ID: 1015095451

View in Genome Browser
Species Human (GRCh38)
Location 6:129409602-129409624
Sequence TCCATTTGAGAGACAACTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 2, 1: 18, 2: 203, 3: 201, 4: 332}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015095451_1015095454 5 Left 1015095451 6:129409602-129409624 CCAAGAGTTGTCTCTCAAATGGA 0: 2
1: 18
2: 203
3: 201
4: 332
Right 1015095454 6:129409630-129409652 GTGATCTGCAGAAGATGGCAGGG 0: 1
1: 187
2: 167
3: 145
4: 286
1015095451_1015095453 4 Left 1015095451 6:129409602-129409624 CCAAGAGTTGTCTCTCAAATGGA 0: 2
1: 18
2: 203
3: 201
4: 332
Right 1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG No data
1015095451_1015095455 27 Left 1015095451 6:129409602-129409624 CCAAGAGTTGTCTCTCAAATGGA 0: 2
1: 18
2: 203
3: 201
4: 332
Right 1015095455 6:129409652-129409674 GCCTTGCTCCAAAATCCTAGAGG 0: 143
1: 187
2: 148
3: 132
4: 240
1015095451_1015095452 0 Left 1015095451 6:129409602-129409624 CCAAGAGTTGTCTCTCAAATGGA 0: 2
1: 18
2: 203
3: 201
4: 332
Right 1015095452 6:129409625-129409647 GAGTAGTGATCTGCAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015095451 Original CRISPR TCCATTTGAGAGACAACTCT TGG (reversed) Intronic
901444628 1:9300549-9300571 TCCTTTTGAGAGACAGCTCTTGG + Intronic
901904050 1:12392659-12392681 TCCTTTTGAGAGACAGCTCTTGG - Intronic
902115684 1:14119088-14119110 TCTTTTTCAGAGACAACACTAGG + Intergenic
902342915 1:15796098-15796120 TCCCATTCAGAGACCACTCTGGG - Intergenic
904179492 1:28655946-28655968 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
904267980 1:29328793-29328815 TCCATTTTAGAGACAAGACATGG + Intergenic
904335933 1:29798011-29798033 TCCTCTTGAGAGACAGCTCTTGG + Intergenic
904372992 1:30062401-30062423 TGCATTTGAGAAATAGCTCTTGG + Intergenic
906050490 1:42867439-42867461 TTCTTTGGAGAGACAGCTCTTGG + Intergenic
907780342 1:57560859-57560881 TCCTTTTGAGAGTCAGCTCTTGG + Intronic
908739868 1:67316539-67316561 TACATTTGAGAGTAAAATCTAGG + Intronic
908807458 1:67946020-67946042 TCGTTTTGAGAGACATATCTAGG + Intergenic
909278734 1:73722148-73722170 TCCTTTTGAGAGTCAGCTCTTGG + Intergenic
909576921 1:77185883-77185905 TCCTTTTGAGAGACAGCTCTTGG + Intronic
909781253 1:79550362-79550384 TCCTTTTGATAAACAGCTCTTGG + Intergenic
909827226 1:80141944-80141966 ATCATCTGAGAGACAACACTGGG + Intergenic
910141289 1:84030014-84030036 TACTTTTGAGAAACAGCTCTTGG + Intergenic
910370635 1:86512153-86512175 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
910561902 1:88600006-88600028 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
910630222 1:89346277-89346299 TCCTTCTGAGAGGCAGCTCTTGG + Intergenic
910638990 1:89439949-89439971 TCCTTTTGAGAGACAACTCTTGG - Intergenic
910790322 1:91043745-91043767 TCCTTTTGAGAGACAGCTGTTGG + Intergenic
910831097 1:91463399-91463421 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
910948215 1:92616713-92616735 TCCTTTTGAGAGACAGCTGTTGG + Intronic
911109097 1:94164180-94164202 TCCATTTGAGAGACAACTCTTGG - Intronic
911257324 1:95647339-95647361 TCCTTTTGAGAGGCAGCTCTTGG - Intergenic
911738397 1:101361894-101361916 TCCTTTTGAGACACAGCTCTTGG - Intergenic
911883574 1:103270474-103270496 CCCTTTTGAGAGACAGCTCTTGG + Intergenic
911980427 1:104559446-104559468 TCCTTTTGAGAGACAACTCTTGG + Intergenic
911981898 1:104579237-104579259 TCTTTTTGAGAGAAAACTCTTGG - Intergenic
912050676 1:105524922-105524944 TCTTTTTGAAAGATAACTCTTGG - Intergenic
912067023 1:105756972-105756994 TTCCTTTAAGAGACAGCTCTTGG + Intergenic
912129911 1:106588025-106588047 TCCTTTTAAGAGACAACTCTTGG - Intergenic
912212253 1:107568919-107568941 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
912238208 1:107875814-107875836 CCCAGGTGAGAGACAACTGTGGG + Intronic
912252029 1:108021363-108021385 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
912730625 1:112099807-112099829 TCCATTTGAAAGACAGCTCCTGG + Intergenic
912733322 1:112128804-112128826 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
915650534 1:157307339-157307361 TCCTTCAGAGAGAAAACTCTGGG - Intergenic
915667670 1:157459618-157459640 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
916106329 1:161435302-161435324 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
916285317 1:163099553-163099575 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
916365967 1:164028062-164028084 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
917217213 1:172690888-172690910 TCCTTTTGAGAGGCAGCTCTTGG - Intergenic
917276497 1:173337219-173337241 TCTTATTGAGAAACAACTCTTGG + Intergenic
917462708 1:175246208-175246230 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
918755713 1:188337784-188337806 TCCTTTTGAGAGATGGCTCTTGG - Intergenic
918918231 1:190671854-190671876 TCCTTCTGAGAGACAGCTCTTGG - Intergenic
918958246 1:191237974-191237996 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
919241773 1:194924229-194924251 TCCTTTTGAGAGACAGCTATTGG + Intergenic
919426881 1:197443463-197443485 TCCATTTGATAGAAAAGTCAAGG - Intronic
919725880 1:200883270-200883292 CTCATTTCAGAGACCACTCTGGG - Intergenic
920197431 1:204238391-204238413 TCCTTTTGAGAGACACCTGTTGG + Intronic
921619820 1:217313162-217313184 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
922186124 1:223276294-223276316 TCCATTTGCCTGACAATTCTGGG + Intronic
922207966 1:223465589-223465611 TCCATGTGAGAGAAACCTTTAGG - Intergenic
922781047 1:228252556-228252578 TCATTTTGAGAGACAGCTCTTGG - Intronic
923253569 1:232199412-232199434 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
924477398 1:244394176-244394198 TCCTTTTGAGAGACAACTCTTGG - Intergenic
924491844 1:244545605-244545627 TCCTTTTAGGAGACAATTCTTGG + Intronic
924840776 1:247707807-247707829 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
924847133 1:247785113-247785135 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1064116840 10:12585386-12585408 TGCATTTGAGAAACAACTACAGG - Intronic
1064545688 10:16448110-16448132 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1064781012 10:18837882-18837904 TCCATTTCAGAGAAAATTCAGGG + Intergenic
1065005327 10:21374189-21374211 TCATTTTTAGAGACAGCTCTTGG + Intergenic
1065379289 10:25073175-25073197 TCCATGTGAGACACAACTCATGG + Intergenic
1066167027 10:32799205-32799227 TCCTTTTGAGAGTCAGCTCTTGG - Intronic
1067125553 10:43512519-43512541 TCCTTATGAGAGACAGTTCTTGG - Intergenic
1067333140 10:45340242-45340264 TGCTTTTGAAAGACAGCTCTTGG + Intergenic
1067754348 10:48993694-48993716 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1068007673 10:51409545-51409567 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1068447210 10:57138618-57138640 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1068459757 10:57312095-57312117 TCCATGTTAGTGACAACTCTTGG + Intergenic
1068837216 10:61568353-61568375 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1068908867 10:62357309-62357331 TCCTGTTGAGAGACAGCTCTTGG + Intergenic
1069145763 10:64890465-64890487 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1069192305 10:65506345-65506367 TCCTTTTGAGAGACAGCCCTTGG - Intergenic
1069290224 10:66769755-66769777 TCCATTAGTCAGACAATTCTGGG + Intronic
1069790831 10:71019558-71019580 TCCTTTTGAGAGACAGCCCTTGG - Intergenic
