ID: 1015111454

View in Genome Browser
Species Human (GRCh38)
Location 6:129596449-129596471
Sequence CAGAACAAGGGGAATTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1015111454_1015111461 -1 Left 1015111454 6:129596449-129596471 CCTTCCCAATTCCCCTTGTTCTG 0: 1
1: 0
2: 2
3: 27
4: 314
Right 1015111461 6:129596471-129596493 GTTGTTTTTATTACTTTTGGAGG 0: 1
1: 0
2: 4
3: 65
4: 956
1015111454_1015111460 -4 Left 1015111454 6:129596449-129596471 CCTTCCCAATTCCCCTTGTTCTG 0: 1
1: 0
2: 2
3: 27
4: 314
Right 1015111460 6:129596468-129596490 TCTGTTGTTTTTATTACTTTTGG 0: 1
1: 0
2: 3
3: 107
4: 1501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1015111454 Original CRISPR CAGAACAAGGGGAATTGGGA AGG (reversed) Intronic
900211796 1:1459809-1459831 CAAAATTAGGGGACTTGGGAGGG - Intronic
900224607 1:1527109-1527131 CAAAATTAGGGGACTTGGGAGGG - Intronic
902085624 1:13858879-13858901 GAGAAAAAGGGGACTTTGGAGGG + Intergenic
903036070 1:20493374-20493396 CAGAAGACGGGGAAGTGAGAAGG + Intergenic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
904698110 1:32341852-32341874 CACAACCAGGGGAAGGGGGAGGG - Intergenic
905683147 1:39889083-39889105 TAAAACAAGGGAAATTGGCAGGG + Intergenic
906515089 1:46434055-46434077 CAGTACTAGGGGAAGTGGGTAGG + Intergenic
908661066 1:66435675-66435697 CAAAACAAGGGGAATTGCACTGG + Intergenic
910315852 1:85882864-85882886 CAGAACAAGGAAAATTGTCAGGG - Intronic
911168394 1:94745398-94745420 CAGAGCAGTGGGAATGGGGATGG + Intergenic
911733049 1:101309707-101309729 AAGAACAAAGGGAAGTCGGAAGG - Intergenic
912489082 1:110051552-110051574 CAGTCCAAGGGAAACTGGGATGG + Intronic
912648919 1:111421189-111421211 CAGGACAAGGGGCAATGGCAAGG - Intronic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
914861147 1:151387195-151387217 CACAAAAAATGGAATTGGGAAGG + Intergenic
915606161 1:156952530-156952552 AAGGACAAGGGGAAATGGGGAGG + Intronic
915686689 1:157641189-157641211 TACAACAAGGGGAGCTGGGAGGG - Intergenic
916695492 1:167231775-167231797 CTGGACAAGAGGATTTGGGAAGG + Intronic
917682861 1:177385256-177385278 AAGAACAAGAGGAGTGGGGAGGG - Intergenic
918905710 1:190490144-190490166 CAGAAAGAGTGGAATTGGGAAGG - Intergenic
919182043 1:194098675-194098697 CAAAAGAAGGGAAGTTGGGAGGG - Intergenic
919491021 1:198204925-198204947 AAGAAGAAGGAAAATTGGGAGGG - Intronic
919645576 1:200091305-200091327 TACAACAAGGGGAGTGGGGAGGG + Intronic
919916114 1:202140435-202140457 CAGATAAAAGGGAATTGGGCTGG - Intronic
920214898 1:204355121-204355143 TTGAACAAGGAGACTTGGGAGGG + Intronic
920224732 1:204430177-204430199 CAGCACAGGAGGAATTGTGAGGG - Intronic
920857534 1:209675310-209675332 CAGAGCCAGGGGAACTCGGAGGG - Intergenic
921052386 1:211520133-211520155 AAGAACAAGGGGAATTGGCTGGG + Intergenic
921601721 1:217113360-217113382 CAGAAACAGGGGAGGTGGGATGG - Intronic
923230254 1:231979313-231979335 CAGATCAAGGGGGTTAGGGATGG - Intronic
923848763 1:237768865-237768887 CAGAACAATGGGAAGAGGGGAGG - Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
