronic
1112130287 13:96516100-96516122 CAGCCAGGCTGGAGTGCAGTGGG + Intronic
1112242644 13:97697130-97697152 CTGGATGGAAGGAGTGCAGAGGG - Intergenic
1113478103 13:110599698-110599720 CACCCTGGCTGGAGTCCAGAGGG - Intergenic
1114284428 14:21226837-21226859 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1115267709 14:31518097-31518119 CACTCAGGCTGGAGTGCAGGGGG + Intronic
1115705659 14:35995282-35995304 CTCTATCGCTGGAGTGCAGTGGG - Intergenic
1115992547 14:39164745-39164767 GAGGATGGCTTGAGTGCAGGAGG + Intronic
1117133987 14:52714823-52714845 CAGCCAGGCTGGAGTGCAGTGGG - Intronic
1117539937 14:56737177-56737199 CAGTATGGTTGGAGTGTGGCAGG - Intergenic
1117663090 14:58028681-58028703 CACCATGGCTGCAGTGCAGGAGG + Intronic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118658932 14:67985818-67985840 CAGGATGGCTGGAGCTCAGGAGG + Intronic
1118838684 14:69495003-69495025 CAGAATGGCTTGGGTGGAGATGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119531208 14:75362544-75362566 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1119872418 14:78028935-78028957 AAGTATAGCTGGAGGACAGAAGG + Intergenic
1120106600 14:80502355-80502377 CAGGATGGCTGCTGTGCAGTGGG + Intronic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1120923812 14:89778746-89778768 CAGTCTGGCTGAAGGGCGGAGGG - Intergenic
1120946763 14:90005150-90005172 GAGTGTGGCTGCAGAGCAGATGG - Intronic
1121133504 14:91472502-91472524 CAGGCTGGATGGAGTGCAGTGGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121339099 14:93094421-93094443 CTGTATGGGTGGTGTGCAGCTGG - Intronic
1121498221 14:94412505-94412527 CAGTATAGCTGGAGTGGAATGGG - Intergenic
1121555973 14:94837523-94837545 CAGTATTTCTAGAATGCAGATGG - Intergenic
1121633368 14:95437470-95437492 CAGTATGTGTGAAGAGCAGAGGG - Intronic
1121814921 14:96921823-96921845 CAATATGGCTGGAGGTCTGATGG - Intronic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122048803 14:99041433-99041455 CAGTCTGGCCAGAGTGCAGAGGG - Intergenic
1122352346 14:101103455-101103477 CAGAGAGGCTGGAGTGCTGAGGG - Intergenic
1122725774 14:103750788-103750810 CACCAAGGCTGGAGTGCAGTAGG - Intronic
1123185259 14:106510613-106510635 CAGGATGGCTGTAGTGGAGGAGG + Intergenic
1123903232 15:24897110-24897132 CACTCAGGCTGGAGTGCAGAGGG - Intronic
1124003170 15:25776490-25776512 CAGTAGGCCTGGCGTGCAGGAGG + Intronic
1124100497 15:26688634-26688656 CAGTATGGTTGAACTCCAGATGG - Intronic
1125841817 15:42808808-42808830 CAGCAAGGCTAGAGTGCAGTTGG - Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1127262350 15:57335557-57335579 AAGCAGGGCTGGAGAGCAGAGGG - Intergenic
1127836600 15:62795583-62795605 CAGAAGGGCTGGAGTCTAGAGGG - Intronic
1127861452 15:62997508-62997530 AAGTGTGGCTGGAATGCAAAGGG + Intergenic
1127933581 15:63614374-63614396 CACCATGGCTGGCGTGCAGAAGG + Intronic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1130301301 15:82681254-82681276 CAATAAGGCTGGGGTGCAGGAGG - Intronic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131543507 15:93296116-93296138 AAGGATGGCTGGAGCCCAGAAGG + Intergenic
1132345275 15:101104427-101104449 AAGTAAAGCTGGAGTGTAGACGG - Intergenic
1132569724 16:638794-638816 CAGCATGGCTGAAGAGCGGAAGG - Intronic
1132573492 16:654299-654321 GAGGATGGCTGGAGTCCAGCTGG - Intronic
1132645156 16:995895-995917 TAGGATGGCTGAAGTTCAGAGGG + Intergenic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134608020 16:15586619-15586641 CAGTGGGGCTGGGCTGCAGATGG + Intronic
1134646853 16:15875559-15875581 GAGGATCGCTTGAGTGCAGAAGG + Intronic
1135149882 16:19996186-19996208 CAGCATGGCTAGGGTGCAGAGGG - Intergenic
1135243616 16:20834334-20834356 CAGTATCGCTTGAGCGCAGGAGG + Intronic
1135542088 16:23337980-23338002 GAGGATCGCTGGAGTCCAGAAGG + Intronic
1135563029 16:23491215-23491237 GAAAATGGCTGGAGTCCAGAAGG + Intronic
1136054789 16:27680319-27680341 CAGCATGGCTGCAGGGGAGACGG + Intronic
1137265563 16:46866407-46866429 GAGGATGGCTGGAGCTCAGAAGG + Intergenic
1137391654 16:48086367-48086389 CTGTCTGGCTGTAGAGCAGATGG - Intronic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1137753755 16:50885651-50885673 CAGTAGGGCTGGAATGCAGTAGG - Intergenic
