ID: 1015102805

View in Genome Browser
Species Human (GRCh38)
Location 6:129501190-129501212
Sequence ACTGAGATCTTAAGCTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015102804_1015102805 4 Left 1015102804 6:129501163-129501185 CCAATTCTATTAATAGAAGTATT 0: 1
1: 0
2: 1
3: 27
4: 362
Right 1015102805 6:129501190-129501212 ACTGAGATCTTAAGCTACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1015102803_1015102805 5 Left 1015102803 6:129501162-129501184 CCCAATTCTATTAATAGAAGTAT 0: 1
1: 0
2: 3
3: 51
4: 469
Right 1015102805 6:129501190-129501212 ACTGAGATCTTAAGCTACAGAGG 0: 1
1: 0
2: 0
3: 4
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015102805 Original CRISPR ACTGAGATCTTAAGCTACAG AGG Intronic
901036955 1:6342010-6342032 ACTAAGACCCAAAGCTACAGAGG - Intronic
907550601 1:55301537-55301559 ACTGTTATCTTAAGCCACACAGG - Intergenic
912184212 1:107255188-107255210 TCTGAAATCTCAAGCTACAGAGG - Intronic
913287140 1:117236833-117236855 ACAGAGAACTTGAACTACAGTGG - Intergenic
913508118 1:119537956-119537978 CCTGTGATCTTAAACTAGAGTGG - Intergenic
918420508 1:184359941-184359963 GCTGTGTTCTGAAGCTACAGAGG - Intergenic
921427423 1:215020727-215020749 ATTGAGATCTAAAGGTACTGTGG - Intronic
924645390 1:245872699-245872721 CCTGAGATCTAAAGCTAAATGGG - Intronic
1063568678 10:7194603-7194625 AATGAAATTTGAAGCTACAGAGG + Intronic
1064078328 10:12287991-12288013 AGTGAGGTCTTGAGCAACAGAGG - Intergenic
1065888932 10:30104091-30104113 ACTGAGAAGTTAACTTACAGAGG + Intronic
1065985566 10:30948033-30948055 ACTGAGATCTCCAGCTGCGGAGG - Intronic
1066054830 10:31671087-31671109 ACTGAGTTCTAAAGAGACAGAGG + Intergenic
1069121217 10:64571847-64571869 ACAGGGATCTTCAGCTATAGTGG - Intergenic
1069493425 10:68881076-68881098 GATGAGATCTGAAGCTAGAGTGG - Intronic
1081056757 11:38418683-38418705 TCTACGATCTTAAGCTACACGGG - Intergenic
1084057022 11:66641015-66641037 TCTGAGGTCTGAAGCAACAGTGG + Intronic
1086562155 11:88179997-88180019 AATGAGATCTACAGCTATAGGGG + Intergenic
1087086044 11:94219739-94219761 ACAGAGATCATATGCTTCAGAGG + Intergenic
1089549686 11:119263441-119263463 ACTGAATTCTAAAGCTAAAGGGG - Intronic
1091051719 11:132378621-132378643 ACTGACACCTTAAGCTCCATTGG - Intergenic
1099250028 12:80243183-80243205 AATGACACCTTAACCTACAGAGG + Intronic
1101466252 12:104952883-104952905 GCTGAGATCTTAAGCTGAATAGG - Intronic
1101530299 12:105567442-105567464 ACTCAGAACTTAAACTCCAGTGG - Intergenic
1102431825 12:112889893-112889915 AGTGGGTTCTTAAGCTACTGTGG - Intronic
1104104250 12:125644205-125644227 TCTGAGATCTCAATCTGCAGGGG - Exonic
1109920092 13:69045328-69045350 AGTGAGAAGTTAAGCGACAGAGG - Intergenic
1110723218 13:78789017-78789039 ACTGAGATCCTACGATAAAGAGG - Intergenic
1112253006 13:97801225-97801247 GATGAAATCTTAAGCTAAAGAGG + Intergenic
1112603160 13:100877019-100877041 ACTAAACTCTTAAGCTATAGAGG - Intergenic
1115190630 14:30743997-30744019 GTTGAGAAGTTAAGCTACAGAGG + Intergenic
1119500412 14:75122165-75122187 ACTGAGTTATTAAGTTGCAGGGG - Intronic
1120560648 14:85988355-85988377 GCAAATATCTTAAGCTACAGAGG - Intergenic
1121019296 14:90569323-90569345 ACTGTGATCACAATCTACAGAGG + Intronic