924843990 1:247746830-247746852 CAGAATAAGGGGACCTGAGAAGG - Intergenic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1065863210 10:29889233-29889255 AAGAACAATGGAAATTGGGAAGG + Intergenic
1066070780 10:31808594-31808616 TAGCACAAGGGGAAGCGGGAAGG - Intronic
1067925714 10:50506054-50506076 CAGGACAAGGGAGATGGGGAAGG - Intronic
1068795862 10:61079361-61079383 CAGAACAAGAGCATTTGGGGTGG + Intergenic
1069834273 10:71299021-71299043 GGGCACAAGGGGAAGTGGGAAGG - Intronic
1070037182 10:72737814-72737836 CAGAAAAAGGGGAAATAGGCTGG - Intronic
1070685410 10:78476822-78476844 CAGATCAAGGGTAATTGTGGAGG + Intergenic
1073075486 10:100823626-100823648 GAGAATAAGGGGAATCTGGAGGG + Intronic
1075616391 10:123893231-123893253 CAGACCCAGAGGAACTGGGAAGG - Intronic
1077238999 11:1500906-1500928 CAGAGCGAGGGGAAGTGGGGAGG - Intronic
1077597255 11:3544671-3544693 CAAAACATGGGAAATAGGGAAGG + Intergenic
1077973750 11:7224150-7224172 CAGACCAAGTGGAATGGGGGCGG - Intergenic
1078156056 11:8801080-8801102 GAGCAGAATGGGAATTGGGAAGG - Intronic
1078179583 11:8999887-8999909 CAGGGTAAGGGGAATAGGGAAGG - Intronic
1078266137 11:9757560-9757582 CAGGACATGAGGCATTGGGATGG - Intergenic
1078702912 11:13705906-13705928 CAAAACAATGGGGATAGGGAGGG - Intronic
1081878541 11:46428175-46428197 AAGAAGAAGGGGAATGGGGAGGG + Intronic
1081986204 11:47306172-47306194 CAGCCCAAGGGGAGTGGGGAGGG + Intronic
1082013884 11:47469898-47469920 GAGAAGAAGGGGATGTGGGAAGG + Intronic
1082044883 11:47717049-47717071 CAGAACAAGTGCAATTCAGAAGG - Exonic
1083544545 11:63538650-63538672 CAGGACATGGAGAAGTGGGAAGG + Intronic
1084215371 11:67644573-67644595 CAGGGCCAGGGGAAGTGGGATGG + Intronic
1086400398 11:86456731-86456753 CAGAACAATGGGAAATCTGATGG + Intronic
1087022781 11:93619903-93619925 CAAAACAATGGGAATGGGGGAGG - Intergenic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1088154967 11:106791337-106791359 TACTACAGGGGGAATTGGGAAGG + Intronic
1088416493 11:109594953-109594975 AAGATCAAGGGCATTTGGGAAGG + Intergenic
1088709157 11:112491175-112491197 CAGAAGAGGGGGAATGGGTAGGG + Intergenic
1089024203 11:115251442-115251464 CAGAAAATTGGGAAGTGGGAGGG + Intronic
1089334361 11:117712968-117712990 CTGCAAAAGGGGAGTTGGGAAGG - Intronic
1089604537 11:119634308-119634330 CCGAGCGAGGGGAATTGAGAAGG + Intronic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1089677813 11:120102102-120102124 CAGAACCAGGGCCAATGGGAAGG - Intergenic
1089881722 11:121780517-121780539 CAGTAAAAGGGGAAATGAGAAGG - Intergenic
1090593723 11:128298100-128298122 CTGAAAAAGGGCAAATGGGAAGG + Intergenic
1091080083 11:132658315-132658337 GAGAACACGGGGAATAGGCATGG + Intronic
1091202897 11:133795763-133795785 CAGAACAAGAGGAAGAGGCAGGG + Intergenic
1091369281 11:135045147-135045169 GAGATCAAGTGGAATTGGGGAGG - Intergenic
1091565358 12:1644170-1644192 CAGACCCAGGGCATTTGGGATGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1093281695 12:17203738-17203760 CAGAGCAAGGGGGATGGGGGGGG - Intergenic
1093844455 12:23951353-23951375 CAAAATAAAAGGAATTGGGAGGG - Intergenic
1094523699 12:31218390-31218412 AAGGACAAGGGGAAAGGGGAAGG + Intergenic
