ID: 1015110065

View in Genome Browser
Species Human (GRCh38)
Location 6:129582622-129582644
Sequence GATTATGTCCTGAGGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 6, 3: 19, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015110065_1015110069 15 Left 1015110065 6:129582622-129582644 CCAAGTGCCCTCAGGACATAATC 0: 1
1: 0
2: 6
3: 19
4: 172
Right 1015110069 6:129582660-129582682 ACTCTCAGTCTCTGCACTAGTGG 0: 1
1: 0
2: 3
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015110065 Original CRISPR GATTATGTCCTGAGGGCACT TGG (reversed) Intronic
901655035 1:10764465-10764487 GATCATGTGCGTAGGGCACTTGG - Intronic
905499001 1:38420952-38420974 AATGATGTCCTCAGGGCACCAGG - Intergenic
908064625 1:60389424-60389446 GATTTTATCCTGAGTGCAGTGGG - Intergenic
910667189 1:89738576-89738598 GAATTGGTCCTGAGGTCACTGGG - Intronic
913377474 1:118168994-118169016 GATTTTATCCTGTGGGAACTGGG + Intronic
917933473 1:179840591-179840613 GATTATGTTCTCAGGCCATTTGG + Exonic
920006435 1:202836731-202836753 AACTATGCCCTGAGGCCACTGGG - Intergenic
921559804 1:216643742-216643764 GATTCTGTTCTGAGGGAACCAGG - Intronic
922998819 1:229988521-229988543 GAGGGTTTCCTGAGGGCACTGGG - Intergenic
924910071 1:248500540-248500562 GATGATATCCTGTGGCCACTGGG + Intergenic
924914033 1:248547515-248547537 GATGATATCCTGTGGCCACTGGG - Intergenic
1063620704 10:7645716-7645738 GATTTTGTCCTGAAGAGACTAGG - Intronic
1067910104 10:50337953-50337975 GATTATATGCTGAGAGAACTAGG - Intronic
1069784065 10:70976924-70976946 GCTTTTGTCCTTAGGGCCCTGGG + Intergenic
1070647599 10:78212485-78212507 GGGGATGTCCTGAGGGCTCTGGG + Intergenic
1073039299 10:100590139-100590161 GCATATGTCCTATGGGCACTTGG - Intergenic
1075098773 10:119491020-119491042 GATTAGGTCATGAAGGCTCTGGG + Intergenic
1077864131 11:6209257-6209279 AATTTTGTCCTGAAGGCAGTGGG - Intronic
1077965430 11:7126971-7126993 GTATATGTTCTGTGGGCACTTGG + Intergenic
1078856405 11:15209107-15209129 GATTTTGTCCAGTGGGAACTAGG - Intronic
1079110598 11:17603041-17603063 GACTTTATCCTGAGGGCAATGGG + Intronic
1083573337 11:63771646-63771668 CAGTTTGTCCTGAAGGCACTGGG + Intergenic
1084953238 11:72678159-72678181 GCCTTTATCCTGAGGGCACTGGG - Intergenic
1085022924 11:73220272-73220294 GATTTTATCCTGAAGGCAATAGG + Intronic
1085730600 11:78995315-78995337 GATTTTGTCCTGAGGGCAATGGG + Intronic
1086209335 11:84299470-84299492 GATTAATTCATGAGGGCCCTAGG + Intronic
1086509995 11:87545888-87545910 CATTATGTTCTGAGGGCAAGTGG - Intergenic
1087250996 11:95899904-95899926 GATTATGTTCTGAGGACAATGGG + Intronic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1089829187 11:121310376-121310398 GATTAAGTCATGAGGGCTCTGGG + Intergenic
1091667524 12:2430171-2430193 GATTAGGTCATGAGGGCAGAAGG - Intronic
1091750757 12:3020079-3020101 GATCGTGTCCTGAAGGCACCAGG - Intronic
1092767122 12:11862748-11862770 GATCACATCCTGAGGGTACTAGG + Intronic