1123912184 15:24978620-24978642 GATGAGATCTTAAGTTACTGTGG + Intronic
1125418563 15:39478762-39478784 ACTGAGAACTTAGCCTCCAGAGG - Intergenic
1130930441 15:88422986-88423008 ACTGACATCCTAAGGTACTGGGG - Intergenic
1133246580 16:4453033-4453055 CCTAAGAACTTAAGCAACAGTGG + Intronic
1142646316 17:1315952-1315974 ACTGAGGTCTCAGGGTACAGAGG + Intergenic
1145880420 17:28348862-28348884 ACTGAGGACTTAGGCTAAAGAGG - Intronic
1147494016 17:40898541-40898563 ACTGAGATATTAATATACAGAGG + Intergenic
1147935111 17:44006688-44006710 ACTGAGCTCTTTAGCAACAAGGG + Exonic
1150098761 17:62403145-62403167 ACTGAGATCTGAAACTCAAGTGG - Intronic
1153461669 18:5341163-5341185 ATTGAGATCTTTATCTGCAGAGG - Intergenic
1158639619 18:59192506-59192528 ACAGAGACCTCAAGCCACAGTGG + Intergenic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
925874722 2:8302045-8302067 ACTGAGAACTTAACCTACTCAGG + Intergenic
933562985 2:83912578-83912600 ACTGAAATTTTGAGCCACAGAGG + Intergenic
935176278 2:100652203-100652225 ACTGAGATGTGAACCTGCAGGGG + Intergenic
937392689 2:121504663-121504685 ACTTAGAGCATAAGCTCCAGAGG - Intronic
937801309 2:126083453-126083475 ACTGAGATCTTAAGGCACCTTGG - Intergenic
938640954 2:133279232-133279254 AGTGACATTTTAAGCAACAGTGG - Intronic
945228692 2:207560568-207560590 ACTAATTTCTTAAGCTGCAGAGG + Intronic
1174072194 20:47907051-47907073 ACAGAGCTCTTAAGCTCCAAGGG - Intergenic
1174146809 20:48458117-48458139 ACAGAGCTCTTAAGCTCCAAGGG + Intergenic
1178012637 21:28305039-28305061 ACTGACATCTCAAGCAACACTGG - Intergenic
1178347911 21:31847907-31847929 ACTGAGCTCTTCAGCTCCCGGGG - Intergenic
950531168 3:13553065-13553087 ACTGTGATATGAAGGTACAGGGG + Intronic
952607009 3:35160123-35160145 ACTGAGATCTTAATTTAAAAAGG + Intergenic
952935511 3:38395416-38395438 GCAGAGTTCTTCAGCTACAGAGG - Intronic
953673026 3:44978405-44978427 ACTGAGTCCTGAAGATACAGAGG - Intronic
955784816 3:62526161-62526183 ACTCAAATCTTAATCTACAAGGG + Intronic
957710108 3:83846286-83846308 AATGAGACCTAAAGCTTCAGAGG - Intergenic
958270831 3:91497070-91497092 ACTGTGATTTTAAGCTATATTGG - Intergenic
961126573 3:124424081-124424103 GCTGACCTCTTAAGCTTCAGTGG - Intronic
966323368 3:178726815-178726837 GCTGTGATCTTGAGCTACATTGG - Intronic
970635031 4:17999766-17999788 ACTGAGATTTTAAGGAACATTGG - Intronic
970840830 4:20466657-20466679 ACTCAGATCATAAGCAGCAGTGG + Intronic
971037717 4:22713072-22713094 ACAGATATAGTAAGCTACAGAGG + Intergenic
975408570 4:74021513-74021535 AGTTAGATGTTAAGTTACAGAGG - Intergenic
976268795 4:83209795-83209817 ACTGAGATCTGAAGCACGAGTGG - Intergenic
978228383 4:106366760-106366782 ATTGAGATATTAAACTTCAGAGG - Intergenic
978453221 4:108859678-108859700 ACTGAGATCATAGACTACAACGG - Exonic
979321370 4:119328795-119328817 GCTGAGACCTGAAGCAACAGAGG - Intergenic
979459814 4:120969305-120969327 AGCCAGATCTTAAGCTATAGTGG + Intergenic
980263020 4:130478674-130478696 ACTGAAATCTTTAGCCACTGAGG - Intergenic
981204574 4:142024465-142024487 ACTGTGATCATCAGTTACAGAGG - Exonic
981700591 4:147603111-147603133 ACTGAGCACTTAAGTTACTGTGG - Intergenic
982024576 4:151238693-151238715 ACTGAGATTTTTATCCACAGTGG + Intronic