1096356084 12:50942176-50942198 CAGAACAAGGGAACATGGGCCGG - Intergenic
1096749450 12:53749403-53749425 CAGACTAAGGGGAAATGGGGAGG + Intergenic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1097693109 12:62752666-62752688 CAGGAAAAGGGGATTTGGCATGG - Intronic
1097765423 12:63521054-63521076 CAAAACGAGGGAAATTGGGAGGG + Intergenic
1098029388 12:66238552-66238574 CAGAGACAGGGAAATTGGGAAGG + Intronic
1098909830 12:76197596-76197618 AAGAACAATGGGAGTGGGGAGGG + Intergenic
1099963166 12:89416356-89416378 CAATATAAGTGGAATTGGGAAGG + Intergenic
1100121918 12:91378482-91378504 CAGAATAAGGGGAAGTTTGAGGG - Intergenic
1100412450 12:94334316-94334338 CAGATAAAGGTAAATTGGGATGG - Intronic
1100587412 12:95993015-95993037 CCCAAAAAGGGGAATTGAGAAGG - Intronic
1100739080 12:97571278-97571300 CAGAACAACCTGAAATGGGAAGG - Intergenic
1101980282 12:109399967-109399989 CAGAACAGTGGGCAGTGGGAAGG - Intronic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102252158 12:111394733-111394755 CAGCCCAAGGGGACTTGGGCAGG - Intergenic
1102827216 12:115958932-115958954 CAAAAAAAGGGGAAATGGGGAGG - Exonic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103955418 12:124573798-124573820 CAGAACATGGGGGATTGGCGGGG + Intergenic
1104352196 12:128054390-128054412 CAGAAGGAGGGGAATTCGGGAGG + Intergenic
1104907340 12:132220609-132220631 CAGAACCAGGGGAATTTCCAGGG + Intronic
1105957326 13:25296184-25296206 CAGAGCAAAGGGAATTGGGCAGG + Intergenic
1106219422 13:27733380-27733402 CAGGGCAAGGGGACATGGGATGG - Intergenic
1107217053 13:37934328-37934350 CAGCACAAGGAGAATGGAGAAGG + Intergenic
1108081146 13:46737522-46737544 CAGCACAAAGGGATGTGGGATGG - Intronic
1108747871 13:53413578-53413600 CAGAACCAGTAGAATTGAGAGGG - Intergenic
1109350079 13:61169044-61169066 CAGAATAAGCCCAATTGGGAAGG + Intergenic
1111378962 13:87420535-87420557 CAGAACAAGGTGTATTGGGATGG + Intergenic
1112052912 13:95662104-95662126 CAGAGCAGGAGGAATAGGGAGGG - Intergenic
1114196827 14:20485499-20485521 CTGAACAAGGGGAATGGTGATGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114544474 14:23488436-23488458 CAGAAGAAGGGGGGATGGGATGG + Intronic
1116006129 14:39293365-39293387 CTGAACAAGATGAATTGGTAAGG + Exonic
1117848599 14:59941631-59941653 CACAACAAGAGAACTTGGGATGG - Intronic
1119385099 14:74253106-74253128 CAGGACAAAGTGAGTTGGGAGGG - Intronic
1119542516 14:75450083-75450105 ATGGACAAGGGGAGTTGGGAGGG + Intronic
1120844675 14:89115531-89115553 CAGAAAAATGGAATTTGGGAAGG + Intergenic
1129797255 15:78387227-78387249 CAGACCTAGGAGAAGTGGGAAGG + Intergenic
1130299180 15:82667072-82667094 CAGAACAAGGGCAGGTGGGGAGG - Intronic
1130335454 15:82953375-82953397 TAGAGCGAGGGGAATTAGGATGG + Intronic
1131031094 15:89186560-89186582 CAGAAGCAGGAGAATTGAGATGG - Intronic
1131740881 15:95390103-95390125 TAGAATAAGGGGACTTGGCATGG + Intergenic
1132906789 16:2286574-2286596 CAGACCCAGGGGCTTTGGGAGGG + Intronic
1133649024 16:7791979-7792001 CAGAATAAGGGTTATTGGCATGG + Intergenic