1138382441 16:56612131-56612153 CACCCTGGCTGGAGTGCAGTGGG + Intergenic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1138565984 16:57833229-57833251 CAGGATGCCAGGAGGGCAGAGGG + Intronic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1138695554 16:58809614-58809636 CACTATGCCTGGAGAACAGATGG - Intergenic
1139575212 16:67837261-67837283 GAGGATGGCTTGAGTCCAGAAGG - Intronic
1140080593 16:71743560-71743582 CAGCCAGGCTGGAGTGCAGTGGG - Intronic
1140529891 16:75656096-75656118 CAGTGTGATTGGAATGCAGAGGG + Intronic
1140805657 16:78530050-78530072 CAGAAGGGGTGGAGTGCAGGGGG - Intronic
1141102581 16:81208918-81208940 CAGTAGGTATGGAGTGCAGCTGG + Intergenic
1142181520 16:88673264-88673286 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1142540562 17:655482-655504 CTGTCTGCCTGGAGTGCATATGG + Intronic
1142723227 17:1791844-1791866 CACTTAGGCTGGAGTGCAGTGGG - Intronic
1143228316 17:5327570-5327592 CAGTATATATGGAGTGCATATGG + Intronic
1143891337 17:10104793-10104815 CAGCATGGCAGCAGTGGAGAAGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144805919 17:17967645-17967667 CATTCAGGCTGGAGTGCAAATGG + Intronic
1145757022 17:27399928-27399950 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1145913056 17:28553698-28553720 CAGTCTGGCGGGAGTCCAGGAGG - Exonic
1146045673 17:29504068-29504090 CACCCAGGCTGGAGTGCAGAGGG - Intronic
1146273116 17:31497533-31497555 CAGGATGGCTGGGCTGCAGTGGG + Intronic
1146963294 17:37003514-37003536 CACCAGGGCTGGAGTGCAGTGGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147899218 17:43773044-43773066 CAGTACAGCTGGAGTGGAGGAGG + Intronic
1148835298 17:50462778-50462800 CAAGAGGGCTGGAGTGGAGAGGG - Intronic
1149808300 17:59640435-59640457 CACTCAGGCTGGAGTGCAGTAGG + Intronic
1150156267 17:62855948-62855970 CACCAAGGCTGGAGTGCAGTGGG - Intergenic
1150552050 17:66219867-66219889 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1152221120 17:79067234-79067256 CACCAAGGCTGGAGTGCAGTTGG - Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1153210807 18:2761775-2761797 CACCCAGGCTGGAGTGCAGAGGG - Intronic
1153226648 18:2905642-2905664 TAGTGAGGCTGGAGTGCAGCGGG + Intronic
1153238025 18:3006957-3006979 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1153493767 18:5676610-5676632 CAGGATGGGTGGAGTGGAAATGG + Intergenic
1154122780 18:11665074-11665096 CAGGATGGATGCTGTGCAGAGGG - Intergenic
1156080705 18:33331356-33331378 CAGGATGGCTGAAGAGCAAAAGG - Intronic
1157153741 18:45244583-45244605 CACTCAGGCTGGAGTGCAGTAGG - Intronic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1157827085 18:50822377-50822399 CAGCCAGGCTGGAGTGCAGTGGG + Intronic
1158117824 18:54016312-54016334 CAATGTGGCTGGAGTTCACAGGG - Intergenic
1158392233 18:57053029-57053051 CAGTATGGCTGGAGTGTGCATGG - Intergenic
1158467623 18:57705032-57705054 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1158685454 18:59610173-59610195 AAATCTGGCTGGAGTGGAGAGGG + Intronic
1159303408 18:66607904-66607926 CACCCTGGCTGGAGTGCAGTGGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160298896 18:77660986-77661008 CACTAAGCCTGGAGTGCAGTGGG - Intergenic
1161207846 19:3051144-3051166 CACTTTGGCTGCAGTGGAGATGG + Intergenic
1161407354 19:4097991-4098013 CAGTCTGGCTGGAGAGGAGGAGG + Intronic
1161503267 19:4629477-4629499 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1161822969 19:6542346-6542368 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1162270640 19:9612257-9612279 CACTTTGGCTGGAGTGCAAGTGG + Intronic
1162518182 19:11162735-11162757 CACCAAGGCTGGAGTGCAGTGGG + Intergenic
1162525993 19:11206882-11206904 CTGTCAGGCTGGAGTGCAGTGGG + Intronic
1162646056 19:12051483-12051505 CACCATGGCTGGAGTGCAGTGGG + Intronic
1162725164 19:12685896-12685918 CACCAGGGCTGGAGTGCAGTGGG + Intergenic
1163025514 19:14509118-14509140 CACCAAGGCTGGAGTGCAGTGGG + Intergenic
1163627331 19:18397640-18397662 GTGTCTGGGTGGAGTGCAGAGGG + Intergenic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1165171810 19:33897731-33897753 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1165476976 19:36036363-36036385 GAGTATTGCTTGAGTCCAGAAGG - Intronic