1093625557 12:21343007-21343029 GGGTATGTCCTGTGGGCAGTAGG + Intronic
1095547571 12:43389492-43389514 GATTGGGTCCTCAGGGCTCTAGG + Intronic
1097705738 12:62866527-62866549 TACTATGTCATGAGGGCACACGG + Intronic
1100331021 12:93582314-93582336 GAATTTATCCTGAGGGCAGTAGG + Intronic
1100777870 12:97992120-97992142 GATTTTGTCTTTAGGGCAATGGG - Intergenic
1102404836 12:112664297-112664319 GATTATGTCATGAAGGCAATGGG + Intronic
1103299461 12:119916929-119916951 GCTTCTGACCTGAGGGTACTTGG + Intergenic
1103895807 12:124272434-124272456 GATGATGTCCTGGAGGCTCTGGG - Intronic
1103940686 12:124499747-124499769 GATTTTGTTCTCAGGGCAGTGGG + Intronic
1104747604 12:131219893-131219915 GACCAGGACCTGAGGGCACTGGG - Intergenic
1104785216 12:131444482-131444504 GACCAGGACCTGAGGGCACTGGG + Intergenic
1105356533 13:19664443-19664465 GAGTTCGTCCTGAGGGCACTGGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107388882 13:39942644-39942666 GGCTATGTCCTGAGGGCCATGGG + Intergenic
1107606506 13:42062674-42062696 GATTATGTCCTGACCTCACAAGG - Intronic
1108118069 13:47151956-47151978 GATGAAGTCCTGAGGATACTAGG - Intergenic
1108411002 13:50146843-50146865 GATGAAGTCCTGAGTCCACTGGG + Intronic
1110157156 13:72331358-72331380 GATTTTATTCTGAGGGCAGTTGG + Intergenic
1110792153 13:79598487-79598509 GATTTTATCCTAAGGGCATTGGG - Intergenic
1111845682 13:93506046-93506068 GGTTATGTCCTGTGACCACTAGG + Intronic
1114862742 14:26545549-26545571 GATTTTATCCTGAGGACAATGGG + Intronic
1118752580 14:68817539-68817561 GATGAGGTCCTGAGGGGAATGGG + Intergenic
1119854176 14:77886981-77887003 AAATCTGTCCTGGGGGCACTAGG + Intronic
1121380572 14:93462413-93462435 GATTTTGTCCTGAAGACAGTGGG + Intronic
1122939364 14:104974352-104974374 GGCTTTGTCCTGAGGGCACCGGG - Intronic
1124208564 15:27743734-27743756 GATTATGTCCAGATAGCACACGG + Intergenic
1129666959 15:77584740-77584762 GACTTTGTCCTGAGGGAAATGGG - Intergenic
1131756061 15:95563921-95563943 GATTTTATCCTGAGGGCACTAGG + Intergenic
1133820088 16:9228216-9228238 GACTTTATCCTGAGGGCAATGGG + Intergenic
1134759469 16:16701254-16701276 GATTTTATCCTGAGCGCAATGGG - Intergenic
1134859580 16:17549134-17549156 GATTACATCCTGATGGTACTGGG + Intergenic
1134986601 16:18657940-18657962 GATTTTATCCTGAGCGCAATGGG + Intergenic
1138622588 16:58223740-58223762 GATCATGTACGGAAGGCACTGGG - Intergenic
1140911008 16:79452814-79452836 GATTACCTCTTGAGTGCACTTGG + Intergenic
1141015414 16:80444436-80444458 GATGATGCCCTGACAGCACTGGG - Intergenic
1149485038 17:57036084-57036106 CAATTTGTCCAGAGGGCACTTGG - Intergenic
1150832557 17:68537208-68537230 GACGATCTCCTGAGTGCACTGGG - Exonic
1151996690 17:77613888-77613910 GTATATGCCCGGAGGGCACTGGG + Intergenic
1152631954 17:81414415-81414437 GGTTGGGTGCTGAGGGCACTAGG + Intronic
1153978057 18:10286822-10286844 GGTTTTGTCCCGAAGGCACTGGG + Intergenic
1155006014 18:21729816-21729838 GATTAGGTGATGAGGGCAATGGG - Intronic