1133880770 16:9779554-9779576 AAGAAAAAGGGGAATGGAGAAGG + Intronic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1135064565 16:19298693-19298715 CAGAACAGGGGGCACAGGGAAGG - Exonic
1135139383 16:19908525-19908547 CATGAGAAGTGGAATTGGGAAGG + Intergenic
1135181855 16:20281757-20281779 CAGATCAAAGGGGATTGAGATGG + Intergenic
1135679210 16:24442421-24442443 CATAACAAGGGGCATTTTGAAGG + Intergenic
1137968830 16:52963470-52963492 CAGAGCCAGGGGAATGGGGTGGG - Intergenic
1140042256 16:71415938-71415960 CTGAAATAGGTGAATTGGGAGGG - Intergenic
1140286592 16:73608237-73608259 AAGCACATGGGGAAATGGGAAGG - Intergenic
1140980112 16:80100419-80100441 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1142503695 17:349223-349245 GAGAACTAGGGTAATTGGGCAGG + Intronic
1143628331 17:8123283-8123305 CTGATCTAGGGGCATTGGGAGGG - Intronic
1143871312 17:9959018-9959040 CAGGAGAAGGGGAGGTGGGAGGG + Intronic
1143936474 17:10490754-10490776 AGCAACAAGGGGAATTGAGAGGG + Intergenic
1145276256 17:21433005-21433027 TAGAAAAATGGGAGTTGGGAAGG - Intergenic
1145314098 17:21718919-21718941 TAGAAAAATGGGAGTTGGGAAGG - Intergenic
1145712545 17:26990896-26990918 TAGAAAAATGGGAGTTGGGAAGG - Intergenic
1145965390 17:28913084-28913106 CAGGACAAGGGGTAGTGGGAAGG + Exonic
1146558293 17:33846446-33846468 CAGAACAAGGCCAATTATGAAGG - Intronic
1147536927 17:41327501-41327523 CAGGACAATGGAAAGTGGGAGGG - Intergenic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1149970974 17:61218074-61218096 CAGAACAAGAAGAACTGAGATGG + Intronic
1150640398 17:66945848-66945870 GAGAACCACGGGGATTGGGAAGG + Intergenic
1151297902 17:73199061-73199083 CAGTACAAGGGGCCTTGGGAGGG + Intronic
1151833422 17:76569040-76569062 CAGACCGGGGGGAGTTGGGAAGG + Intronic
1152077360 17:78168098-78168120 CAGACCAGGAGGAATGGGGAGGG + Intergenic
1152299433 17:79486455-79486477 CAGAAGAAGGGGAGTTGAGGAGG - Intronic
1153335689 18:3922045-3922067 CAGGAGACAGGGAATTGGGAAGG + Intronic
1157027864 18:43868216-43868238 CAGACCAAAGGGAATTAGGAAGG - Intergenic
1157686890 18:49650137-49650159 CAGGACTAGGGGAAGAGGGAAGG + Intergenic
1159960865 18:74555042-74555064 GAGAACAAGGGGAACTAGGCTGG - Intronic
1160838754 19:1136977-1136999 CAGCACCTGGGGAATGGGGATGG + Intronic
1161856207 19:6767340-6767362 CAGAACCAGGATTATTGGGATGG - Intronic
1162788027 19:13047889-13047911 CGGAACAAGAGGACCTGGGAAGG - Intronic
1162857055 19:13476846-13476868 CAGAAGCTGGGGAATTAGGAAGG - Intronic
1165831717 19:38733867-38733889 CAGAAGAAAGGGAGTTGGGATGG - Intronic
1166825679 19:45607501-45607523 CAGAACCTGGGCAATGGGGAAGG + Intronic
1167882413 19:52471029-52471051 CAGAACAGGAGGAAGTGGGTGGG - Intronic
1168139256 19:54374397-54374419 CAGAACTAAGGGAACTGGGAGGG - Intergenic
1168158756 19:54493844-54493866 CAGAACTAAGAGAACTGGGAGGG + Intergenic
926828382 2:16932768-16932790 CAGAAAAGGGGGAAGAGGGAAGG - Intergenic
927811021 2:26180152-26180174 CAGAACAAGGGGAAATGACTAGG - Intronic
927907892 2:26875166-26875188 CAGAATAAGGCAGATTGGGAAGG + Intronic
929531521 2:42755969-42755991 GTGCACAAGGGGAATTGTGAAGG - Exonic
929938965 2:46315828-46315850 TAGCACAAGGGGAGTTGGGAAGG + Intronic