1071013897 10:80971700-80971722 TCCATCTGAGAAACAGCTTTTGG - Intergenic
1071267086 10:83973977-83973999 TCCTTTTAAGAGACAGCCCTTGG - Intergenic
1071364468 10:84884496-84884518 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1071378384 10:85033382-85033404 TCCTTTTGAGAGATAGCTCTTGG + Intergenic
1071673927 10:87637404-87637426 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
1071937689 10:90549301-90549323 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1071942785 10:90607753-90607775 TCCTTTTGAGAGACCGCCCTTGG - Intergenic
1071947086 10:90657706-90657728 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
1071950799 10:90700912-90700934 TCCTTTTGAAAGACAGCTTTTGG - Intergenic
1072209258 10:93231653-93231675 TCCTTTTGAGAGACAGATCTTGG - Intergenic
1072360469 10:94654168-94654190 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1072400596 10:95095719-95095741 GCCATTTAAGAGTCAAGTCTTGG + Intergenic
1072715430 10:97749371-97749393 TCCAGGTGAGACACAGCTCTGGG - Intronic
1073557349 10:104465925-104465947 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1073830504 10:107377984-107378006 TCTTTTTGAGAGACAGTTCTTGG - Intergenic
1073838742 10:107473982-107474004 TCCATTTTAGAGACAAGACATGG + Intergenic
1073918476 10:108432290-108432312 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1073957682 10:108891628-108891650 CCCTTTTGAGAGACAGCTCTTGG - Intergenic
1073966711 10:108998628-108998650 GCCATCTGATGGACAACTCTAGG - Intergenic
1073995873 10:109314692-109314714 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
1075606789 10:123817424-123817446 TCCTTTTGAGAGACAGCACTTGG + Intronic
1076123291 10:127953370-127953392 TCCTTTTGAGAGACAACTCTTGG + Intronic
1076772629 10:132674814-132674836 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1078900206 11:15634981-15635003 TCCCATTAAGAGAAAACTCTAGG - Intergenic
1079538498 11:21543725-21543747 TACATTTTAGAGACTTCTCTGGG + Intronic
1080020139 11:27551641-27551663 TTCTTTTGAGAGACAGCTCTGGG - Intergenic
1080076593 11:28157520-28157542 CCCTTTTGAGAGACAGCTCTTGG + Intronic
1080976680 11:37350597-37350619 TCCTTTTGAGAGACAGCTTTTGG + Intergenic
1081065460 11:38534877-38534899 TCTTTTTGAGAGGCAGCTCTTGG - Intergenic
1081072776 11:38631120-38631142 TCCTTTTGAGAGACATTTCTTGG + Intergenic
1081110477 11:39128418-39128440 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1081266468 11:41029933-41029955 TCCATAAGAAAGATAACTCTTGG + Intronic
1081609061 11:44547877-44547899 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1084759001 11:71256464-71256486 TCCATTTGAGAGTTGACTCCAGG - Intergenic
1085079266 11:73620721-73620743 CCCTTTTGAGAAACAGCTCTTGG + Intergenic
1085685962 11:78622189-78622211 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1085747570 11:79128239-79128261 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1085982935 11:81746303-81746325 ACAATATGAGAGACAATTCTAGG - Intergenic
1086278612 11:85160451-85160473 TCCTTTTGAGAAACAGCTCTTGG + Intronic
1086834115 11:91600392-91600414 TCCTTTTGGGAGACAGCTCTTGG + Intergenic
1087374021 11:97320553-97320575 TCCTTTTGAGAGACACCTCTTGG + Intergenic
1087765852 11:102152436-102152458 TCGATTTGAGAGGTAAGTCTGGG + Intronic
1088097204 11:106115157-106115179 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1088191660 11:107234491-107234513 TTCTTTTGAGAGACAGTTCTTGG - Intergenic
1088407612 11:109498663-109498685 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1088449355 11:109965367-109965389 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
1088836655 11:113583388-113583410 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1089903606 11:122013608-122013630 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1090209493 11:124908051-124908073 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1090314331 11:125771651-125771673 TCCATTTGGGAGACCACTTGGGG - Intergenic
1090575129 11:128094202-128094224 TCCCTCTGAGAGTCAGCTCTTGG + Intergenic
1091051739 11:132378755-132378777 TCCTTTTGAGAGGCAGCTTTTGG + Intergenic
1091212417 11:133873524-133873546 TCCTTTTGAGAAACAGCTTTTGG + Intergenic
1092093283 12:5821650-5821672 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1092381560 12:8000938-8000960 TCCTTTTGAGAGACAGCTCCTGG + Intergenic
1093036336 12:14335683-14335705 CCCTTTTGAGAGACAGCTCTTGG + Intergenic
1093048924 12:14484968-14484990 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1093049671 12:14490963-14490985 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1093964540 12:25310956-25310978 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1094102529 12:26779262-26779284 TCCTTTGGAGAGACAGCTCTTGG + Intronic
1094127419 12:27037916-27037938 TCCATTTATGAAAAAACTCTTGG + Intronic
1095121506 12:38424844-38424866 TCTTTTTGAGAGGCAACTCTTGG - Intergenic
1095289300 12:40458721-40458743 TCCTTTTTAGGAACAACTCTAGG + Exonic
1095603853 12:44044334-44044356 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1095856241 12:46863675-46863697 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1096288712 12:50322960-50322982 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1097437839 12:59572254-59572276 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1097821342 12:64131864-64131886 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1097843358 12:64342761-64342783 TCCTTTTGAGAAACAGCTCTTGG - Intronic
1097960209 12:65524994-65525016 TACAATTGAGAGACATTTCTTGG + Intergenic
1098673040 12:73254244-73254266 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1098716089 12:73829815-73829837 TCCTTTTGAGAGACAGTTCTTGG + Intergenic
1098731050 12:74037348-74037370 TCCTTTTGAGAGACAGCTGTTGG + Intergenic
1098733291 12:74065631-74065653 TCCTTTGGAGAGAAAGCTCTTGG + Intergenic
1098807195 12:75034973-75034995 TCCTTTTAAGAAACAGCTCTTGG + Intergenic
1098831905 12:75374025-75374047 TCATTTTGAGAGAAAGCTCTTGG - Intronic
1099183380 12:79492588-79492610 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
1099365923 12:81765384-81765406 TCCTTTCGAGAGACAGCTCTTGG + Intergenic
1099379382 12:81936540-81936562 TCTTTTTGAGAGGCAGCTCTTGG - Intergenic
1099508560 12:83507187-83507209 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1099578075 12:84405391-84405413 TCCTTTTGAGAGGCAGCTTTTGG + Intergenic
1099735784 12:86565039-86565061 TCTTCTTGAGAGACAGCTCTTGG + Intronic
1099995066 12:89769530-89769552 TCCTTTTGAGAAATACCTCTTGG - Intergenic
1100241153 12:92711608-92711630 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1100787930 12:98098421-98098443 GCCATTTGAAAGACAACTTTAGG - Intergenic
1101264130 12:103066122-103066144 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1101534668 12:105606104-105606126 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1101543071 12:105682636-105682658 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1101572399 12:105965922-105965944 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1101697458 12:107139830-107139852 TCCTTTTGAGAAAAAGCTCTTGG - Intergenic
1102427785 12:112857966-112857988 TCCCATTTAGAGACAACACTTGG - Intronic
1103035611 12:117654063-117654085 TCCTTTTAAGAGACAGCTCTTGG + Intronic
1104497256 12:129252482-129252504 TCTTTCTGAGAGACAATTCTGGG - Intronic