982577743 4:157136953-157136975 ACTGACATCTTAGACAACAGTGG + Intronic
985870401 5:2549686-2549708 CCTGAGAGCTAAAGCTAAAGTGG + Intergenic
988169220 5:27632974-27632996 ACTGACATCTTAAGCACCATTGG + Intergenic
989060309 5:37404279-37404301 ACTCAGATCATAATCTGCAGAGG - Intronic
989464735 5:41741565-41741587 AGTGAGATGTTAAGCTACTAAGG - Intronic
990748492 5:58985532-58985554 ACTGAGAGCTTAAGGCACATGGG - Intronic
992131161 5:73694205-73694227 ACTGAGATGATAAGCTTCTGGGG + Intronic
996310148 5:122095424-122095446 ATTGAGATTTTCAGCTGCAGAGG + Intergenic
997237237 5:132279915-132279937 ACTCAGATCCAAAGCTTCAGGGG - Intronic
1003027235 6:2565750-2565772 ACTGAGGCCTTGAGCTACTGCGG + Intergenic
1003631674 6:7793204-7793226 AATGAGCTTTCAAGCTACAGAGG + Intronic
1005221510 6:23593756-23593778 ACTGAGTTCTCTAGCTACTGGGG - Intergenic
1005703543 6:28428822-28428844 ACTGATCTCTTCAGCTACCGGGG + Intergenic
1007395151 6:41573514-41573536 ACTGAGTTCTTAAGCTTGAGGGG + Intronic
1009172368 6:60417140-60417162 ACTGTGATTTTAAGCTATATTGG + Intergenic
1012791755 6:103707733-103707755 AGTGTTATCTTAGGCTACAGTGG - Intergenic
1014014660 6:116516465-116516487 ACTGAGATCTTCAGATCCTGAGG - Exonic
1014014837 6:116518243-116518265 ACTGAGCTCTTAACCTGCTGGGG + Exonic
1015102805 6:129501190-129501212 ACTGAGATCTTAAGCTACAGAGG + Intronic
1015263380 6:131263848-131263870 ACTCTGATCCTAAGCTACTGTGG + Intronic
1015908711 6:138145131-138145153 ATTAAAATCTTAAGCTACTGTGG + Intergenic
1018095626 6:160384927-160384949 CCTGAGAGCATAAGCCACAGAGG - Intronic
1020087663 7:5320271-5320293 ACTGAGATGTTAGGCGGCAGGGG + Intronic
1021040850 7:15860066-15860088 ACTGATATCTTAAACTACCCAGG + Intergenic
1022954879 7:35371835-35371857 ACTGAGGTCTTTAGCCACAAAGG - Intergenic
1024400298 7:48916938-48916960 AGTGAGATGTTAAGCTTGAGTGG - Intergenic
1028037187 7:85999504-85999526 ACAGGGATCTTAAGATCCAGTGG + Intergenic
1030594060 7:111515219-111515241 ACTGAGATATTAATTTACAGTGG - Intronic
1031448022 7:121878943-121878965 ACTGAGATCATAATCAAAAGAGG - Intronic
1035075657 7:156175631-156175653 ACTGATTTATTAAGCTTCAGTGG - Intergenic
1038482357 8:27910409-27910431 ACAGAGATAGTAAGCCACAGCGG + Intronic
1042530477 8:69809991-69810013 AGTGAGTTCTCCAGCTACAGAGG + Intronic
1044783062 8:95763287-95763309 AGTGAGATCTGAAAATACAGTGG - Intergenic
1045451373 8:102329854-102329876 GCTAAGTTCTTAAGTTACAGTGG - Intronic
1047838589 8:128721443-128721465 AATAACATCTTAAGCTTCAGTGG + Intergenic
1050395789 9:5194735-5194757 AATCAGATCTTCAGCTATAGTGG + Intergenic
1051915565 9:22202821-22202843 ACTGTGATCATAAGCTACTCAGG + Intergenic
1058215610 9:102229921-102229943 ACTAAGTTTTTAAGCTACAAAGG + Intergenic
1186342879 X:8662126-8662148 AGTGAGATCTTGGGCTTCAGGGG - Intronic
1187629826 X:21156817-21156839 AGTGGGATGTTAGGCTACAGAGG + Intergenic
1190755687 X:53399902-53399924 ACTTAGTTCTTCAGCTTCAGGGG - Intronic
1190846206 X:54193356-54193378 TCTCAAATCTTAAGTTACAGTGG + Exonic
1195446653 X:104959719-104959741 AATGAAATCTTAAGGTAGAGGGG - Intronic
1196556185 X:117087207-117087229 ACAGAGATCTGAAGCTAGAATGG - Intergenic
1197584903 X:128334362-128334384 ACTGAGTTCTGAAGCAACTGGGG + Intergenic