1156549965 18:38005003-38005025 GATGTGCTCCTGAGGGCACTGGG - Intergenic
1160741393 19:687760-687782 GGTTTTGTCTTGAGGGCAATCGG - Intronic
1160881854 19:1324593-1324615 GTTTTTCTCCTGAGGGCACTGGG + Intergenic
1160905743 19:1450981-1451003 GAGCGTATCCTGAGGGCACTGGG + Intronic
1160954143 19:1682366-1682388 GGTTTTCTCCTCAGGGCACTGGG - Intergenic
1161242575 19:3230597-3230619 GACTCTTTCCTGAGGGCACTGGG + Intronic
1161641371 19:5425475-5425497 GACTTTCTCTTGAGGGCACTGGG - Intergenic
1161642766 19:5434786-5434808 GACTTTGTCCTGAGGGCGATAGG + Intergenic
1163124709 19:15238684-15238706 GATTAGCTCCTGAGGGAGCTGGG - Intronic
1163447010 19:17352841-17352863 GACTTTCTCCTGAGGGCACTGGG - Intronic
1163534427 19:17869042-17869064 GATTTTGTTCTGAGGGTGCTGGG - Intergenic
1165730749 19:38143181-38143203 AAGTTTATCCTGAGGGCACTGGG - Intronic
1165905650 19:39193021-39193043 ATTTTTCTCCTGAGGGCACTGGG + Intergenic
1166071480 19:40390491-40390513 GATTCTGTTCTGAGGGCACTGGG + Intergenic
1166219474 19:41355256-41355278 GACTTTATACTGAGGGCACTGGG - Intronic
1166963758 19:46515376-46515398 GGTGTTGTCTTGAGGGCACTGGG - Intronic
1167039347 19:47013423-47013445 CAGTGTGTCCTGAGGGCACTGGG + Intergenic
1167077698 19:47259295-47259317 GACTTTGTCCTGAGGGCACTGGG + Intronic
1167101160 19:47404984-47405006 GACTTTGTCCAGATGGCACTAGG + Intronic
1167213598 19:48149393-48149415 GATTTTCTCCTGACGGCTCTGGG + Intronic
1167539257 19:50074835-50074857 GACTCTGTCCTGGGGCCACTGGG - Intergenic
1167630450 19:50623023-50623045 GACTCTGTCCTGGGGCCACTGGG + Intronic
1167747978 19:51364010-51364032 GACTCTGTCCTGAGGGTGCTGGG + Intronic
1168534544 19:57158160-57158182 GATTGAGTCCTGTGGGCACCTGG + Intronic
925724264 2:6857979-6858001 GATTTTATTCTGAGTGCACTGGG - Intronic
927199738 2:20570943-20570965 GATTTTATCCTAAAGGCACTAGG + Intronic
931995756 2:67837750-67837772 AATTAGGTCCTGAGGCCATTGGG - Intergenic
933199804 2:79435834-79435856 GATTATGTTCTCAGTTCACTCGG - Intronic
934233008 2:90203488-90203510 GTATATGTTCTGTGGGCACTTGG + Intergenic
937417901 2:121731562-121731584 GAATTTATCCTGAGGGCAGTGGG - Intronic
937926351 2:127170637-127170659 GAATTTATCCTGAGGGCACTGGG + Intergenic
938982961 2:136544123-136544145 AATTTTGTCTTCAGGGCACTTGG - Intergenic
940063199 2:149595889-149595911 CATTATGTCCTGATGTTACTGGG + Intergenic
942406153 2:175657888-175657910 GCATATGTTCTGAGGGTACTTGG + Intergenic
942505801 2:176640098-176640120 AATTATGTCCTGAGATCATTTGG + Intergenic
946279859 2:218659152-218659174 GATTTTGTCCTGAGAGCAGCAGG + Intronic
1169474572 20:5919254-5919276 GATTATGCCCTGAGGTCTTTTGG + Intronic
1172471626 20:35202117-35202139 GTATATGTTCTGTGGGCACTTGG - Intergenic
1172471693 20:35202906-35202928 GTATATGTTCTGTGGGCACTTGG - Intergenic
1173189167 20:40863120-40863142 GATTTTGTCCTGAGGACAATGGG + Intergenic
1174321048 20:49741920-49741942 GATTTTTTCCTGAGGGCAATGGG - Intergenic
1178414031 21:32389343-32389365 GATTTTATCCTAAGGGCAGTGGG + Intronic