1104646536 12:130501681-130501703 TGCCTTTGAGCCACAACTCTAGG + Intronic
1105740108 13:23315176-23315198 TCCTTTTGAGAGACAACTCTTGG + Intronic
1107165469 13:37277735-37277757 ACCCTTTGAGAGACAATTATTGG + Intergenic
1107983577 13:45755972-45755994 TCCTCTTGAGAGACAGCTCTTGG - Intergenic
1108302435 13:49091985-49092007 TCCTTTGGAGAGACAGCTCTTGG - Intronic
1108431846 13:50361180-50361202 CCCATTTGGGAGAAAACTGTAGG - Intronic
1108904277 13:55449971-55449993 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1108914302 13:55588871-55588893 TCCTTTTGAAAGACAGCTCTTGG - Intergenic
1109519021 13:63484801-63484823 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1109583047 13:64366167-64366189 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1109951025 13:69502205-69502227 ACCTTTTGAGAGACAGCTCTTGG - Intergenic
1110143764 13:72164814-72164836 TCCCTTTGAGAAACAGGTCTAGG - Intergenic
1110377172 13:74806469-74806491 TTTTTTTGAGAGACAGCTCTTGG + Intergenic
1110834136 13:80064629-80064651 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1111057799 13:82973027-82973049 CCAGTTTGAGAGACAGCTCTTGG - Intergenic
1111432254 13:88159634-88159656 TCCTTTTGAAAGACAGATCTTGG - Intergenic
1112231127 13:97590164-97590186 TTCTTTTGAGAGATAGCTCTTGG - Intergenic
1112249929 13:97770278-97770300 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1112628728 13:101137192-101137214 TCCCTTTGAGATACAACCCATGG + Intronic
1113693817 13:112330292-112330314 TCCATGTGAGTGACGCCTCTTGG + Intergenic
1114205870 14:20570769-20570791 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
1114390793 14:22306163-22306185 TCCTTCTTAGAGAGAACTCTTGG + Intergenic
1114537921 14:23434544-23434566 GCCATCTGAGAGACAACTAATGG + Intronic
1114905376 14:27120422-27120444 TCCTTATGAGAGACAGCTATTGG - Intergenic
1115039413 14:28904687-28904709 TCCATTAGAGAAAATACTCTGGG - Intergenic
1115059715 14:29173894-29173916 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1115130692 14:30049260-30049282 TCCTATTAAGAGACAGCTCTTGG + Intronic
1115143399 14:30199387-30199409 TTCTTTTGAGAGGCAACTCTTGG + Intergenic
1115890243 14:38018341-38018363 TTAATTTGAGAGACTACTCTTGG + Intronic
1116058907 14:39896938-39896960 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1116158380 14:41236665-41236687 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
1116308045 14:43283447-43283469 TCCTTTGGAAAGACAGCTCTTGG - Intergenic
1117001598 14:51376312-51376334 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1117216842 14:53560175-53560197 TCCTTTTGAGAGACACCTCTTGG + Intergenic
1117634132 14:57724373-57724395 TCCTTTTGAGAGACAGCTGTTGG + Intronic
1117780115 14:59223384-59223406 TCCTTCTGAGAGACAGCTCTTGG - Intronic
1117997793 14:61494211-61494233 TCCATTTAAGAGACTCCTATTGG - Intronic
1118482268 14:66179214-66179236 TCCAGTTGAGAGGCAAAGCTGGG - Intergenic
1118880775 14:69824018-69824040 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1119107565 14:71938839-71938861 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1120169406 14:81233986-81234008 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
1120250741 14:82059649-82059671 TCTTTTTGAGAGACCACTCTTGG - Intergenic
1120794594 14:88618678-88618700 TCCATTTGAATGACAAAGCTTGG + Exonic
1120892476 14:89503641-89503663 CCCATCTGAGAGACAACAGTAGG + Intronic
1122761125 14:104027420-104027442 TCCATTAGGGAGATAAATCTTGG - Intronic
1123794345 15:23756523-23756545 ACCATTTGAGAGACAATTATTGG + Intergenic
1123908499 15:24943654-24943676 TCCTTTTGAGAAACAGCTGTTGG - Intronic
1124210929 15:27764453-27764475 TCCATTCCAAAGACAACTCAAGG + Intronic
1125249225 15:37680252-37680274 TCCATTTAAGAGATAATTATTGG - Intergenic
1126170350 15:45690413-45690435 CCCATATGAGAGAGAAATCTGGG + Intronic
1126189875 15:45868187-45868209 ACCATTTGAAAGATAACTCCTGG + Intergenic
1126283609 15:46986277-46986299 TCCTTTTAAGAAACAACTCTTGG + Intergenic
1127356915 15:58209189-58209211 TCCTTGGGAGAGACAGCTCTTGG + Intronic
1127641467 15:60919528-60919550 TCCATTATAGAGGCTACTCTGGG + Intronic
1128404041 15:67316875-67316897 TGCATTTGAGGGACAGATCTGGG + Intronic
1128642810 15:69352223-69352245 TCCTTTTGGGAGGCAGCTCTTGG + Intronic
1130852676 15:87811755-87811777 TCCTTTTAAGAAACAACTTTAGG + Intergenic
1131523946 15:93137831-93137853 TCACTTTGAGAGCCAACCCTTGG + Intergenic
1131724009 15:95202795-95202817 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1133223337 16:4328494-4328516 TCCATTGGAGGAAAAACTCTGGG + Intronic
1133723837 16:8519446-8519468 TGCATTTGAAAGACACTTCTAGG - Intergenic
1135626002 16:23995496-23995518 TCCTATTAAGAGACAGCTCTTGG + Intronic
1136250941 16:29004591-29004613 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1138278894 16:55757689-55757711 TTCATTTCAGATACAACTCACGG + Intergenic
1138318837 16:56093763-56093785 TCTTTTTGAGAGACAGATCTCGG - Intergenic
1141495672 16:84407875-84407897 TTCATTTCAGAGACATCTCATGG - Intronic
1141559544 16:84858038-84858060 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1141906114 16:87028107-87028129 TCCTTGAGAGAGTCAACTCTTGG - Intergenic
1142588383 17:988584-988606 TCCTTTTGAGACACAGCTTTTGG - Intergenic
1143050116 17:4118350-4118372 TTCTTTTGAGAGACAGCTCCGGG - Intronic
1144337175 17:14281790-14281812 GCCAAATAAGAGACAACTCTGGG + Intergenic
1146836354 17:36114000-36114022 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1148362558 17:47024383-47024405 TCCCTTTTAGAATCAACTCTGGG - Intronic
1150687631 17:67333303-67333325 TCCATTTCAGAGTCAGCTTTTGG - Intergenic
1151964436 17:77424030-77424052 TCCATTTTAGGGACAACGCAAGG + Intronic
1153049134 18:884699-884721 TCCTTTTGAGAAACAGCACTTGG + Intergenic
1153089708 18:1330158-1330180 CCCTTTCGAGAGACAGCTCTTGG + Intergenic
1153217694 18:2835606-2835628 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1154068464 18:11131095-11131117 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1154129538 18:11724828-11724850 TCCTTTTAAGAAACAACCCTTGG - Intronic
1154252672 18:12757279-12757301 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1154506171 18:15042886-15042908 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1155940706 18:31799594-31799616 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1156303859 18:35858690-35858712 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1156606370 18:38671761-38671783 TCCTTTTGAGAGACATTTCTTGG + Intergenic
1156698784 18:39799151-39799173 GCCCTTTAAGAGACAGCTCTAGG + Intergenic
1156998578 18:43497725-43497747 TCCTTTTGAGAGATAGCTTTTGG + Intergenic
1157284195 18:46365990-46366012 TCTAATTAAGAGATAACTCTTGG + Intronic
1157341201 18:46780023-46780045 TCCTTTTGAGAGACAACTCTTGG + Intergenic
1157998505 18:52588128-52588150 TCTGTTTAAGAGACAGCTCTTGG - Intronic
1159152206 18:64535042-64535064 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
1159277139 18:66235521-66235543 TCCTGTTGAGAAACAGCTCTTGG + Intergenic
1159287788 18:66375478-66375500 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1159559106 18:69975355-69975377 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1159711300 18:71764120-71764142 TACTTTTGAGAGACAACTCTTGG + Intronic
1159933293 18:74336900-74336922 TCCATTTCAGAGACCACAGTAGG - Intronic