1165951858 19:39478405-39478427 CACCCTGGCTGGAGTGCAGTTGG - Intergenic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1167079135 19:47267317-47267339 CAGGCTGGATGGAGTGCAGTGGG + Intronic
1167617799 19:50545538-50545560 CATTCAGGCTGGAGTGCAGTGGG - Intronic
1167811740 19:51839351-51839373 CACCCAGGCTGGAGTGCAGAGGG - Intergenic
1168021371 19:53611306-53611328 CACTCAGGCTGGAGTGCAGCAGG + Intergenic
1168522266 19:57061743-57061765 CATCCTGGCTGGAGTGCAGTGGG - Intergenic
925107144 2:1301312-1301334 CAGCATGGCATGGGTGCAGACGG - Intronic
925583016 2:5433262-5433284 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
925712070 2:6750841-6750863 CATAATTGCTGGTGTGCAGAAGG - Intergenic
926369595 2:12166544-12166566 CACCCAGGCTGGAGTGCAGACGG - Intergenic
927698075 2:25251274-25251296 GAGGAAGGCAGGAGTGCAGAGGG - Intronic
929099769 2:38300689-38300711 CACTGAGGCTGGAGTGCAGTGGG + Intronic
929171104 2:38934392-38934414 CAGGGTGGCTTGAATGCAGAGGG - Intronic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
932320536 2:70819321-70819343 CAGTGGGGGTGGGGTGCAGAGGG - Intronic
932739754 2:74282612-74282634 CACTGGGTCTGGAGTGCAGAGGG + Intronic
932805649 2:74780548-74780570 CAGACTGGCTGGATTGCAGGTGG + Intergenic
933301393 2:80545114-80545136 CACAAGGGCTGGAGTGGAGAAGG - Intronic
933697116 2:85227949-85227971 CACTCAGGCTGGAGTGCAGTAGG - Intronic
934088005 2:88526214-88526236 AAGTAAGGCTGGAGTAGAGAAGG + Intronic
936532606 2:113287174-113287196 TAATGTGGCTGGAGTGTAGAGGG + Intergenic
938338514 2:130520094-130520116 CAGCCAGGCTGGAGTGCAGTGGG - Intergenic
938351325 2:130600656-130600678 CAGCCAGGCTGGAGTGCAGTGGG + Intergenic
938399035 2:130973446-130973468 CACTCAGGCTGGAGTGCAGTGGG - Intronic
938919293 2:135979594-135979616 TAGTATGGCGGCAGTGAAGATGG - Intronic
939389201 2:141544704-141544726 CACTGAGGCTGGAGTGCAGTGGG + Intronic
940061631 2:149577381-149577403 TGTTGTGGCTGGAGTGCAGAGGG + Intronic
940477102 2:154176988-154177010 CAGTAAGTTTGGAGTGGAGAGGG - Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941287714 2:163634482-163634504 CAGTTTGGCTGTGGTGTAGATGG - Intronic
941631017 2:167884280-167884302 CAGTATGGCCAGAGCACAGAGGG - Intergenic
941718469 2:168788198-168788220 CACTCTGGCTGGAGTGCAAGTGG - Intronic
942275173 2:174316370-174316392 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
943062464 2:183052921-183052943 AAATAAGGATGGAGTGCAGAAGG + Intergenic
943343943 2:186715290-186715312 GAGGATGGCTTGAGTGCAGGAGG - Intronic
943610242 2:190024225-190024247 CAGTTTGGCTGGAATGCACTTGG + Intronic
944731496 2:202522116-202522138 CACTCAGGCTGGAGTGCAGTGGG - Intronic
945954024 2:216068183-216068205 CACTCAGGCTGGAGTGCAGTGGG - Intronic
946013605 2:216586469-216586491 CACCCAGGCTGGAGTGCAGAGGG - Intergenic
946157837 2:217818500-217818522 CAGTGTGGCTGGCGTCCACACGG - Exonic
947512330 2:230767787-230767809 GAGTATGACTGGAGTGCATGAGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947588184 2:231369988-231370010 CAGCATCTCTGGAGTGCAGGGGG - Intronic
947722576 2:232378786-232378808 CAGCATGTCTGGAGGGCAGCAGG - Exonic
947995951 2:234528023-234528045 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
948199793 2:236121252-236121274 CAGCATGGGTAGAGTGCAGCAGG + Intronic
948210578 2:236190278-236190300 CAGGATCCCTTGAGTGCAGAAGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948306844 2:236954727-236954749 CTGCAGGGCTGGGGTGCAGAAGG + Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948776752 2:240293199-240293221 CAGTCTGCCGGGAGGGCAGAAGG - Intergenic
948807118 2:240457806-240457828 CAGGGTGGCTGGAATGCAGCAGG - Intronic
948879744 2:240850654-240850676 CAGGATGGCTGGGCTACAGAAGG + Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169101795 20:2956610-2956632 CACTCTGGTTGGAGTGCAGTGGG - Intronic
1169174975 20:3502979-3503001 CAGTATCACTGGAGTGAAAAAGG - Intronic
1169265160 20:4162978-4163000 TTGTATGCCTGGAGAGCAGAGGG + Intronic
1169360377 20:4943583-4943605 GAGGATGGCTTGAGTCCAGAAGG + Intronic
1172053753 20:32139773-32139795 CTGTGTGGCTACAGTGCAGAAGG - Intronic
1172243086 20:33426408-33426430 CACCCTGGCTGGAGTGCAGTGGG - Intronic
