ID: 1015110059

View in Genome Browser
Species Human (GRCh38)
Location 6:129582528-129582550
Sequence GTATCTACTAAGTCAAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015110059 Original CRISPR GTATCTACTAAGTCAAGGTA GGG Intronic
908484981 1:64582688-64582710 GTATCTACTAAAGTAAGGAATGG - Intronic
909747322 1:79113499-79113521 GTATCTAATTAGTCAATGCAGGG + Intergenic
911868185 1:103055230-103055252 GTATCTAACAAGTACAGGTATGG - Intronic
913718097 1:121559758-121559780 GTATCTAAAAATTCAAAGTATGG + Intergenic
915027959 1:152850752-152850774 GTATCTTGTAAGCCAAGCTATGG - Intergenic
916989947 1:170232233-170232255 GTATCTACTAATTTAATGAAAGG + Intergenic
917190979 1:172418521-172418543 GTTTCAACTAAAACAAGGTAAGG + Intronic
919447322 1:197724450-197724472 GTATCTACAAAGCCTAGGAATGG + Intronic
922771382 1:228185409-228185431 GTATCTACTGAGGCCAGGTATGG - Intergenic
924259058 1:242211319-242211341 CAAGCTACTAACTCAAGGTAAGG - Intronic
1064980784 10:21164683-21164705 GTATCTTTTAAGTCATTGTAGGG - Intronic
1069020433 10:63481657-63481679 GTATCTACTAAGTGAGGTTATGG - Intergenic
1072346247 10:94509654-94509676 GTATCTGCCAGGTCTAGGTATGG - Intronic
1073683130 10:105726609-105726631 GAATCTAGAAAGGCAAGGTAGGG + Intergenic
1075538350 10:123290607-123290629 CTATCTAGTAAGTGAATGTAAGG - Intergenic
1079461546 11:20684113-20684135 ATATTTACTAAGGCCAGGTATGG + Intronic
1080367246 11:31589587-31589609 GTTTCTACTATGTCAAGATCTGG + Intronic
1082211375 11:49506584-49506606 GTATATACTAAGTAATGGGATGG + Intergenic
1082942710 11:58725429-58725451 GTAACTTCTAAGTGAAGGTAGGG + Intronic
1083898144 11:65630588-65630610 TCACCTACTATGTCAAGGTACGG + Exonic
1085035053 11:73294751-73294773 GTACCTACTAAGTAAGGTTATGG - Intronic
1092476397 12:8822572-8822594 TTATATACTAATTCCAGGTAGGG - Exonic
1094403696 12:30091412-30091434 CTATCTGCAAAGTCAAGATATGG + Intergenic
1101641632 12:106589346-106589368 GCATTTACTAAGAGAAGGTATGG + Intronic
1110242467 13:73284120-73284142 TTATCTACTTAGCCCAGGTAAGG - Intergenic
1115354225 14:32430467-32430489 GAAACTCCTAAGTCAAGGCAGGG - Intronic
1119636401 14:76277003-76277025 CTATCTCCTAAGTCCAGGTCTGG - Intergenic
1138173244 16:54872635-54872657 GTGTCTAGTAAGTCTAGGTTTGG + Intergenic
1140743764 16:77963599-77963621 TTTTCTACGAAGTGAAGGTAAGG - Intronic
1140804798 16:78523284-78523306 GTATATATAAATTCAAGGTAAGG + Intronic
1144124328 17:12188499-12188521 GTATCTACCAAGTCAACATCTGG + Intergenic
1152120784 17:78417046-78417068 GTATGTACTAAGTGGAGGGAGGG - Intronic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1155110069 18:22706057-22706079 GTATATACTCAGTAAAGGGATGG - Intergenic
1155811128 18:30236578-30236600 TTCTCTACTAAGTCAAGTAATGG - Intergenic
1159607598 18:70491527-70491549 GTTCCTACTAAGTGAAGGAACGG + Intergenic
1160111434 18:76035716-76035738 TTACCTACTAAGTGAAGGGAAGG - Intergenic
1160307258 18:77751489-77751511 GTATCTTTTAAGTCAAGATTAGG + Intergenic
930332058 2:49997574-49997596 GTATCTACTAGTGCAAGGTAAGG + Intronic
930572402 2:53103503-53103525 GTATCTGTTAAGTAAAGGTCAGG + Intergenic
931336643 2:61351493-61351515 CTAACTACTAAATCAAGATAGGG + Intronic