930855065 2:56006870-56006892 CAGAACAAGGAAAGTTAGGAGGG - Intergenic
931799767 2:65747434-65747456 CAAAGCAAGGGGGAGTGGGACGG - Intergenic
934571102 2:95373970-95373992 CTGAACAAGGGGATATAGGAGGG - Intronic
934716773 2:96549291-96549313 GAGAACAGGAGGCATTGGGATGG - Intronic
935427388 2:102934295-102934317 AAGAAGAAGGGGAAATGGCATGG + Intergenic
935598322 2:104897093-104897115 CAGAAGTAGAGGAATTGGGAAGG + Intergenic
936800456 2:116259146-116259168 GAGAAAAATGGGATTTGGGAGGG - Intergenic
938064037 2:128271531-128271553 CAGAACACGGGGAAATGCGAGGG + Intronic
938391977 2:130914056-130914078 CAGAACAAGTGGAGCAGGGATGG + Intronic
938556412 2:132428730-132428752 TAGAAAAGGGTGAATTGGGAAGG + Intronic
939668566 2:144980780-144980802 GAGAAAAAGGAGATTTGGGAAGG - Intergenic
940023540 2:149181125-149181147 CAGATGAAGGGGAATTGAGAGGG - Intronic
940097433 2:149993419-149993441 GAGCACCAGGGGATTTGGGAAGG + Intergenic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
942453057 2:176120586-176120608 GAGATCAAGGCGAAGTGGGATGG - Intergenic
944320293 2:198332547-198332569 CATAAGAAGGGGAGGTGGGATGG + Intronic
945966551 2:216193586-216193608 GAGAACAAAAGGAATTGGAATGG + Intronic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946762720 2:223010962-223010984 CAGGAAAAGTGGAAGTGGGAGGG + Intergenic
947453311 2:230228653-230228675 CAGAACAAGGAAAATTGTCAGGG - Intronic
947544794 2:231003061-231003083 CTGGACAAGAGGAAATGGGAGGG + Intronic
947747294 2:232515143-232515165 CAGCCCATGGGGAATAGGGAAGG + Intergenic
1169080799 20:2796830-2796852 CATAATAAGGGAAAGTGGGATGG + Intronic
1169342281 20:4805585-4805607 GAAAACAAGGGGAATTCCGAGGG + Intronic
1170798765 20:19572697-19572719 CTGAACAAGAGGATTTGGGGTGG - Intronic
1171071505 20:22073175-22073197 CAGAGGATGGGGAAATGGGATGG + Intergenic
1171275300 20:23851756-23851778 TAGGCCAAGGGGAAATGGGAAGG - Intergenic
1171773929 20:29348663-29348685 AAGAACAAAGGGAAATGTGAAGG + Intergenic
1171815936 20:29786216-29786238 AAGAACAAAGGGAAATGTGAAGG + Intergenic
1172484649 20:35291053-35291075 CAGGAGAAAGAGAATTGGGAGGG - Intronic
1172539162 20:35697994-35698016 CAGAACAATCCGAGTTGGGATGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174373497 20:50110329-50110351 CAGAACCAAAGGAAGTGGGAAGG + Intronic
1174890857 20:54390587-54390609 CAGAAGCAGGGGAAATGGCAGGG - Intergenic
1175057117 20:56208659-56208681 TAGACCAGGGGGACTTGGGATGG - Intergenic
1175110094 20:56641780-56641802 CAGGGCAAGGGGAAAAGGGAGGG - Intergenic
1175193271 20:57225297-57225319 CAGAATTAGGGGAATTGGCTCGG + Intronic
1175689110 20:61052952-61052974 CAGAGGAAGGGGAATTGGCCCGG + Intergenic
1175756401 20:61533136-61533158 GAGAAGAAGGGGACTTGGGTTGG + Intronic
1177478549 21:21655729-21655751 CAGAGCAAGGTGCTTTGGGAAGG - Intergenic
1177967980 21:27752192-27752214 GAGAACAAGTGGAATTTGAAAGG + Intergenic
1178013046 21:28308646-28308668 GAGTACAAGGGGAAGTGGAATGG - Intergenic
1180319388 22:11306780-11306802 AAGAACAAAGGGAAATGTGAAGG + Intergenic
1181476964 22:23174456-23174478 GAGAACAAGGGAAATTGAGGGGG + Intergenic