1172367247 20:34359449-34359471 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1172739496 20:37154550-37154572 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1173185519 20:40837081-40837103 CTGCATGGCTGGAATGCAGGGGG - Intergenic
1173395804 20:42678339-42678361 CATTCAGGCTGGAGTGCAGTGGG + Intronic
1175003072 20:55651073-55651095 CAGTATAGCTGGAAAGTAGAAGG - Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175283485 20:57820971-57820993 CTGTAGGGATGGATTGCAGAGGG + Intergenic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1177164137 21:17580789-17580811 CACCCAGGCTGGAGTGCAGAGGG + Intronic
1177593549 21:23205358-23205380 CAGTTTTGCTTGAGTGCAGGTGG + Intergenic
1178683737 21:34695229-34695251 AAATATGGCTGGAGTAAAGACGG - Intronic
1178803824 21:35821868-35821890 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1179605438 21:42513106-42513128 CAGGATGGCTTCAGAGCAGAGGG - Intronic
1180239651 21:46492897-46492919 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1181097125 22:20513110-20513132 CACTTGGGCTGGAGTGCAGTTGG + Intronic
1181315235 22:21966758-21966780 CTGTCTGTCTGGAATGCAGAAGG - Intronic
1182074921 22:27488760-27488782 CAGAATGGCTGTAATGCAGATGG - Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182386331 22:29945051-29945073 CACCCAGGCTGGAGTGCAGAGGG + Intronic
1182644491 22:31797093-31797115 CACCAAGGCTGGAGTGCAGTGGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1185011875 22:48319105-48319127 CTGAATGGCTGGAGTGGAGGTGG - Intergenic
1185252250 22:49809692-49809714 CACCATGACTGGAGTGAAGAGGG + Intronic
1185255895 22:49831064-49831086 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
949595284 3:5538079-5538101 CACTCTGGCTGGGGTGCAGTGGG + Intergenic
949877390 3:8635176-8635198 CAGTAGGTCTGGGGTGCAGACGG + Intronic
950004016 3:9679849-9679871 CAGCAGGGCTGGAGTGTAGCAGG + Intronic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950331328 3:12158449-12158471 CAGTATGGCCGGAGTGAGGGAGG + Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950809181 3:15635014-15635036 TAGTATGGATAGAGGGCAGAGGG + Intronic
951031077 3:17882301-17882323 CACTGAGGCTGGAGTGCAGTGGG + Intronic
951577311 3:24126995-24127017 CAAGATGGCTGGAGTTCAGCTGG - Intronic
952213971 3:31257129-31257151 CATTAAGACTGGAGTCCAGAAGG - Intergenic
953434860 3:42870491-42870513 AAGTAAGGCTGGGGTGGAGAGGG - Intronic
955289608 3:57679012-57679034 AAGTATGGCTTGAATCCAGAAGG + Intronic
955584531 3:60462366-60462388 CGGTATGGCTTGAGTGCCCATGG + Intronic
956960489 3:74393667-74393689 CAGTATGGCTGAAACACAGAGGG + Intronic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958417184 3:93888691-93888713 CAGTTTGACTGGTGTGCTGATGG - Intronic
958673978 3:97242283-97242305 CACTGTGGCTAGACTGCAGAGGG - Intronic
959538336 3:107512439-107512461 AAGTATGACTGGAGAGGAGAAGG + Intergenic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
961402911 3:126659627-126659649 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
961632107 3:128308674-128308696 CAGTCTGGCTGAAATGCAAATGG + Intronic
961786271 3:129348943-129348965 CAGCAAGGCTGGAGCACAGAGGG + Intergenic
961835948 3:129659744-129659766 CAAAATGGCAGGAGTGAAGATGG - Intronic
962390391 3:134966776-134966798 CAGAATGGCAGGAATGCAGATGG - Intronic
962436943 3:135375454-135375476 CAGTGTGGCTGAAATCCAGATGG - Intergenic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
962565594 3:136655721-136655743 CACCCAGGCTGGAGTGCAGATGG - Intronic
962974469 3:140434069-140434091 AAGTATGGCTTGTGGGCAGATGG - Intronic
963010971 3:140770024-140770046 CATCATAGCTGGAGAGCAGAAGG + Intergenic
963460235 3:145603323-145603345 CAGTATGGCTGGATCTCAGATGG - Intergenic
964187042 3:153958682-153958704 CAGTCAGACTGGAGTGCAGTGGG + Intergenic
964311462 3:155398095-155398117 CACTCAGGCTGGAGTGCAGTGGG - Intronic
964577774 3:158194231-158194253 CAGCCAGGCTGGAGTGCAGCAGG - Intronic
965175786 3:165330464-165330486 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
965439030 3:168690743-168690765 CAGGATGGCTGAACTGCTGAAGG + Intergenic
966519377 3:180855948-180855970 CACTGAGGCTGGAGTGCAGTGGG - Intronic
966865841 3:184258877-184258899 CAGGCTGGCTGGTGTGCAGAGGG - Intronic