932211050 2:69930860-69930882 GTATTGACTGAGACAAGGTATGG - Intronic
932369006 2:71172488-71172510 GTATCTAGTGGGTCAAGGTCAGG - Intergenic
932860661 2:75287916-75287938 TTATCCACTAATTCAAGTTAAGG - Intergenic
937568717 2:123330973-123330995 GTATCTATTAAATCAATGTCTGG - Intergenic
940787377 2:157996260-157996282 GTATCTCCTCACTAAAGGTATGG - Intronic
941575908 2:167229941-167229963 GTATCTACTTAGGCATGGAAAGG + Intronic
1169974650 20:11311051-11311073 GTATCCACTGAGAAAAGGTATGG + Intergenic
1174568438 20:51484033-51484055 GGATCTTCTGAGTCATGGTAAGG - Intronic
1177608640 21:23416617-23416639 TTATTTACTAAATCAATGTAAGG - Intergenic
956128223 3:66031247-66031269 GTATATACAAACTCAAGGAAAGG + Intronic
960450765 3:117804825-117804847 GTTTCTACTCAGTCAAGAAAGGG - Intergenic
970000605 4:11362282-11362304 ATAATTACTAAGTAAAGGTATGG - Intergenic
971599536 4:28574859-28574881 ATATCTATTAAGTCAGGTTAAGG - Intergenic
977911375 4:102541127-102541149 GCATCTAGTGAGTCAAGGTCAGG - Intronic
980456305 4:133047712-133047734 GAATCAACCAAGTCAAGGAAAGG + Intergenic
985524859 5:396671-396693 GTATGTAATAAATAAAGGTATGG + Intronic
987475927 5:18392543-18392565 GTCCCTTGTAAGTCAAGGTAGGG - Intergenic
988883103 5:35526217-35526239 GTATCTACTAAGTAGAGGCCAGG - Intergenic
989367656 5:40674911-40674933 GTATCTGATAAGTCAAGCAAAGG + Intergenic
989717305 5:44479401-44479423 ATATGTAGTAAGTCAAGCTAAGG + Intergenic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993646643 5:90471416-90471438 GTATGTACTATGTCAATTTAAGG + Intronic
995182256 5:109239906-109239928 GGAGCTACTCAGTCATGGTATGG - Intergenic
1002335469 5:178475000-178475022 GGATCTACAAAGCCAAGGAATGG - Intronic
1006057726 6:31397987-31398009 GAAGCTATTAACTCAAGGTAAGG - Intergenic
1007106069 6:39283841-39283863 GTATTTATCAAGTCAAGGAAGGG - Intergenic
1007273581 6:40657130-40657152 CTATCTAGCAAGTCAAGGGAAGG - Intergenic
1012182721 6:96175309-96175331 GTCTTTACTGAGTAAAGGTAAGG + Intronic
1014053802 6:116989360-116989382 GTATCTACTAAGTACAGGCTAGG + Intergenic
1015110059 6:129582528-129582550 GTATCTACTAAGTCAAGGTAGGG + Intronic
1018212543 6:161496340-161496362 GGATGTAATTAGTCAAGGTAAGG + Intronic
1021426992 7:20511707-20511729 GAATATACTAAGTCAAGATGAGG + Intergenic
1026622779 7:71964952-71964974 GTCTCTACTAACTCAAAGTCTGG - Intronic
1032563434 7:132915754-132915776 GTATCTGCTAAGTCAGGGATAGG - Intronic
1035632549 8:1119805-1119827 CACTCTCCTAAGTCAAGGTAGGG - Intergenic
1036108699 8:5874545-5874567 GGAGCTATTTAGTCAAGGTAAGG + Intergenic
1044665809 8:94633431-94633453 TTATCTTTTAAGTCAAGGTGGGG - Intergenic
1044840195 8:96330664-96330686 ATATCTACTAAATGAAGGTCAGG - Intronic
1047832645 8:128653080-128653102 GTATCTACTAAGTAAAGTATAGG + Intergenic
1048472743 8:134718006-134718028 GTTTTTACAAAGTTAAGGTATGG + Intergenic
1055380504 9:75701605-75701627 GTATCTACCCAGTAATGGTATGG + Intergenic
1059597264 9:115734843-115734865 GTATGTCCTAACTCAAGGCAAGG + Intergenic
1061340106 9:129973386-129973408 GTGTTTACTAAGTCAAGTCAGGG + Intronic
1189127014 X:38459555-38459577 GTATATACTAAGAGAAGGGAAGG - Intronic
1191699458 X:64024025-64024047 ATATCTACTAAGTCAAGGTCAGG - Intergenic