1160092462 18:75840011-75840033 TCCTCTTGAGAGACAGCTCTTGG + Intergenic
1164097087 19:22021347-22021369 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1164117259 19:22234578-22234600 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1164876646 19:31695389-31695411 TCCATGCCACAGACAACTCTAGG - Intergenic
1166092748 19:40520750-40520772 TCCAGTTGGGAGATCACTCTGGG + Intronic
1166211324 19:41308418-41308440 TCCTTGTGAGAGACAATGCTGGG + Intronic
1167525847 19:49983337-49983359 TCCCTTTGAGATACAGCTCGAGG + Intronic
1168539337 19:57197374-57197396 TCCTTTTGAGAGACAGCTCTTGG - Intronic
925055942 2:857422-857444 TCCATGTGAGACACAGCTCCAGG - Intergenic
925279952 2:2676864-2676886 TTCTTTTGAGAGACAGCACTTGG + Intergenic
925461123 2:4063576-4063598 GCCATGTGAGAGACAACAATAGG - Intergenic
926810397 2:16750680-16750702 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
926825566 2:16902234-16902256 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
926826761 2:16913664-16913686 TCCTTTTGAGAGACAGATCTTGG + Intergenic
927008716 2:18879720-18879742 TCCTTTTGACAGACAGCTCTTGG + Intergenic
927325993 2:21805928-21805950 TCCCTCTGAGAGTTAACTCTTGG - Intergenic
927660431 2:24988665-24988687 TCCTTTTGAGAGACGGCTCTTGG + Intergenic
927693850 2:25227114-25227136 TCCACTTGCAAGACAGCTCTGGG + Intergenic
928632183 2:33205141-33205163 AGCATTTGAGAGACAAGTATAGG - Intronic
928886043 2:36149521-36149543 TCCATTTATCAGACAGCTCTGGG + Intergenic
929269827 2:39960785-39960807 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
929550260 2:42886028-42886050 TCCTTTTGAGAGACAACTCTTGG + Intergenic
930295405 2:49547513-49547535 TCCTTTTGAGAAAGAGCTCTTGG - Intergenic
930536610 2:52652266-52652288 CTCCTTTGAGAGACAACTCTTGG - Intergenic
931260498 2:60614327-60614349 TCCATTTCAAAGAAAACTCAGGG + Intergenic
931697193 2:64880134-64880156 TCCAGTGCAGAGAAAACTCTGGG + Intergenic
932641559 2:73452366-73452388 TCCTGTTGAGAGATAACACTGGG - Exonic
932870708 2:75395085-75395107 TCCTTTTGAGAGACAGCTCCTGG - Intergenic
933265685 2:80178384-80178406 CCTTTTTGAGAGACAGCTCTTGG - Intronic
933394464 2:81713359-81713381 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
933736660 2:85500791-85500813 TCCAATTCAGAAACAACTATGGG - Intergenic
935183934 2:100714897-100714919 TCCTTTTGACAGACAGCTCTTGG + Intergenic
935425111 2:102911329-102911351 TCCTTTTGAGATACAGCTCTTGG - Intergenic
935564310 2:104590255-104590277 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
935944631 2:108274367-108274389 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
936403929 2:112185971-112185993 TTCATTTTAAAGACAACGCTAGG - Intronic
936641225 2:114314688-114314710 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
936646289 2:114376384-114376406 TCCCTTTGAGGGACAGCTCATGG - Intergenic
937582065 2:123499169-123499191 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
937785207 2:125887730-125887752 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
937800326 2:126074726-126074748 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
937852571 2:126648740-126648762 TCCTTTTGAGAGACAGCACTTGG - Intergenic
937867150 2:126761080-126761102 TCCTTTTGAGAAAGAGCTCTTGG + Intergenic
938203930 2:129401171-129401193 TCCTTTTGAGAAACAGCTCGTGG + Intergenic
938375538 2:130803370-130803392 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
939069061 2:137517854-137517876 TCCTTTTGAAAGGCAGCTCTTGG + Intronic
939213871 2:139212238-139212260 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
939788687 2:146546115-146546137 TCCTTTTGAGAGACAACTCTTGG - Intergenic
939806239 2:146778472-146778494 TCCTTTTGAAAGACAGCTCTCGG + Intergenic
939833624 2:147101856-147101878 TACATTTGAGAGACAGATTTGGG - Intergenic
940158739 2:150688510-150688532 GCCATTTGGAAGACAGCTCTAGG + Intergenic
940171314 2:150832714-150832736 TCCTTTTGAGATACAGCTCTTGG - Intergenic
940544765 2:155069837-155069859 TCCCTTTGAGGAACATCTCTTGG - Intergenic
940605917 2:155924290-155924312 TCCTTTAGAGAGACAGCTCATGG - Intergenic
941156036 2:161979519-161979541 TCCATGTGAGAAACATCTTTTGG + Intronic
941831325 2:169963300-169963322 TCCATTAGAATGTCAACTCTGGG - Intronic
942048120 2:172112572-172112594 CAGATTTGAGAGACAACACTTGG - Intergenic
942099159 2:172560878-172560900 TCCATTTAAGACTTAACTCTGGG - Intronic
942221846 2:173776413-173776435 GCCTTTTGAAAAACAACTCTGGG - Intergenic
942253218 2:174065309-174065331 TCCAATTGAGACACAACAATTGG + Intergenic
943006896 2:182395839-182395861 TCCTTTTGAGAGACAGCTCTTGG + Intronic
943239220 2:185362574-185362596 TCCTTTTGAGAGACAACTCTTGG - Intergenic
943388129 2:187227134-187227156 TGCTTTTGAGAGGCAGCTCTTGG + Intergenic
943517599 2:188907244-188907266 TCCTTTTGAGAGACATCTCTTGG - Intergenic
944448612 2:199818263-199818285 TCCATTTGTGAGACAAATCATGG + Intronic
945147250 2:206751619-206751641 TCTATGTGTGAGACACCTCTAGG + Intronic
945544869 2:211138155-211138177 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
945642177 2:212443835-212443857 TCCTTTTGAGAGACAGCTCTTGG + Intronic
945717836 2:213380671-213380693 TCCTTTTGAGAGACAGCTCTTGG - Intronic
945725846 2:213471497-213471519 TCCTTTTGAGAGACAGATGTTGG - Intronic
946527869 2:220539969-220539991 TCCTCTTCAGAGACAGCTCTTGG - Intergenic
946703775 2:222437794-222437816 TCCTTTTGAGAGACAGCTCTTGG - Intronic
946790920 2:223299758-223299780 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
947440716 2:230118668-230118690 TCCTTTTGAGAGACAGCTCCAGG - Intergenic
947440846 2:230120255-230120277 TCCTTTTGAGAGACAGCTCTGGG + Intergenic
947758372 2:232585783-232585805 ACCACTTGGGAGACAACTTTTGG - Intergenic
1169119440 20:3086034-3086056 ACCCTTTGAGAGGCAACACTGGG + Intergenic
1173902506 20:46601213-46601235 TACATTTTATAAACAACTCTGGG + Intronic
1174141849 20:48420272-48420294 TCCATTTTACACAGAACTCTAGG + Intergenic
1176791682 21:13326138-13326160 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1176998159 21:15580182-15580204 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1177139417 21:17342271-17342293 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1177505562 21:22014184-22014206 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
1177781016 21:25622426-25622448 TCCTTTTGAGAAACAGCTTTTGG - Intergenic
1177913174 21:27056208-27056230 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1178012659 21:28305173-28305195 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1178060756 21:28851140-28851162 TCCTTTTGAGAAACAGTTCTTGG - Intergenic
1178063300 21:28875359-28875381 TCTTTTTGAGAAACAGCTCTTGG - Exonic
1178145772 21:29737836-29737858 ACCATCTGAGACACAAGTCTGGG + Intronic
1178163991 21:29950553-29950575 TTAATTTGAGAGACAATTCCAGG - Intergenic
1178457115 21:32765746-32765768 TCCATTTCAGAGGGAAGTCTGGG - Intronic
1178634465 21:34290195-34290217 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1179415151 21:41192523-41192545 TCCTTCTGAGAGAGAGCTCTTGG - Intronic
1179771835 21:43625629-43625651 TCCATTTGAGAGCTAACCCATGG + Intronic
1180591148 22:16938369-16938391 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1181367437 22:22388946-22388968 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1181420653 22:22795829-22795851 TGCTTTTGAGAGACAGCTGTTGG + Intronic
