ID: 1015095453

View in Genome Browser
Species Human (GRCh38)
Location 6:129409629-129409651
Sequence AGTGATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015095449_1015095453 15 Left 1015095449 6:129409591-129409613 CCAGTAACAGGCCAAGAGTTGTC 0: 17
1: 171
2: 183
3: 131
4: 176
Right 1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG No data
1015095447_1015095453 22 Left 1015095447 6:129409584-129409606 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG No data
1015095448_1015095453 16 Left 1015095448 6:129409590-129409612 CCCAGTAACAGGCCAAGAGTTGT 0: 17
1: 184
2: 186
3: 148
4: 230
Right 1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG No data
1015095451_1015095453 4 Left 1015095451 6:129409602-129409624 CCAAGAGTTGTCTCTCAAATGGA 0: 2
1: 18
2: 203
3: 201
4: 332
Right 1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015095453 Original CRISPR AGTGATCTGCAGAAGATGGC AGG Intronic
No off target data available for this crispr