1182064009 22:27417668-27417690 CAGAAGAGGGTGATTTGGGATGG - Intergenic
1183781476 22:40001861-40001883 TAGAGGTAGGGGAATTGGGAGGG + Intronic
949547695 3:5086193-5086215 CAGAGCAATGGGAATGGAGAAGG + Intergenic
951073469 3:18361028-18361050 CAGAACAAGATGAATTAGCAGGG + Intronic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
951927484 3:27924479-27924501 CAGAAGAAGAGGAAATGGAAAGG + Intergenic
953607986 3:44424374-44424396 CAGACCCAGGGGAGTAGGGAGGG - Intergenic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
954654184 3:52183958-52183980 CACAAGAAGGGGAAGAGGGAGGG + Intergenic
955726782 3:61941713-61941735 CAAAAAAAGGGGAAGTTGGAGGG - Intronic
956488390 3:69745451-69745473 CAGAGGAAGGGGAACTGGGGAGG + Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
959450508 3:106493427-106493449 CAGAAAAATGGGAATTTGAATGG - Intergenic
961022367 3:123519022-123519044 CAGAGCAAGAGGAAGTGAGAGGG + Intronic
961285722 3:125800929-125800951 CAAAACATGGGAAATAGGGAAGG - Intergenic
962206560 3:133439785-133439807 TAGGACAAGGGGACATGGGAAGG + Intronic
962383898 3:134917347-134917369 CAGAGCATGGGGACATGGGAAGG - Intronic
962635760 3:137329995-137330017 AAGAAAATGGGGAATTGGGAAGG + Intergenic
962978817 3:140469603-140469625 CAGAACAGTAGGAATGGGGATGG - Intronic
963015591 3:140821032-140821054 CATAAAAAAGGGATTTGGGAAGG + Intergenic
963158803 3:142128717-142128739 CAGAAGCAGGGGATTTGGGGAGG + Intronic
963888172 3:150603716-150603738 TAGAACAGTGGGAATGGGGAAGG + Intronic
965776635 3:172238607-172238629 CAGCACAAGGGGGATTGGCTAGG + Intronic
965922301 3:173931830-173931852 GAGAAAATGGTGAATTGGGAAGG + Intronic
966035473 3:175408107-175408129 CAGAAACAGGGGAAAGGGGAAGG + Intronic
966171780 3:177089725-177089747 CAGAACAAGAGGAAATAGAAGGG + Intronic
966816887 3:183896740-183896762 CAGAACGAGGAGAAATGGAATGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967697516 3:192550134-192550156 TAGAAAAAAGGAAATTGGGATGG + Intronic
969556853 4:7917763-7917785 CAGAACCAGAGGAGTTTGGAAGG - Intronic
972362841 4:38344938-38344960 CAGAACAGGGTGAAAGGGGAAGG - Intergenic
972684761 4:41341482-41341504 CATCACTAGGGGAATTGTGATGG - Intergenic
976888865 4:90020466-90020488 CAGAAGAAGAGGGATTAGGAAGG - Intergenic
977805639 4:101294135-101294157 CAGAAGAAGTGGAATGGAGATGG + Intronic
978595605 4:110374041-110374063 CATGACAGAGGGAATTGGGAAGG + Intronic
979044583 4:115845862-115845884 AAGAACAAGAGTAATTGGAAAGG + Intergenic
979396108 4:120191564-120191586 TAGGACAAGGGGAAGAGGGAAGG - Intergenic
981554545 4:145978548-145978570 CAGAAAAAGAGCAATTTGGAAGG - Intergenic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
982076788 4:151745692-151745714 CAGAATAAGGGGAATGAAGAGGG - Intronic
982436356 4:155385698-155385720 CAGGACTAGGGGCACTGGGAGGG - Intergenic
982663961 4:158238318-158238340 CAGATAAAGGAGAATTTGGAGGG + Intronic
982754793 4:159205242-159205264 CAGAAACTGGGGAATTGGGTGGG + Intronic
984392780 4:179158254-179158276 CATAACAAGGGGAATATGGATGG + Intergenic
985475836 5:78558-78580 CAGGACAAGAGGAAATGGGTTGG - Intergenic
986623959 5:9706300-9706322 CAGAACCAGGGGAACTGGCCTGG + Intronic