1182954031 22:34404235-34404257 TCCATTTCAGAGGCAGTTCTAGG + Intergenic
1184314131 22:43670285-43670307 TCCATATGAGAAACACCTTTGGG + Intronic
1184603562 22:45558377-45558399 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1185033675 22:48459539-48459561 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
949170041 3:986606-986628 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
949196714 3:1318688-1318710 CCTAGTTGTGAGACAACTCTAGG - Intronic
949245867 3:1924920-1924942 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
949417593 3:3830885-3830907 TCCTTTTGAGAGACAGCTCTTGG - Intronic
949445610 3:4131051-4131073 TCCTTTTGAGAGACAGCTCTTGG + Intronic
949751317 3:7355560-7355582 TCCTTTAGAGAGACAGCTTTTGG + Intronic
951003618 3:17592849-17592871 TCCTTTTGAGAGACAGCTTTTGG + Intronic
951122570 3:18945564-18945586 TCCTTTTGAGAGGCAGCTCTAGG + Intergenic
951291520 3:20876748-20876770 TCCTTTTGTGAGACAGCACTTGG - Intergenic
951384524 3:22027532-22027554 TCCTTTTGAGAGACAGCTCTTGG + Intronic
951970764 3:28441868-28441890 TCCTTTTGAGAGACAGCTCTTGG - Intronic
954054155 3:48007957-48007979 TCCTTTTGAGAGTCAGCTCTTGG + Intronic
954511492 3:51129664-51129686 TCCTTTTGAGAGGCAGCTCTTGG - Intronic
955418755 3:58716570-58716592 TCCATGTGAGAGACCACTTTTGG - Intergenic
955961815 3:64348441-64348463 TACATTTGAAAGATCACTCTGGG + Intronic
956319473 3:67980543-67980565 TTTATTTGAGAGATAATTCTGGG - Intergenic
956360451 3:68441435-68441457 TCCTTTTGAGAGATAGCTCTTGG + Intronic
956509660 3:69980369-69980391 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
956703896 3:71982890-71982912 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
957247582 3:77733900-77733922 TACTTTTGAGAGACAGCTTTTGG - Intergenic
957615735 3:82524326-82524348 TCCATGTGACAGACAACTGTGGG + Intergenic
957803953 3:85122491-85122513 TGGATTTGAGAGAGAACTGTGGG - Intronic
958029747 3:88094033-88094055 GTCATTTGAGAGAAAAATCTAGG + Intronic
958487679 3:94732477-94732499 TCCTTTTAAGAGACAGCTCTTGG - Intergenic
958682337 3:97347077-97347099 TACATTTCAGAGACAACTGGTGG - Intronic
959226780 3:103597279-103597301 TCCTTTTAAGAGACAGCTTTTGG - Intergenic
959377345 3:105602837-105602859 TCCTTTTGAAAGACAGCTCTTGG - Intergenic
959439508 3:106359179-106359201 TCCTTTTGAGAGACAACGCTTGG + Intergenic
959746015 3:109777276-109777298 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
959891827 3:111565090-111565112 TCCATTTGAGCTACTATTCTTGG + Intronic
959967433 3:112372951-112372973 TCCTTTTGAGAAACAGCTTTTGG - Intergenic
960197503 3:114787499-114787521 TCCATTTATATGACAACTCTTGG + Intronic
960349528 3:116575698-116575720 TCCTTTTGAGAGACAGCTCTTGG + Intronic
960494747 3:118360783-118360805 TCCTTTTGAGAGACTGCTCTTGG - Intergenic
961262847 3:125616420-125616442 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
961710980 3:128828005-128828027 TCCTTTCGAGAGACAGCTCTTGG - Intergenic
961841092 3:129712959-129712981 TTCATTTAAGAGACAACTGAAGG + Intronic
963319189 3:143794594-143794616 TCCTTTAGAAAGAAAACTCTTGG + Intronic
963331818 3:143923376-143923398 TCCTTTTGAGAGACAGATCTTGG - Intergenic
963453670 3:145516664-145516686 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
963572108 3:147010441-147010463 TTCATTTGAGAGAGAACAATGGG - Intergenic
963630308 3:147723217-147723239 TCCTTTTGAGAGACATCTTCTGG + Intergenic
964548474 3:157860711-157860733 TCCTTTTGAGAGTCAATCCTTGG + Intergenic
964679246 3:159318917-159318939 TCCTTTTGAGAGACAGCTCATGG - Intronic
965226768 3:166000767-166000789 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
965251333 3:166348270-166348292 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
965550572 3:169961133-169961155 TGAATTTCAGAGACAACCCTAGG + Intergenic
965708645 3:171534782-171534804 TCCTTTTGAGAAGCAGCTCTTGG - Intergenic
966044331 3:175530924-175530946 TCCTTTTGAGAGACAGCTCTTGG - Intronic
966445692 3:179998556-179998578 TCCTTTTGAGAGACAGCTCTTGG + Intronic
966480569 3:180403963-180403985 TTCTTTTGAGAAATAACTCTTGG + Intergenic
966763532 3:183438039-183438061 TCATTTTGAGAAACAGCTCTTGG + Intergenic
968800182 4:2738118-2738140 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
968906945 4:3457964-3457986 TCCTTTTGAAAGACAGCTCTTGG + Intergenic
970238024 4:13978450-13978472 TCCAGTTGACAGAAAAATCTAGG + Intergenic
970345883 4:15151536-15151558 TCTATTTGAAAGACCATTCTTGG - Intergenic
970816402 4:20161301-20161323 TCCTTTAGAGAGACAGCTTTTGG + Intergenic
971897539 4:32617002-32617024 TCCTTTTGAGTGACAGCTCTTGG + Intergenic
971979296 4:33732876-33732898 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
972094048 4:35326091-35326113 TCTTTTTGAGACACAACTCTTGG + Intergenic
972095492 4:35342686-35342708 TCCTTTTGAGAGAATGCTCTTGG + Intergenic
972805915 4:42529324-42529346 TCCTTTTGAGAGACAGCTCTTGG + Intronic
973098051 4:46226757-46226779 ACCTTTTGAGAGACAGCTCTTGG + Intergenic
973102924 4:46294749-46294771 TTTTTTTGAGAGACAGCTCTTGG + Intronic
973118441 4:46489040-46489062 TCCTTTTGAGAGGCAGCTCTTGG + Intergenic
973130191 4:46639698-46639720 TCCTTTTGAGAGATAGCCCTTGG - Intergenic
974262372 4:59542272-59542294 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
974557604 4:63471896-63471918 TCCTTTTGAGAGTTAGCTCTTGG + Intergenic
974644616 4:64674767-64674789 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
974746915 4:66088908-66088930 TCATTTTGAGAGACAGCTCTTGG - Intergenic
975024467 4:69531629-69531651 TCCTTTTGAGAGACAGCTCATGG + Intergenic
975051322 4:69868198-69868220 TCCTTTTGAGAGACAGATCTTGG + Intergenic
975386717 4:73767512-73767534 TTCTTTTGAGAGACAGCTTTTGG - Intergenic
975982616 4:80177280-80177302 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
976570151 4:86597835-86597857 TGCATTTGATAGCAAACTCTGGG - Intronic
977204715 4:94155681-94155703 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
977384912 4:96326533-96326555 TCCTTTTGAGAAACAGCTTTTGG + Intergenic
977430766 4:96928209-96928231 TCTTTTTGAGAGACAGCTTTTGG + Intergenic
977466000 4:97383371-97383393 TCCTTTTGAGAGACAACTCTTGG + Intronic
977490072 4:97700074-97700096 TCCTTTTGAGGGACAGCTCTTGG - Intronic
977535676 4:98254131-98254153 TACATTTGAAAGACAATTCATGG + Intergenic
977626277 4:99192657-99192679 TCCTTTTGAGAGATAGCTCTTGG - Intergenic
977701732 4:100029890-100029912 TCCTTTTGAGTGACAGCTCTTGG - Intergenic
977833276 4:101618171-101618193 TCCTTTTGAAAGACAGCTCTTGG - Intronic
977930413 4:102743822-102743844 TCCTTTTGAGAGACAGCTCTTGG - Intronic
978341591 4:107725552-107725574 TCCTTTTGAGAGACAGCTTGTGG - Intergenic
978455970 4:108891960-108891982 TCCATTTGATGGACAACTAAGGG + Intronic
978661919 4:111137338-111137360 GCCATTCAAGAGCCAACTCTTGG + Intergenic
978772153 4:112467783-112467805 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
978899076 4:113926821-113926843 TCCTTTTGAGGGACAGCTCTTGG - Intronic
979767019 4:124474592-124474614 TCCTTTTAAGAGACAGCTCTTGG + Intergenic
979888568 4:126062176-126062198 TTCTTTTGAGAGATAGCTCTTGG - Intergenic
979898403 4:126189060-126189082 TCCTTTTGAGAGAAAGCTCTTGG - Intergenic
980387948 4:132111184-132111206 TCCTTTTGAGAGACAACACTTGG - Intergenic
980405892 4:132353794-132353816 TCCTTTTGAGAGACAGCTTTTGG - Intergenic