966879142 3:184339930-184339952 CAGTTTTCCTGGAGTGCAGCTGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967199765 3:187062404-187062426 CACAATAGCTGGACTGCAGAAGG + Intronic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969640692 4:8396635-8396657 CACCAAGGCTGGAGTGCAGTGGG - Intronic
969673788 4:8603861-8603883 AAGCATGGCTGTCGTGCAGAGGG + Intronic
970056704 4:11981778-11981800 GAGTATGCCAGGAGAGCAGAAGG - Intergenic
970173014 4:13308050-13308072 CAGTGTGGCTAGAGTGCGGTGGG - Intergenic
970301539 4:14686227-14686249 CAGTATGGCAGGAGTAGAGCAGG + Intergenic
971268831 4:25118282-25118304 CAGTTTGGCTGGAATGGAGCAGG + Intergenic
972174596 4:36388191-36388213 GAGGAAGACTGGAGTGCAGAAGG + Intergenic
972184229 4:36508876-36508898 CAGAATTGCTGGAAAGCAGAAGG - Intergenic
972445582 4:39140186-39140208 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
972750137 4:41980404-41980426 CAGCTGGGCTGGAGTGCAGTGGG + Intergenic
973811321 4:54573139-54573161 GAGTATGGCTGGAGCACAGGTGG - Intergenic
975704670 4:77099843-77099865 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
975863299 4:78700756-78700778 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
977155410 4:93566727-93566749 CACTCAGGCTGGAGGGCAGAGGG - Intronic
977596311 4:98885486-98885508 CACCCTGGCTGGAGTGCAGTGGG + Intronic
978400464 4:108325350-108325372 CAGCATGGCTGGAGAGCACAGGG + Intergenic
978751098 4:112248796-112248818 CAGAATGGCTGGAATGAAGAAGG - Intronic
979322019 4:119335880-119335902 CAGTGTTGCTGCAGTGCACATGG + Intergenic
979383977 4:120042131-120042153 CAGTACCTCTGGAGTGCAGTCGG - Intergenic
979979934 4:127242549-127242571 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
980099333 4:128525388-128525410 CACCCAGGCTGGAGTGCAGAGGG - Intergenic
981091984 4:140741626-140741648 GAGTATGGCTTGAGTCCAGGAGG + Intronic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981335210 4:143561773-143561795 CACCATGGCTGGAGTGTAGTGGG + Intergenic
982263458 4:153516864-153516886 CACTTAGGCTGGAGTGCAGTGGG + Intronic
983055041 4:163092055-163092077 GAGGATGGCTTGAGTCCAGAAGG - Intergenic
983071712 4:163275624-163275646 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
983362097 4:166739279-166739301 CACTCAGGCTGGAGTGCAGTGGG + Intronic
983696197 4:170534789-170534811 GAGTATGGCTGGAATGGATAAGG + Intergenic
984148704 4:176098236-176098258 CAGTTGGGCTGAAGTGCATATGG - Intronic
984747639 4:183238550-183238572 CACTGTGGCTGGATTACAGAGGG - Intronic
985972673 5:3390823-3390845 CAGTGTGCATGGAGTGCAGTGGG - Intergenic
986125726 5:4880962-4880984 CAGAAAGGCTGGAGTGCTGGAGG + Intergenic
986353305 5:6900667-6900689 CTGCAGGGCTGGAGTGCGGAGGG + Intergenic
986739673 5:10695094-10695116 TAGCATGGCTGGTGAGCAGAGGG + Intronic
987075661 5:14379830-14379852 CAGAACGGCTGGAAGGCAGATGG - Intronic
987853716 5:23390557-23390579 CACCCAGGCTGGAGTGCAGAAGG - Intergenic
988713326 5:33800239-33800261 CAGTGTCGCAGGATTGCAGAAGG + Intronic
989630472 5:43477149-43477171 CATTTAGGCTGGAGTGCAGTAGG - Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
992585165 5:78231210-78231232 CACCAAGGCTGGAGTGCAGTGGG + Intronic
992681088 5:79153812-79153834 CAACATGGCTGGAGTAGAGAGGG + Intronic
992879969 5:81098055-81098077 CAGCATGGCAGGAGTGGAGTTGG + Intronic
996206604 5:120745737-120745759 CACCAAGGCTGGAGTGCAGTGGG + Intergenic
996211182 5:120812975-120812997 CACCAAGGCTGGAGTGCAGTGGG + Intergenic
997033986 5:130164997-130165019 CAGTATTGGTGGAGTATAGAGGG + Intronic
998056322 5:139081342-139081364 GAGGATGGCTTGAGTCCAGAAGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999403622 5:151286957-151286979 CACAATGCCTGGATTGCAGAAGG + Intronic
999652525 5:153781452-153781474 AAATATGGGTGGAGGGCAGAAGG - Intronic
999723175 5:154413584-154413606 CAGGATGGGTGGGATGCAGAGGG + Intronic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001915768 5:175558698-175558720 CAGGCTGGATGGAGTGCAGTGGG - Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002515427 5:179754547-179754569 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1002835933 6:865346-865368 CAGAATGACTGGAATGCAGGAGG + Intergenic