988092118 5:26556601-26556623 CAGAACTAGGGAAATTGCAATGG + Intergenic
990315734 5:54581588-54581610 CAGAACAAGGGAAGAAGGGAGGG - Intergenic
990389908 5:55308098-55308120 AAGGACAAGGGGAAATGGAAGGG + Exonic
994860638 5:105188147-105188169 AAGAACAAAGGGAATGGAGAAGG - Intergenic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
998217921 5:140251443-140251465 CAGGACATGGGAAATTGGGGTGG - Intronic
998612252 5:143702065-143702087 AATGACAAGGGGGATTGGGAGGG + Intergenic
999526702 5:152414227-152414249 CAGAAAAAGGGGAGTTGCAATGG - Intronic
999766980 5:154748591-154748613 CAGGACAAGTGGAAGTGGAAAGG + Intronic
1000055499 5:157602577-157602599 CAGAAGAAGGGGGATGAGGAAGG + Intergenic
1003235146 6:4288776-4288798 CAGCAGAAGGGAAGTTGGGAAGG + Intergenic
1003558062 6:7158294-7158316 GGGAACAAAGGGAATAGGGAGGG - Intronic
1003624713 6:7730138-7730160 AGGAATAAGGGGAATTTGGAGGG - Intronic
1003637062 6:7842099-7842121 CACAACAAGGGAAAGGGGGATGG - Intronic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1008810027 6:55485202-55485224 CAGAAGATGGGAAATTTGGAGGG - Intronic
1010581702 6:77607045-77607067 AAGACCAAGGGGAAATGGGCAGG - Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1014003657 6:116392719-116392741 CAGAACAAAGGCAATGGGAAAGG - Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1016164604 6:140924879-140924901 TAGAACAAGGGGAAGAGAGAGGG + Intergenic
1017096888 6:150812567-150812589 CAGAAAAAGGGGGATTAAGAAGG + Intronic
1018388773 6:163327647-163327669 CAGCAGAAGAGGAAATGGGAGGG - Intergenic
1018704267 6:166450948-166450970 CAGAACAATGGGAAGTGTGAGGG + Intronic
1018882049 6:167893778-167893800 CAGAACACGCGGAATAGGGAAGG - Intronic
1018979546 6:168592160-168592182 GAGAACTAGGGAAATAGGGAAGG - Intronic
1019378367 7:708265-708287 GAGATCAAGGTGTATTGGGATGG - Intronic
1020376528 7:7493658-7493680 AAGAAAAAGGGGAAATGGGAAGG - Intronic
1020534147 7:9372999-9373021 CAGAAACAGGGGAAGTGGGAGGG - Intergenic
1021555964 7:21918316-21918338 TAGAAGAAGGGGAGTTGGGTCGG - Intronic
1024477788 7:49832112-49832134 CAGAAAAATGGGAATTTGCAAGG + Intronic
1025036052 7:55593046-55593068 CAGAATGAGAGGAATTGGGGTGG - Intergenic
1026440308 7:70438233-70438255 CGGAATAATGGGTATTGGGAAGG + Intronic
1026878598 7:73893999-73894021 CAGGACCCGGGGACTTGGGAAGG + Intergenic
1026938016 7:74270184-74270206 CAGGTCAAGGTGATTTGGGAGGG + Intergenic
1027137052 7:75631915-75631937 CAGGAAATGGGGAAGTGGGAGGG + Intronic
1030101779 7:105953127-105953149 CAGAACACGTGGAATTTGGCTGG + Intronic
1033232948 7:139616031-139616053 CAGACCATGGGGAATGTGGAGGG - Intronic
1034918572 7:155060518-155060540 AAGGACTAGGGGAATTGTGATGG + Intergenic
1034944920 7:155255652-155255674 AAGAAGAAGGGGAAAGGGGAAGG + Intergenic
1034993266 7:155561282-155561304 AAGAGAAAGGGGAATGGGGATGG + Intergenic
1035884957 8:3281694-3281716 CAGAACACAGGGAATTGTTAGGG + Intronic
1035886452 8:3296352-3296374 CAGAGGAAGGGGGACTGGGAAGG + Intronic
1037572996 8:20174207-20174229 CAGAAATAAGGGAATTGGGCTGG - Intronic
1037859107 8:22392224-22392246 CAGAAGATGGGGAACTAGGAAGG + Intronic