980497527 4:133605365-133605387 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
980602159 4:135039517-135039539 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
980629522 4:135414283-135414305 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
980957730 4:139445914-139445936 TCCTTCTGAGAGACAGCTTTTGG + Intergenic
981835002 4:149043942-149043964 TCCTGTTGAGAGACAGCTCTTGG + Intergenic
981979356 4:150772607-150772629 TCCTTTTGAGAAACAACTCTTGG - Intronic
982597776 4:157407029-157407051 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
982623342 4:157732904-157732926 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
982835538 4:160116638-160116660 TCCTTTTGAGAGAGAGCTCTTGG + Intergenic
982847768 4:160274293-160274315 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
983027389 4:162755292-162755314 TCCTTTTTAGAGACAGCTCTTGG + Intergenic
983131541 4:164025784-164025806 TTCTTTTGAGAAAAAACTCTTGG - Intronic
983185063 4:164691572-164691594 TCCTTTCGAGAGACAGCTCTTGG + Intergenic
983582675 4:169324809-169324831 TTCTTTTAAGAGACAGCTCTTGG + Intergenic
984060285 4:174982027-174982049 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
984636371 4:182114714-182114736 CCCATTTTAGAGATAACACTAGG + Intergenic
986037034 5:3950440-3950462 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
986087108 5:4462715-4462737 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
986742918 5:10719503-10719525 TCCTTTTGAGAGACAGCTCTTGG + Intronic
986938332 5:12918753-12918775 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
987153175 5:15061663-15061685 CCCTTTTGAGAAACAGCTCTTGG + Intergenic
987468190 5:18296987-18297009 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
987504386 5:18749851-18749873 TCCTTTTGAGAGACAACTCTTGG + Intergenic
987578342 5:19758314-19758336 TCCTTTTGAGAGGCAGCTCTTGG - Intronic
987657138 5:20821654-20821676 TCTTTTTGAGAGACAGGTCTTGG - Intergenic
987678033 5:21100294-21100316 TACATTTTAGAAACAAATCTTGG + Intergenic
988056569 5:26105270-26105292 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
988079832 5:26401422-26401444 TCCTTTTGAGAGACAACTCTTGG - Intergenic
988107757 5:26772544-26772566 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
988160826 5:27516873-27516895 TCCTTTTGAGAGACAGATCTAGG - Intergenic
988188774 5:27901234-27901256 TCCTTTTAAGAGACAGCTCTTGG + Intergenic
988562129 5:32290845-32290867 TCCTTTTGAAAGACAGCTCTTGG + Intronic
988766413 5:34382294-34382316 TCTTTTTGAGAGACAGGTCTTGG + Intergenic
989045207 5:37267593-37267615 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
989097830 5:37797318-37797340 ACCTTTTGAGAGACAGCTTTTGG + Intergenic
989457642 5:41661770-41661792 TTCTTTTGAGGGACAGCTCTTGG - Intergenic
989486385 5:41996361-41996383 TCCTTTTGAGTGACAGCTCTTGG - Intergenic
989679027 5:44007551-44007573 TGCTTTTGAGAAACAGCTCTTGG - Intergenic
989862498 5:46396774-46396796 TCCTTTTGATAGAGAAGTCTTGG + Intergenic
990761100 5:59130376-59130398 TCCATTTGAGAGACAAGCCACGG + Intronic
991013808 5:61910902-61910924 TCCTTTTGAGAGACAGCCCTTGG - Intergenic
991033544 5:62105920-62105942 TTCTTTTGAGAGACAGCTCTTGG + Intergenic
991054169 5:62304774-62304796 TACATTAGATAGAAAACTCTAGG + Intergenic
991234166 5:64375161-64375183 TCCTTTTGAGAAACAGCTTTTGG + Intergenic
991330739 5:65489686-65489708 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
992101597 5:73412988-73413010 CCCATTCTAGAGACAACTATGGG + Intergenic
992242954 5:74789865-74789887 TCCTTTTGAGAAACAGTTCTTGG + Intronic
993231902 5:85247535-85247557 TCCTTTTAAGAGACAGCTCTTGG - Intergenic
993319826 5:86458576-86458598 TCTTTTTGAGAGATAGCTCTTGG + Intergenic
993791790 5:92218909-92218931 TCCTTTTGAAAGACAGTTCTTGG + Intergenic
994291375 5:98031973-98031995 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
994539521 5:101076926-101076948 TCCTTTTGAGGAGCAACTCTTGG + Intergenic
994855436 5:105113586-105113608 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
994984421 5:106915731-106915753 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
995269558 5:110205468-110205490 TCCTTTTGAGATATAGCTCTTGG - Intergenic
995427734 5:112043728-112043750 TCCTTTTGAGACAAAGCTCTTGG - Intergenic
995776287 5:115727681-115727703 TCTTCTTGAGAGACAGCTCTTGG - Intergenic
996018559 5:118567854-118567876 TCCTCTAGAGAGACAGCTCTTGG + Intergenic
996164957 5:120212510-120212532 TCCTTTTGCGAGACAGCTTTTGG - Intergenic
996277908 5:121690507-121690529 TACATAAGAGAGAAAACTCTAGG + Intergenic
996392203 5:122973787-122973809 TCCTTTTGAGAGACAGCTCTTGG - Intronic
996560332 5:124821354-124821376 ACCACTTCAGAGACAACCCTGGG + Intergenic
996825562 5:127677833-127677855 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
998290337 5:140908553-140908575 TCCTTTTGAGAGACAGCTCTTGG - Intronic
998631320 5:143901708-143901730 TCCTTTTGACAGACAAATCTGGG - Intergenic
999351384 5:150874843-150874865 TCCTTTTGAGAGACAGCTCTTGG + Intronic
999467330 5:151820128-151820150 TCCATCTGAGAGAAATCACTGGG - Intergenic
999766099 5:154742012-154742034 TCTATTTGAGACATATCTCTAGG - Intronic
1000223246 5:159234250-159234272 TCCTTTTGAGACACAGCTCTTGG - Intergenic
1000238880 5:159390475-159390497 TCCATATCAGAGAAGACTCTGGG + Intergenic
1000416972 5:160993900-160993922 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1001173594 5:169444641-169444663 TCCTTTTGAAAGACAGCTCTTGG + Intergenic
1002531389 5:179848126-179848148 TCCATTTGAGATGCACCTCAGGG + Intronic
1002593372 5:180306282-180306304 CCCATTTGAAAGACAATGCTAGG - Intronic
1003695899 6:8406141-8406163 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1003758606 6:9150080-9150102 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1003791219 6:9549990-9550012 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1004298587 6:14436671-14436693 TCCTTTTGAGAAACAGCTTTTGG + Intergenic
1004824289 6:19403237-19403259 TCTTTTTGAGAGACAGCTCTTGG - Intergenic
1005059553 6:21762938-21762960 TCGAATGGGGAGACAACTCTTGG + Intergenic
1005185167 6:23157071-23157093 TCCTTTTGAGAGACAGCTGTTGG + Intergenic
1005508112 6:26487904-26487926 TCCGTTTGAGAGAGAATTATTGG + Intergenic
1006001555 6:30969074-30969096 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1007921758 6:45616692-45616714 TGCATTTGGGAGAAAACTTTGGG + Intronic
1008266923 6:49439290-49439312 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1008400291 6:51055470-51055492 TCCTTTTGAGAAACAGTTCTTGG + Intergenic
1008642904 6:53483183-53483205 TCCATAAGAGAGACCACTATTGG + Intergenic
1008820397 6:55625151-55625173 TCCTTTTGAGAGATAGCTCCTGG + Intergenic
1009390112 6:63135079-63135101 TCTTTTTGAGAGACAGCTTTTGG - Intergenic
1009563203 6:65275240-65275262 TCCTTTTGAGAAACAGCTGTTGG + Intronic
1009660696 6:66606923-66606945 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1009770335 6:68136853-68136875 TCCTTTAGAGAGATAGCTCTTGG - Intergenic
1009851926 6:69208959-69208981 TCCTTTTGAGAGACAACTCTTGG - Intronic
1010323576 6:74540488-74540510 TCCTTTTGAGAGACACCTCTTGG + Intergenic
1010325331 6:74556600-74556622 TCCTTTTGAAAGACATCTCTTGG - Intergenic
1010579038 6:77571284-77571306 TCCATTTGGGAAACACATCTTGG + Intergenic
1010580754 6:77593906-77593928 CCCTTTTGAGAGACAGCTCTTGG - Intergenic