1182085966 22:27561399-27561421 GATTATGTCCTTGGGACACCTGG - Intergenic
1183476892 22:38040500-38040522 GACTAGATCCTGAGGGCAGTGGG + Intronic
949540100 3:5026260-5026282 GATTCTGCCCTGAAGGCACCCGG - Intergenic
955887365 3:63614783-63614805 GATTATTTCCAGATGGCACAGGG - Intronic
959682038 3:109106895-109106917 GATTTTATCCTGAGAGCATTGGG - Intronic
960203514 3:114867129-114867151 GATAATGTTCTGTGGGCACTCGG + Intronic
962220917 3:133564165-133564187 GTTTTTATCCTGAGGGCAGTGGG + Intergenic
966473057 3:180313779-180313801 GAGTTTGACCTGAGGCCACTTGG + Intergenic
966809463 3:183830475-183830497 GAGAAGCTCCTGAGGGCACTGGG + Intronic
969421717 4:7101635-7101657 CATAGTGTCCAGAGGGCACTGGG + Intergenic
970917394 4:21352006-21352028 AGTTATGTCCTGAGGCCATTTGG + Intronic
971181110 4:24329334-24329356 GATTTTATCCTAAGGGCAATGGG - Intergenic
974471094 4:62318848-62318870 AATCATGTCCTAAGAGCACTGGG - Intergenic
978616182 4:110598960-110598982 GATTATGCCCTGAAGTCTCTTGG + Intergenic
988987870 5:36638379-36638401 GATGAAGTGCTGAGGGCATTAGG - Intronic
991396474 5:66209525-66209547 GATTTTGCCCTGAGGGCACTGGG - Intergenic
995579526 5:113581057-113581079 GATCATGTCCTGAAGGCAGCTGG - Intronic
996652536 5:125897797-125897819 TATCATGTCCTGAAGGAACTTGG + Intergenic
997402681 5:133614209-133614231 GATTATGTAATAAGGCCACTAGG - Intergenic
997559948 5:134837577-134837599 GATTATGTCATGAGGGCTAGTGG + Intronic
999176488 5:149635421-149635443 GATTTTATTCTGAGGGCAGTGGG + Intergenic
999856115 5:155596124-155596146 GGTTATGTTCTAAGGGCTCTAGG + Intergenic
1000684835 5:164235671-164235693 GATTTTGTCCTAAGTGCAGTAGG - Intergenic
1001149537 5:169215114-169215136 GATGATTTCCTGAGGGCAATGGG - Intronic
1001929765 5:175664623-175664645 GATTTTGTCCTGTAGGCAGTGGG + Intronic
1001939271 5:175729236-175729258 GCCTCTGTCCTGAGGGCAGTGGG - Intergenic
1004841234 6:19587338-19587360 CATTATGTTCTGGAGGCACTGGG - Intergenic
1007563662 6:42831445-42831467 GATTAATTACTGTGGGCACTTGG + Intronic
1008746736 6:54679801-54679823 GATTAAATCCTGAGGGGAATAGG + Intergenic
1013847273 6:114468192-114468214 GATTAAGTCATGAGGGGATTTGG + Intergenic
1015110065 6:129582622-129582644 GATTATGTCCTGAGGGCACTTGG - Intronic
1018355567 6:163011318-163011340 GTTTATTTCCTGGGGGCAATCGG - Intronic
1018872245 6:167792141-167792163 GGTTCTGTCCTCAGGGAACTTGG - Intronic
1021401132 7:20210554-20210576 CATTATTTCCTGAAGGCAGTGGG - Intronic
1021617665 7:22519763-22519785 GAAAATGTCCTCAGGGCCCTGGG + Intronic
1022927258 7:35069253-35069275 GAAAATGTCCTCAGGGCCCTGGG + Intergenic
1024300357 7:47882770-47882792 GCTTTTGTCCTGAGTGCCCTAGG + Intronic
1024568722 7:50706718-50706740 GACTAGATCCTGAGGGCACAAGG + Intronic
1026455535 7:70569251-70569273 AATAATGTCCTCAGGGCACAGGG - Intronic
1028375010 7:90136341-90136363 GAAAATGTCCTCAGGGCCCTGGG - Intergenic
1028450720 7:90979387-90979409 GATTATGGAGTGATGGCACTGGG - Intronic