1004630558 6:17417314-17417336 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1005172975 6:23009417-23009439 CAATATGGCTTGAAAGCAGATGG + Intergenic
1005210528 6:23455257-23455279 CATTTAGGCTGGAGTGCAGTGGG + Intergenic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1008111271 6:47497481-47497503 GAGAATGGCTTGAGTCCAGAAGG - Intronic
1008198338 6:48553937-48553959 CAGCATGGCTGGAATAAAGAAGG - Intergenic
1008609004 6:53168643-53168665 CAGCAGGGCAGGAATGCAGAAGG + Intergenic
1010307077 6:74337632-74337654 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1010470298 6:76218846-76218868 CACCAAGGCTGGAGTGCAGTGGG - Intergenic
1010960713 6:82142642-82142664 CACAAAGGCTGGAGTGCAGTGGG - Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011605604 6:89102182-89102204 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1011810056 6:91121040-91121062 CATTTTGGCTGGAGTTCAGGAGG + Intergenic
1012276379 6:97279743-97279765 CACCCTGGCTGGAGTGCAGTGGG - Intronic
1012287168 6:97404812-97404834 CAGCATGGCCACAGTGCAGAAGG + Intergenic
1012308725 6:97693614-97693636 CAGTATGGGTGGACTGGATAAGG + Intergenic
1012669874 6:102030854-102030876 CATTAAGTCTGGAGTTCAGAGGG - Intronic
1012952385 6:105532263-105532285 CAATTTGGCTGGAGCTCAGAGGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015340756 6:132097796-132097818 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1016029156 6:139319722-139319744 CACCCAGGCTGGAGTGCAGATGG - Intergenic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017467471 6:154707787-154707809 CAGTCTGGCTGAAGTGGAGGAGG + Intergenic
1018324959 6:162656838-162656860 GAGTATGGCTGGAGTGTCAAGGG - Intronic
1018776400 6:167020866-167020888 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019159882 6:170062717-170062739 CAGTGTGGCTGATGTGCACAGGG - Intergenic
1019307263 7:341714-341736 CAGTATCTCTGGAGTGTTGAGGG - Intergenic
1019711895 7:2521613-2521635 CAGTAAGGCTTGAGTGCTGGGGG - Intronic
1020147932 7:5659461-5659483 CAGTATGGCTGGAGCCCAGTGGG + Intronic
1020242274 7:6404950-6404972 GAGGATGGCTTGAGTGCAGGAGG - Intergenic
1020512884 7:9081911-9081933 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
1020614063 7:10436922-10436944 GAGTATAGATGGAGTGAAGATGG - Intergenic
1020755379 7:12195059-12195081 CAGTATGACTGGAAAGCACAAGG - Intergenic
1021625395 7:22588243-22588265 CAGACTGGCCTGAGTGCAGAAGG + Intronic
1022098155 7:27153652-27153674 GAGTATGGCTGGAGGGCAGGGGG - Intergenic
1022170195 7:27820012-27820034 CAGTAAGGCTGGAGTGGGGCAGG - Intronic
1022213412 7:28234112-28234134 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1022246854 7:28568735-28568757 CAGTTTGTCAGGAGTCCAGATGG - Intronic
1022362672 7:29677495-29677517 TACTACAGCTGGAGTGCAGAGGG - Intergenic
1022407345 7:30103026-30103048 CACTCAGGCTGAAGTGCAGAGGG - Intronic
1022698718 7:32736298-32736320 TACTACAGCTGGAGTGCAGAGGG + Intergenic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023311628 7:38893198-38893220 CAATGTGGCTGTAGTGTAGAAGG - Intronic
1023585330 7:41724219-41724241 CACCCAGGCTGGAGTGCAGAGGG + Intergenic
1023976127 7:45031418-45031440 CACTTAGGCTGGAGTGCAGCGGG + Intronic
1025076578 7:55949103-55949125 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1025851574 7:65248947-65248969 CATTCAGGCTGGAGTGCAGTAGG + Intergenic
1025864563 7:65368759-65368781 AAGTCTTGCTGCAGTGCAGATGG - Intergenic
1025936652 7:66043380-66043402 CAGGATTGCTTGAGTCCAGAAGG + Intergenic
1026127794 7:67594764-67594786 GAGGATCGCTAGAGTGCAGAAGG + Intergenic
1026331598 7:69356788-69356810 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1026558286 7:71426877-71426899 CAGCCAGGCTGGAGTGCAGGTGG - Intronic
1026814692 7:73501379-73501401 CAGTGTGGTTGGACTACAGAAGG - Intronic
1027023958 7:74837234-74837256 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1027063972 7:75108087-75108109 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1027122944 7:75535286-75535308 CACTCAGGCTGGAGTGCAGTGGG + Exonic
1028551421 7:92071272-92071294 CAGTTTAGCAGGAGTGTAGAGGG + Intronic