1010764760 6:79766052-79766074 TCCATTGGAGAAAAAATTCTAGG + Intergenic
1010818631 6:80388399-80388421 TCCTTTTGAGAGACAGCTCCTGG + Intergenic
1010854104 6:80815418-80815440 TCCTTTTTAGAGACATCTCTTGG - Intergenic
1010938246 6:81886418-81886440 TGCTTTTGAGAGACAGCTCTTGG - Intergenic
1011069100 6:83361664-83361686 TCCTTTTGAGAGACAGCTCCTGG + Intronic
1012344587 6:98170318-98170340 TCCTTTTGAGAGATAGCTGTTGG + Intergenic
1012730460 6:102874318-102874340 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1012920795 6:105219546-105219568 TCATTTTGAGAGACAGCTCTTGG - Intergenic
1013406670 6:109849801-109849823 TCCTTTTGAGAGACAGTTCTTGG + Intergenic
1014363398 6:120508355-120508377 TCCTTTTGAGAGAGAGCTCTTGG - Intergenic
1014416986 6:121195388-121195410 TACTTCTGAGAGACAGCTCTTGG + Intronic
1014534198 6:122596623-122596645 TCCTTTTGAGAGAGAGCTCTTGG - Intronic
1014895654 6:126896573-126896595 TCATTTTGAGAGACAGCTCTTGG + Intergenic
1015095451 6:129409602-129409624 TCCATTTGAGAGACAACTCTTGG - Intronic
1015443286 6:133272566-133272588 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1015475748 6:133657490-133657512 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1015648678 6:135427628-135427650 TCCAAATGACAGAGAACTCTGGG + Intronic
1015862092 6:137691840-137691862 TCCTTTTAAGAGACAGCTTTTGG + Intergenic
1016119916 6:140332693-140332715 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
1016144289 6:140649401-140649423 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1016147331 6:140692717-140692739 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1016174916 6:141069096-141069118 TCCTTTTGAAAGACAGTTCTTGG - Intergenic
1016419615 6:143870683-143870705 TTCTTTTGAGAGACAGCTCTTGG - Intronic
1016576259 6:145572588-145572610 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1016594550 6:145784879-145784901 TCTTTTTGAGAGACAGCTCTTGG + Intergenic
1017044070 6:150330855-150330877 TCGTTTTGAGAAACAGCTCTTGG - Intergenic
1017219195 6:151946201-151946223 TATATTTGAGAGCCAACTCTTGG + Intronic
1017227806 6:152041093-152041115 TCCTTGTGAGAGACAACTCTTGG - Intronic
1017388457 6:153912208-153912230 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1017977117 6:159368058-159368080 TCCTTTTGGGAGACAGTTCTTGG - Intergenic
1018122929 6:160655224-160655246 TCCTTTTGAGAGACAGCTATTGG - Intronic
1018535032 6:164810495-164810517 TCCTTTAGAGAGACCACTCTTGG - Intergenic
1018599885 6:165527525-165527547 TCCTTTTGAGAGACAGCTATTGG + Intronic
1018803793 6:167242992-167243014 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1019110981 6:169713700-169713722 ACCATTTGAAAGTCAAATCTTGG - Intronic
1020396716 7:7725513-7725535 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1020710348 7:11597624-11597646 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1021305093 7:19022528-19022550 TCCTTTTGAGAAATAGCTCTTGG - Intronic
1021370611 7:19840923-19840945 TTCATTAGATAGACAAATCTAGG + Intergenic
1021988808 7:26122921-26122943 TCCTTTTGAGTGACAGCTCTTGG + Intergenic
1022590598 7:31658025-31658047 TCAATTTGAGAAACAATACTTGG + Intronic
1022938119 7:35202221-35202243 TTCATCTGAGGGACAGCTCTTGG - Intergenic
1023711718 7:43000757-43000779 TCAATTTGAAAGACAACTGTTGG + Intergenic
1024040536 7:45550143-45550165 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1024060114 7:45691044-45691066 TCCAGTTGAGGGACACTTCTGGG + Intronic
1024486834 7:49928861-49928883 TCCTTTTGAGAAACAGCTTTTGG - Intronic
1024744206 7:52388442-52388464 CCTTTTTGAGAGACAGCTCTTGG + Intergenic
1024848586 7:53681312-53681334 TGCATTTGAGATGCATCTCTCGG + Intergenic
1024866102 7:53906342-53906364 TCCTTTTGAGAGACAGTTCTTGG + Intergenic
1027685796 7:81277953-81277975 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1028067442 7:86405022-86405044 TCCATTTCATAAATAACTCTGGG + Intergenic
1028141734 7:87281982-87282004 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1028237819 7:88382819-88382841 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1028880375 7:95873190-95873212 TCCCTTTGAGAGAGATGTCTTGG - Intronic
1028935012 7:96455061-96455083 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1030277457 7:107736112-107736134 TCCTTTTGAGAGACATATCTTGG + Intergenic
1030368752 7:108674025-108674047 TCCTTTTGAGAGACAGATCTTGG + Intergenic
1030457464 7:109793054-109793076 GTCTTTTGAGTGACAACTCTTGG - Intergenic
1030894978 7:115047938-115047960 TGAATTTGGGACACAACTCTAGG - Intergenic
1030931289 7:115525685-115525707 GCCTTTTGAGAGACAGCTCTTGG - Intergenic
1031236825 7:119188013-119188035 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1031676557 7:124618362-124618384 TTTTTTTGAGAGACAGCTCTTGG + Intergenic
1031761418 7:125717115-125717137 TCTTTTTGAGAGACAGCTTTTGG + Intergenic
1031886415 7:127250552-127250574 TCCATTTTAGAGTCAACTACAGG - Intronic
1032153105 7:129446960-129446982 TACTTTTGAGAGACAGCTCTTGG - Intronic
1032923472 7:136576118-136576140 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1033076256 7:138253043-138253065 TCCTTTTGAGAGGCAGCTCTTGG + Intergenic
1035879726 8:3232657-3232679 TCCAATTAAAAGACAATTCTGGG - Intronic
1035986750 8:4441758-4441780 TCCATTTGACTGACTAATCTTGG + Intronic
1037205206 8:16308989-16309011 TCCATTCGAGAAACAATTATGGG - Intronic
1037364594 8:18108272-18108294 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1037953616 8:23036099-23036121 TCCTTTTGAGAAACAGCTCTTGG + Intronic
1039626544 8:39060155-39060177 TCCTTTTGAGAAAAAACTATTGG - Intronic
1040911945 8:52528415-52528437 TGCTTTTGAGAGACAGCTCTTGG + Intergenic
1041934552 8:63321327-63321349 TCCTTTTGAGAGACAGCTCTCGG + Intergenic
1041986181 8:63924470-63924492 TCTTTTTGAGAGATAGCTCTTGG + Intergenic
1042001063 8:64123999-64124021 TCCTTTTGGGAGACAGCTCTTGG - Intergenic
1042342419 8:67694348-67694370 TCCTTCTGAGAGACAGCTCTTGG + Intronic
1044133755 8:88559031-88559053 CCCTTTTGAGAAACAGCTCTTGG + Intergenic
1044202388 8:89452485-89452507 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1044633156 8:94298409-94298431 TCCTTTTGAGAGGCAGCTCTTGG - Intergenic
1046128675 8:109941605-109941627 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1046197557 8:110884220-110884242 TCATTTTGAGGGACAGCTCTTGG + Intergenic
1046384812 8:113495454-113495476 TCCTTTTGATAAACAGCTCTTGG + Intergenic
1046417639 8:113937797-113937819 TCCTTTTGAGAGACAGGTCTTGG - Intergenic
1047109435 8:121772644-121772666 TCCATTTAAGACAAAACTTTCGG - Intergenic
1047453629 8:124989310-124989332 TCCTTTTGAAAGATAGCTCTTGG + Intergenic
1048281339 8:133107663-133107685 ACTATTTGGGAGACAACTTTTGG + Intronic
1048555560 8:135472456-135472478 TGCATTTCAGACACAGCTCTGGG - Intronic
1049939501 9:531592-531614 GTCATTTGAGATGCAACTCTTGG + Intronic
1050287379 9:4117789-4117811 TCCACATGAGAGTCCACTCTGGG - Exonic
1050482673 9:6102600-6102622 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1051342248 9:16122187-16122209 TCCATTTGGCAGAAAAATCTGGG - Intergenic
1051425922 9:16931360-16931382 TCCATTTGGGAAACATCTATTGG + Intergenic
1052048192 9:23819623-23819645 TTCCTTTGAAAGACAACTTTAGG - Intronic
1052227588 9:26108373-26108395 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1052240933 9:26272491-26272513 TCCATTTGGGAGACAAATTGAGG + Intergenic