1038471576 8:27827830-27827852 CATAAGAAGGGGAAGTGGCAGGG - Intronic
1041444808 8:57939306-57939328 CAAAACAAGTGGATGTGGGACGG - Intergenic
1042187553 8:66152157-66152179 GAGAACAAGGAGGATAGGGATGG + Intronic
1043064666 8:75553338-75553360 TAGAACAAGGTGAATGGGTAAGG - Intronic
1045832424 8:106479535-106479557 CAGTACCAGGGGGATTGGGGTGG - Intronic
1047392031 8:124459987-124460009 AAGAGAAAGGGGAATTGGGATGG - Intronic
1048517830 8:135126428-135126450 CAGAGGGAGGGGAATTGGGTGGG - Intergenic
1049224426 8:141442977-141442999 CAGAAGAAGGGGACTTGGTGGGG + Intergenic
1049604903 8:143524755-143524777 GGGAACAAGAGGAATAGGGAGGG + Intronic
1050569987 9:6927812-6927834 GAGAAGAATGGGAAGTGGGAAGG - Intronic
1050656529 9:7834507-7834529 AAGAAAAGGGAGAATTGGGAGGG - Intronic
1051562345 9:18455975-18455997 GAGAACAAGTTGAAATGGGAGGG - Intergenic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1054718687 9:68582349-68582371 CAGAACAAGGTGACCTGGCAGGG + Intergenic
1055858267 9:80718052-80718074 CAGGAGTAGGGGAAATGGGAAGG - Intergenic
1056414884 9:86366484-86366506 GAGTACAGGGGGAATTGGAATGG + Intergenic
1057546391 9:96022318-96022340 CAGGCTAAGGGGAATTGGGTAGG + Intergenic
1058541134 9:106013817-106013839 CAGAAAAAGGTGACTAGGGAAGG + Intergenic
1058602620 9:106686805-106686827 CAAAAGAAGGGGAACTGGCAGGG + Intergenic
1059777377 9:117489054-117489076 CAGAAGAAGAGGAACTGGGCTGG - Intergenic
1059981172 9:119773616-119773638 AAGAACTACGGGACTTGGGAGGG - Intergenic
1060808626 9:126595736-126595758 CACAACAGGGGAAACTGGGAGGG - Intergenic
1061043504 9:128152599-128152621 CAGAACAAGGGGGCCTGGGAGGG - Intronic
1061081434 9:128373074-128373096 CAGAAAAAGGGCAATTGTGCTGG - Intronic
1062123625 9:134847875-134847897 GAGAGGAAGGGGAAGTGGGAGGG + Intergenic
1203367623 Un_KI270442v1:272530-272552 AAGAACAAAGGGAAATGTGAAGG + Intergenic
1185975399 X:4714224-4714246 CAGCAGAAGGGGAACTGGAAAGG - Intergenic
1189906829 X:45769969-45769991 CAGAACAAGGGGGGTGGGGGGGG + Intergenic
1189914487 X:45843346-45843368 AAGAACATGGGGCAGTGGGAGGG + Intergenic
1190511037 X:51174714-51174736 CTGAAGAGGGGGAAATGGGAAGG + Intergenic
1192084805 X:68085606-68085628 TATAACTAGTGGAATTGGGAAGG + Intronic
1192726216 X:73755620-73755642 CAGAAGAAGGGAGAGTGGGAGGG - Intergenic
1193307501 X:79966613-79966635 CAGAAGAAGTGAAGTTGGGAGGG - Intergenic
1193547427 X:82846920-82846942 CAGAGCAGGAGGAAGTGGGAGGG - Intergenic
1195255333 X:103084282-103084304 GAGAACAGGGGGAATTGTGTTGG - Intronic
1196023276 X:111012574-111012596 CAATAAAAGGGGAATTGGAAAGG + Intronic
1196143668 X:112293593-112293615 AAGATCAAAGGGAGTTGGGATGG + Intergenic
1198187463 X:134267248-134267270 AAGGACAAGGGGAAGTGGCAGGG + Intergenic
1198278325 X:135118084-135118106 GAGAACACAGGGAATTGGGGAGG + Intergenic
1198292637 X:135254432-135254454 GAGAACACAGGGAATTGGGGAGG - Intronic
1198298537 X:135310627-135310649 GAGAGCACAGGGAATTGGGAAGG - Intronic
1201071070 Y:10147737-10147759 AAGAACAAAGGGAAATGTGAAGG - Intergenic
1201610363 Y:15836090-15836112 CAGAACACTGGGCATTGGAATGG + Intergenic