1028855734 7:95590976-95590998 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029793957 7:102874652-102874674 GAGTATGGCTTGAGCCCAGAAGG - Intronic
1031239622 7:119220432-119220454 CAGTATGGCTAGAATACAGCAGG - Intergenic
1031492662 7:122408463-122408485 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1031978086 7:128106473-128106495 CAGGATGGATGGTGTGAAGATGG - Intergenic
1032229546 7:130062694-130062716 CAGCCAGGCTGGAGTGCAGTGGG + Intergenic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032410640 7:131691428-131691450 CAGCAAGGCTGGAGTTCGGATGG - Intergenic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032668733 7:134064393-134064415 CAGTCTGGCTGCGGTGCAGCAGG - Exonic
1032828153 7:135592844-135592866 CACCCAGGCTGGAGTGCAGAGGG - Intronic
1033540339 7:142350169-142350191 CAACATGGCTGGAGTAGAGAAGG - Intergenic
1034942890 7:155243348-155243370 TAGTAAGGAGGGAGTGCAGAAGG + Intergenic
1036415771 8:8546466-8546488 GAGTATTGCTGGAGTCCGGAAGG + Intergenic
1036795218 8:11750904-11750926 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037887782 8:22604174-22604196 AAGTAAGGCTGGAGTGATGATGG + Intergenic
1038177651 8:25195530-25195552 TGGTGTGGCTGGAATGCAGAAGG - Intronic
1038363031 8:26901943-26901965 CAGCATGTATGGGGTGCAGAGGG + Intergenic
1038807631 8:30809894-30809916 CAGTCAGGCTGGAGTGCAGTGGG - Intronic
1038960060 8:32508774-32508796 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1039022178 8:33219976-33219998 CACCCAGGCTGGAGTGCAGAGGG + Intergenic
1039727656 8:40237292-40237314 CAGCCAGGCTGGAGTGCAGTGGG + Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039868046 8:41522800-41522822 CTCTCTGGCTGGAGTGCAGTGGG - Intergenic
1039893599 8:41700801-41700823 CACCCTGGCTGGAGTGCAGTGGG + Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1040638738 8:49306272-49306294 CAGTATGGCTGGTTGGGAGATGG - Intergenic
1040826472 8:51626442-51626464 CAGTTTGGCTGACTTGCAGAGGG + Intronic
1041078070 8:54187274-54187296 CAGCAGGGATGGAGTGCAGAGGG - Intergenic
1041477130 8:58278938-58278960 CAGTAGGGGAGGAGAGCAGAAGG - Intergenic
1041753561 8:61288261-61288283 CGGGAGGGATGGAGTGCAGAGGG - Intronic
1042130775 8:65585120-65585142 CAATGTGGCTGGGATGCAGAGGG - Intergenic
1042542024 8:69916852-69916874 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1042697973 8:71579258-71579280 CACCAAGGCTGGAGTGCAGTGGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1042938327 8:74082771-74082793 AAATATGACTGGAGGGCAGAAGG + Intergenic
1044137679 8:88608353-88608375 CAGTAAGGCTGCCCTGCAGATGG + Intergenic
1045031224 8:98138321-98138343 CAGGGTGGCTGAAGTGTAGAAGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045224189 8:100228621-100228643 AAGGATGGCTTGAGTCCAGAAGG + Intronic
1045274573 8:100691471-100691493 CAGGCAGGCTGGAGTGCAGTGGG - Intronic
1045531807 8:102992036-102992058 CACCAAGGCTGGAGTGCAGTGGG - Intergenic
1045729427 8:105218063-105218085 CATTATTGCTGGACTGCATAAGG + Intronic
1045911275 8:107413327-107413349 CAGGAAGGCTGGGGAGCAGAGGG - Intronic
1046054692 8:109065431-109065453 CAGCCAGGCTGGAGTGCAGTGGG + Intergenic
1046233835 8:111394319-111394341 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1047343919 8:124009216-124009238 CACCCAGGCTGGAGTGCAGAAGG - Intronic
1048266044 8:132987975-132987997 CAGTGGGGATGGTGTGCAGATGG - Intronic
1049349611 8:142157504-142157526 AAGGATGGCTGGAAGGCAGAGGG + Intergenic
1049713312 8:144077348-144077370 CAGAGTGGCTGTAGAGCAGAGGG + Intergenic
1050197816 9:3106926-3106948 CAGTCTGTCTGGAGTGAAGCAGG - Intergenic
1050285299 9:4095702-4095724 CAGTTTAGCTGTAGTACAGATGG - Intronic
1050436194 9:5613311-5613333 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
1051287860 9:15514225-15514247 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1051589791 9:18766062-18766084 AAGTCTGGCTGGAGTACACAGGG + Intronic
1052758180 9:32563380-32563402 CAGGATGGCTGGAGTACAGTGGG + Intronic
1053391884 9:37741731-37741753 CTGTATGGCAGGAATGCAGGAGG - Intronic
1054983353 9:71232878-71232900 CAGTATAGCACCAGTGCAGAAGG - Intronic
1056680073 9:88709396-88709418 CAGTTTGGCTGGATTGAGGAGGG - Intergenic
1057275314 9:93673199-93673221 CAGAGTGGCTGGGGTGCAGGAGG + Intronic