1052368649 9:27640833-27640855 TCCTTTTGAGAGACAGCCCTTGG + Intergenic
1052442271 9:28512285-28512307 TCCTTTTGAGAGTCAGCTCCTGG - Intronic
1053610818 9:39711426-39711448 TCCTTTTGAGAAACAACTCTTGG + Intergenic
1053868854 9:42469448-42469470 TCCTTTTGAGAAACAACTCTTGG + Intergenic
1054087436 9:60759732-60759754 TCCTTTTGAGAAACAACTCTTGG - Intergenic
1054242704 9:62630969-62630991 TCCTTTTGAGAAACAACTCTTGG - Intergenic
1054556828 9:66665487-66665509 TCCTTTTGAGAAACAACTCTTGG - Intergenic
1055192196 9:73539006-73539028 TCCATTGGAAATAAAACTCTTGG + Intergenic
1055903942 9:81271207-81271229 TCCTTTTGAGAGATACCTCTTGG - Intergenic
1056156665 9:83845206-83845228 TCCTTTTAAGAGACAGCTCTTGG + Intronic
1056314235 9:85372948-85372970 TTCTTTTCAGAGACAGCTCTTGG - Intergenic
1056353873 9:85778321-85778343 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1056939287 9:90941431-90941453 TCCATGGGAGAGACAACCCATGG - Intergenic
1057058995 9:91986587-91986609 TCCTTTTGAAAAACAGCTCTTGG + Intergenic
1057423690 9:94931488-94931510 TCCATTTAAGGGAGAATTCTAGG - Intronic
1058019895 9:100076077-100076099 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1058544167 9:106042753-106042775 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1059082268 9:111262685-111262707 TCCATTTGAGCATCAAGTCTTGG - Intergenic
1060178779 9:121517314-121517336 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1186279494 X:7977115-7977137 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1186384095 X:9091765-9091787 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1186469768 X:9812112-9812134 TCCTTTTGAGATAAAGCTCTTGG - Intronic
1187604864 X:20871859-20871881 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1187850840 X:23590209-23590231 TCCATTTGAGAGATTATTGTTGG - Intergenic
1189154885 X:38746725-38746747 TCCTTTTGAGAGACAGTTCTTGG - Intergenic
1190255272 X:48757800-48757822 TCCTTTTGAGAAACAGCTCTTGG + Intergenic
1190527880 X:51346252-51346274 TCCTTTTGAGAAATAGCTCTTGG - Intergenic
1190601539 X:52097838-52097860 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1191134035 X:57044491-57044513 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1191630039 X:63312592-63312614 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1191631293 X:63324875-63324897 TCATTTTGAGAGACAGCTTTTGG + Intergenic
1191658806 X:63629810-63629832 TCCTTTTTAAAGACAGCTCTTGG - Intergenic
1191742541 X:64451312-64451334 TCCTTTTGAGAAACAGCTATTGG - Intergenic
1191769496 X:64740102-64740124 TCCTTTTGAGGGACAGCTTTTGG - Intergenic
1191946352 X:66539007-66539029 TCCTTTTGAGAGACTGCTCTTGG + Intergenic
1191946913 X:66544500-66544522 GCCATTTAAGAGCCAACTCCTGG + Intergenic
1192297712 X:69868020-69868042 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1192657638 X:73008976-73008998 CCCTTTTGAGAGACAATTCCTGG - Intergenic
1192661564 X:73047766-73047788 TCCTTTTGAGAAATAGCTCTTGG - Intergenic
1192673253 X:73168421-73168443 TTCTTTTGAGAGACAGCTCTTGG - Intergenic
1192824485 X:74681190-74681212 TCCTTTTGAGAAACAGCTTTTGG + Intergenic
1192881693 X:75291504-75291526 TCTATTTTAGACACAACGCTAGG - Intronic
1192898702 X:75471905-75471927 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1192996191 X:76515573-76515595 TCCTTTTCAGAAACAGCTCTTGG + Intergenic
1193053489 X:77125763-77125785 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1193297779 X:79852669-79852691 TCCTTTTGAGAAACAGTTCTTGG + Intergenic
1193447155 X:81618766-81618788 TTCCTTTGAGAGACAGCTCTTGG + Intergenic
1193573669 X:83174936-83174958 TCCTTTTTAGAGACAGCTCTTGG - Intergenic
1193914803 X:87351933-87351955 TCCATTTGAGAAACAGCTCTTGG - Intergenic
1193957283 X:87878205-87878227 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1194061703 X:89210750-89210772 TCCATTGGACAGACAATACTTGG + Intergenic
1194155337 X:90380936-90380958 TCCTTTTGAGAAACAGTTCTTGG - Intergenic
1194179592 X:90695940-90695962 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1194210277 X:91062349-91062371 TCCTTTTGAGAGACTGCTCTTGG + Intergenic
1194343309 X:92731079-92731101 TCCTTTTGAGAGACAGCCGTTGG + Intergenic
1194443548 X:93961098-93961120 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1194513419 X:94822257-94822279 TCCATTTGAGAGACAGCTCTTGG - Intergenic
1194589026 X:95773550-95773572 TATTTTTGAGAAACAACTCTGGG + Intergenic
1194833957 X:98658799-98658821 TCCTTTTGAGAGCGAGCTCTTGG + Intergenic
1194849247 X:98852179-98852201 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1195228468 X:102822266-102822288 TTCTTTTGAGAAACAGCTCTTGG + Intergenic
1195782354 X:108479870-108479892 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1196135970 X:112209848-112209870 TCCTTTTGCAAGACAGCTCTTGG - Intergenic
1197038379 X:121905042-121905064 GCCCTTTAAGAGACAAGTCTAGG - Intergenic
1197044413 X:121978320-121978342 CTCCTTTGAGAGACAACTCTTGG + Intergenic
1197084198 X:122453504-122453526 TCCCTTTGAGAGACAGCTCTTGG - Intergenic
1197097467 X:122612833-122612855 TCCTTTTGAGAGACAGGTTTTGG + Intergenic
1197245047 X:124158999-124159021 TCCTTTTGAGAGACAGCTCTTGG - Intronic
1197313341 X:124932973-124932995 ACCCTTTCAGAGGCAACTCTTGG - Intronic
1197372057 X:125637871-125637893 TCCTTCTGAGAGGCAGCTCTTGG - Intergenic
1197405086 X:126039193-126039215 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1197477360 X:126941334-126941356 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1198701299 X:139400291-139400313 TCCTTTTGAGAGACGGCTCTTGG + Intergenic
1198783041 X:140257802-140257824 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1198934039 X:141887874-141887896 TCCTTTTGAGAGACAGCTCTTGG + Intronic
1199024378 X:142919714-142919736 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1199040590 X:143111095-143111117 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1199144443 X:144348970-144348992 TCCTTTTGAGAAACAGCTCTTGG - Intergenic
1199310428 X:146314405-146314427 TCCTTTTGAGAGACAGCTCTTGG - Intergenic
1199818262 X:151419512-151419534 TCCATTTGACCTTCAACTCTGGG + Intergenic
1200289355 X:154857134-154857156 TCCTTTTGTGAGATAGCTCTTGG + Intronic
1200501686 Y:3957869-3957891 TCCTTTTGAGAAACAGTTCTTGG - Intergenic
1200521269 Y:4212025-4212047 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1200526254 Y:4278109-4278131 TCCTTTTGAGAGACAACTCTTGG - Intergenic
1200651668 Y:5847744-5847766 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1200715626 Y:6540054-6540076 TCCATTGGACAGACAATACTTGG + Intergenic
1200746059 Y:6904877-6904899 TCCTTTTGAGCGATAGCTCTTGG - Intergenic
1200973124 Y:9177715-9177737 TGCTTTGGAGAGACAGCTCTTGG - Intergenic
1200976628 Y:9218475-9218497 TCCTTTTGAGAGACAGCTCTTGG + Intergenic
1201281617 Y:12347525-12347547 TCAATTTGAGTGACAAATTTAGG - Intergenic
1201798426 Y:17926694-17926716 TCCTATTGAGAGACAGCTCTTGG + Intergenic
1201803127 Y:17979263-17979285 TCCTATTGAGAGACAGCTCTTGG - Intergenic
1202137954 Y:21686798-21686820 TGCTTTGGAGAGACAGCTCTTGG + Intergenic
1202358014 Y:24072478-24072500 TTCTTTGGAGAGACAGCTCTTGG - Intergenic
1202359746 Y:24095384-24095406 TCCTATTGAGAGACAACTCTTGG + Intergenic
1202511032 Y:25574730-25574752 TCCTATTGAGAGACAACTCTTGG - Intergenic
1202512764 Y:25597635-25597657 TTCTTTGGAGAGACAGCTCTTGG + Intergenic