ID: 1015095315

View in Genome Browser
Species Human (GRCh38)
Location 6:129408642-129408664
Sequence CTGGCTGATCACCCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015095309_1015095315 26 Left 1015095309 6:129408593-129408615 CCTTTGCATGATGGAAGAGGTCT 0: 1
1: 7
2: 157
3: 208
4: 293
Right 1015095315 6:129408642-129408664 CTGGCTGATCACCCTGAGGAAGG No data
1015095311_1015095315 -8 Left 1015095311 6:129408627-129408649 CCTGCCACCAAGAAGCTGGCTGA 0: 1
1: 38
2: 206
3: 246
4: 449
Right 1015095315 6:129408642-129408664 CTGGCTGATCACCCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015095315 Original CRISPR CTGGCTGATCACCCTGAGGA AGG Intronic
No off target data available for this crispr