ID: 1015104156

View in Genome Browser
Species Human (GRCh38)
Location 6:129516910-129516932
Sequence CTTTTTATGCTGAAGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015104152_1015104156 22 Left 1015104152 6:129516865-129516887 CCAAGTTCATTATTAGAGAGTTT No data
Right 1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG No data
1015104151_1015104156 23 Left 1015104151 6:129516864-129516886 CCCAAGTTCATTATTAGAGAGTT No data
Right 1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG No data
1015104153_1015104156 -7 Left 1015104153 6:129516894-129516916 CCGTATGAGTGAATAGCTTTTTA No data
Right 1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG No data
1015104150_1015104156 28 Left 1015104150 6:129516859-129516881 CCTGACCCAAGTTCATTATTAGA No data
Right 1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015104156 Original CRISPR CTTTTTATGCTGAAGGTAGA GGG Intergenic
No off target data available for this crispr