1057363694 9:94398852-94398874 CACTGAGGCTGGAGTGCAGTGGG + Intronic
1057472989 9:95374570-95374592 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1057659641 9:96989235-96989257 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1057782408 9:98060628-98060650 CACCCAGGCTGGAGTGCAGAAGG - Intronic
1057944905 9:99317534-99317556 CAGTGTGGGTGGATTGCAGGAGG + Intergenic
1058906496 9:109486431-109486453 CAGTTTGGGTGGAGTGGAAAAGG + Intronic
1059159232 9:112018449-112018471 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1059983273 9:119796584-119796606 CAGTTTGGCTGGATTGTAGGGGG + Intergenic
1060050853 9:120377123-120377145 CAGTCTGGAGGGAGTGGAGAAGG + Intergenic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1060716154 9:125931325-125931347 CAGCCTGGGTGGAGTGCATAGGG - Intronic
1060804627 9:126566895-126566917 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1060830668 9:126713427-126713449 CACCCAGGCTGGAGTGCAGAGGG + Intergenic
1060846728 9:126843141-126843163 CAGAATCGCTGGAATGCAGGTGG - Intergenic
1060877737 9:127095355-127095377 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061219655 9:129242828-129242850 CAGTCTGGCTGGGGTGCAGGAGG + Intergenic
1061299924 9:129698368-129698390 CAGTCTGGCTGCAGAGAAGAGGG + Intronic
1061692923 9:132348836-132348858 GAGGATGGCTTGAGTCCAGAAGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1062068069 9:134539634-134539656 CTGTATGGGAGGCGTGCAGATGG + Intergenic
1062126410 9:134865289-134865311 CAGCATGGCTGCAATGCAGGGGG - Intergenic
1062307816 9:135919646-135919668 CAGCATGGGTGGAGTGAGGAGGG - Intergenic
1185662461 X:1738145-1738167 CACCAAGGCTGGAGTGCAGTGGG - Intergenic
1186267466 X:7847766-7847788 CAGCCAGGCTGGAGTGCAGTGGG - Intergenic
1186496763 X:10016689-10016711 CATTCTGGCTGCAGTACAGAAGG - Intronic
1186577699 X:10784484-10784506 CAGTCAGACTGGAGTGCAGTGGG + Intronic
1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG + Intergenic
1187117686 X:16370017-16370039 CAGTATGGCTGGTGTTCTTATGG - Intergenic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1187829609 X:23367525-23367547 CAGTAGGGCTGGCGTGCTCAGGG + Intronic
1187969024 X:24640972-24640994 CACTCAGGCTGGAGTGCAGAGGG + Intronic
1188009009 X:25038626-25038648 CAGGATGGCTGGTGCTCAGAAGG + Intergenic
1189922841 X:45920326-45920348 CACTCAGGCTGGAGTGCAGCTGG + Intergenic
1190085256 X:47389809-47389831 GAGTATTGCTTGAGTCCAGAAGG + Intronic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1190700693 X:52987396-52987418 CAGGATGGCTTGAGCCCAGAAGG + Intronic
1191210457 X:57879334-57879356 CAGTGTTGCTGAAGTTCAGATGG - Intergenic
1192431789 X:71117558-71117580 GAGGATCGCTGGAGTCCAGAAGG + Intergenic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1193372033 X:80710279-80710301 CAATATGGCTGGAGACCATATGG + Intronic
1193981975 X:88192260-88192282 CACCCAGGCTGGAGTGCAGATGG - Intergenic
1193987922 X:88269388-88269410 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1194476307 X:94363952-94363974 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1195397016 X:104422076-104422098 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1195735357 X:108007386-108007408 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1195976481 X:110532887-110532909 GACTATGGCTGAAGAGCAGAAGG - Intergenic
1196203295 X:112910517-112910539 CAATATGCCAGTAGTGCAGAGGG - Intergenic
1196326697 X:114413901-114413923 CTATATGGCTGGAGTAGAGAAGG + Intergenic
1196337228 X:114551481-114551503 CAGTTTGCCTGGAGGGCAAATGG - Intergenic
1196492157 X:116280710-116280732 CAGTTTGGCTGAAGTGAAAATGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196764353 X:119229452-119229474 CATTATGGTTGGAGTGTTGAGGG + Intergenic
1197324335 X:125073685-125073707 CAGTATGGATAGTGTGCAGGAGG + Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197968586 X:132091792-132091814 CAGCCAGGCTGGAGTGCAGTGGG - Intronic
1198529697 X:137539877-137539899 CTCTCTGGCTGGAGTGCAGTTGG + Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1201101350 Y:10677668-10677690 CACACTGGCTGGAGTGCAGTGGG + Intergenic
1201463836 Y:14257813-14257835 CACTGAGGCTGGAGTGCAGTGGG - Intergenic