1030150314 7:106398086-106398108 TATTATTTCCTCAAGGCACTTGG + Intergenic
1030356611 7:108550369-108550391 CATTATGTCCTGAGAACAATGGG - Intronic
1030765793 7:113408208-113408230 GATTATATCCTAAGTGCAGTGGG - Intergenic
1032149672 7:129417396-129417418 GATTATATCCTGAGAGAACTAGG + Intronic
1032422941 7:131797737-131797759 GATGATGTACTTAAGGCACTTGG + Intergenic
1032783404 7:135182486-135182508 GTTTGTGACCTGAAGGCACTGGG - Intergenic
1034111594 7:148542658-148542680 GATTTTATGCTGCGGGCACTGGG - Intergenic
1039817477 8:41107227-41107249 GATTCTTTCCTGAAGGCTCTAGG - Intergenic
1041015750 8:53591644-53591666 CATCATGTCCTGAAGGTACTCGG - Intergenic
1041634099 8:60123142-60123164 AATCATGTCCTGAAGGCACCTGG + Intergenic
1044491062 8:92815541-92815563 GATTTTGTCCTGATGTCCCTGGG + Intergenic
1045490668 8:102666586-102666608 GATTAGGTCATGCGGGCTCTGGG - Intergenic
1045985543 8:108245801-108245823 TATTATGTGCTGAGAGCACAAGG + Intronic
1046336221 8:112791408-112791430 GATTATGTTTTCTGGGCACTTGG - Intronic
1047943556 8:129851216-129851238 GATTTTATCCTAAGGGTACTAGG + Intronic
1050050781 9:1599257-1599279 GATTTTGTCCTGAGCTCCCTTGG + Intergenic
1050423196 9:5488160-5488182 GATTAAGTTGTGAGGGCAGTTGG + Intergenic
1052262858 9:26538080-26538102 GATTTTGTCCTAAAGGCAATGGG + Intergenic
1053145922 9:35712036-35712058 GATAATGCCCTGAGGGCAGTTGG - Exonic
1055102229 9:72478055-72478077 GATAATGTCCTGGGGGCAGGAGG - Intergenic
1057303600 9:93900122-93900144 GACTTTGTCCTGGGGGTACTAGG - Intergenic
1059069185 9:111117581-111117603 TATTCTGTCCTCAGAGCACTTGG - Intergenic
1059514194 9:114877575-114877597 GATTATCTCCTGAGTTGACTGGG - Intergenic
1060401186 9:123350440-123350462 GACTGTGTCCTGAGGGCACTGGG - Intergenic
1060589527 9:124808110-124808132 GGTTCTGGGCTGAGGGCACTGGG + Intronic
1060826332 9:126690189-126690211 GATGGTCTCCTAAGGGCACTAGG + Intronic
1060994568 9:127868703-127868725 GACTTTCTCCTGAGGGCACTGGG - Intronic
1061988051 9:134141848-134141870 GAAGATTTCCTGAGGGCAATGGG + Intronic
1062388328 9:136323915-136323937 GATGATGTCATGAGGGGACTTGG + Intergenic
1186412002 X:9352085-9352107 GATTAACTCCTGAGCGCACTTGG - Intergenic
1187359331 X:18610131-18610153 GATTTTGTCCTGATGCCAATGGG - Intronic
1188366032 X:29316146-29316168 GGGAATGGCCTGAGGGCACTGGG - Intronic
1191134013 X:57044295-57044317 GAGCATGTCCTGAGGGCACAAGG - Intergenic
1192288165 X:69760932-69760954 AATTTTATCCTGGGGGCACTGGG + Intronic
1192928984 X:75784899-75784921 GATTGGCGCCTGAGGGCACTGGG + Exonic
1194588145 X:95763055-95763077 GATTACATCCTGAGGCCTCTTGG - Intergenic
1197719474 X:129735391-129735413 AATTCTGCCCTGAGGGCAGTGGG + Intergenic
1198376395 X:136044326-136044348 GACTTTATCCTGAGGGCAGTGGG + Intronic
1199519201 X:148716335-148716357 GATTCTTCCCTGGGGGCACTAGG - Intronic
1200075113 X:153546933-153546955 AATTGTGTCCTGACGCCACTGGG + Intronic
1202195292 Y:22294595-22294617 GAGGGTGTCCTGAGGGCACGTGG + Intergenic